Plant Breeding In Post Genomics EraProceedings Proceedings of Second National Plant Breeding Congress March 1-3, 2006 Jointly organized by Indian Society of Plant Breeders & Tamil Nadu Agricultural University Coimbatore 641 003, India Plant Breeding in Post Genomics Era Plant Breeding in Post Genomics Era Proceedings of the Second National Plant Breeding Congress March 1-3, 2006 Coimbatore, INDIA Jointly organized by Indian Society of Plant Breeders & Tamil Nadu Agricultural University Coimbatore 641 003, India The organizers and publishers take no responsibility of the contents of papers presented and included in this publication Publication No. 2 Published by the Indian Society of Plant Breeders Coimbatore 641 003 Editorial Committee Convenor Dr. T.S. Raveendran Members Dr. S.R. Sree Rangasamy Dr. M. Kadambavanasundaram Dr. N. Nadarajan Dr. P. Vindhiya varman Dr. P.Sumathi Dr. J.R.Kannan Bapu Dr. S.Ganesh Ram Dr. M.Kumar Dr. K.K.Vinod Printed at M/s. Laser Park, Coimbatore Foreword Agricultural research has made great strides in terms of innovations and development of viable, applicable and relevant technologies. These technological advancements were responsible for increasing productivity and production and made India an exporting country from the status of importing country. Nevertheless, we cannot be complacent and have to constantly work for enhancing the production to feed the population which increase every day. The estimated requirement of food grains for 2020 AD it is 300 million tonnes and by 2050 AD is 400 million tonnes as against the present production of 210 million tonnes with the rider of shrinking land and water resources. Among all the technologies responsible for overall agricultural production, improved varieties acclaim top most importance as they have a direct bearing on the production. From a simple procedure of mass selection during early 20th century, the crop improvement technologies have very steadily and rapidly evolved to the present stage of molecular breeding through the untiring efforts of Geneticists and Plant Breeders. During this transformation, a large volume of scientific data would also be generated, which on interpretation, provide the younger generation precise guidelines and directions on how to proceed the programmes in future. Such informations are constantly and periodically discussed in many scientific fora by scientists involved in crop improvement. The Indian Society of Plant Breeders a Forum registered under Societies Act, is striving hard for the scientific upliftment in the field of Plant Breeding and Genetics by organizing such Congresses, special lectures for the benefit of students and scientists and supporting meritorious students through fellowship programme and providing travel grant for attending seminars etc. This is the Second National Plant Breeding Congress organized by the Society to document the research findings and information generated after 1998, when it conducted the First National Plant Breeding Congress. Classifying the 305 papers contributed for the seminar, under six important titles such as, crop biodiversity, quantitative genetics, ploidy variations, hybrid breeding, in vitro breeding tools and genomics. The editors have chosen invited papers and presentations to cover the entire gamut of crop improvement and presented in a lucid form and assimilation of scientists particularly the younger group. I hope the reader will make the best of the information available in this book. I congratulate the editorial committee for bringing out this informative and useful publication for the benefit of researchers and students. Coimbatore iii Prof. C. Ramasamy Vice-Chancellor iv PREFACE The science of plant breeding has great antiquity and is the most useful branch of science to the mankind. Though it was a simple procedure of selection of desirable plants for further perpetuation and utility to human community, the recent plant breeding procedures are technologically highly advanced and packed up with strong genetic base. Thus today, the methods are complicated but very efficient and precise to yield the desired results. The scientists engaged in crop improvement activities should also keep themselves abreast of the latest developments in Genetics, Cytogenetics, Genomics, Plant Breeding and Biotechnology. Besides, they should also listen to the socio-economic preferences and adjust to the IPR system. The Indian Society of Plant Breeders was started at the Tamil Nadu Agricultural University during 1998 with a view to promote the interest of Plant breeders and to provide a common platform for exchange, discuss and disseminate the latest knowledge and developments to the end-users. The society organized the First National Plant Breeding Congress in July 1998 with the primary objective of taking stock of the developments made during 20th century and to programme the crop improvement technologies during 21st century. Now, this second congress was organized jointly with the Tamil Nadu Agricultural University, Coimbatore to consolidate the research information generated during the last eight years in the field of crop diversity, heterosis breeding, ploidy breeding, biometrical and quantitative genetics and biotechnological approaches. There was overwhelming response from the scientists and more than 300 papers were received. The editorial committee carefully selected 46 articles including 11 invited papers for oral presentation and allotted 259 for poster presentations. There were 311 registered participants including scientists from SAUs, CSIR, ICAR and GOI institutes, International institutes and postgraduate and research scholars. A few represented private institutions too. There was also a special panel discussion on IPR issues which was valued by the participants. The Editorial Committee deem it a honour to publish all the oral presentation papers in this proceedings, the abstracts being printed and distributed to the participants on the inauguration day of the congress. The proceedings also contains the recommendations of the six technical sessions for easy follow up of the future program. The Editorial committee thank all the participants for their cooperation in sending the papers, revising them in the light of editors comments and sending back in time. The committee also thank the President, Secretary and Organizing Secretary of the Congress for their help. The committee also acknowledges the cooperation of the press M/s. Laser Park, Coimbatore in bringing out this publication in a nice way. The committee believes that this book will be very much useful to all the scientists engaged in crop improvement programmes including students and research scholars. Coimbatore 09.02.07 v Editorial Committee the plant breeders felt that a common forum. subsequently there was a change in this trend and the plant breeding science. the importance of crop breeding which formed the backbone activity of all the agricultural research stations and the institutes was well recognized. To promote the general advancement of plant breeding science. millets (1923). Therefore. Subsequently breeding stations for sugarcane (1912). started to lose its prime importance. However. 5. With the above idea in view. which can rejuvenate the interests of the breeders and revitalise the activities would be necessary. discussion and dissemination of current development in the field of plant breeding to its members. School of Genetics (presently known as Centre for Plant Breeding and Genetics). The first breeding station in Tamil Nadu was established in 1901 at Kovilpatti to take up breeding work in cotton and millets. to create a common platform to bring together and facilitate the exchange of Information and provide opportunities for its members to establish a firm link between the plant breeders in India and abroad. Establishing a literature communication service to plant breeders. paddy (1913). Rangaswamy. 4. Coimbatore to start a forum for the plant breeders for encouraging the plant breeders serving in various capacities in different public and private sector institutions with the following objectives. To provide a medium for the exchange. vi . it was decided by a group of breeders headed by Dr. To encourage scientific and technological research on various aspects of plant breeding. During this period. A separate department for forage crops was started in 1976. 1. 6. 3. To promote the profession of plant breeding and increase professional competence in developing improved varieties and hybrids in different crops. Director.INDIAN SOCIETY OF PLANT BREEDERS The commencement of crop breeding research work in Tamil Nadu dates back to 1870 when an exotic cotton variety was introduced in India from Mauritius. M. oilseeds (1930) and pulses (1943) were established. To promote brotherhood and progress among plant breeders 2. cotton (1922). Tamil Nadu Agricultural University. supporting meritorious students through fellowship programme and providing travel grant for attending seminars etc. Sugarcane Breeding Institute. M. 191 of 1995 on 6. Coimbatore – 3. Thuljaram Rao. Retired Director.S. special lectures for the benefit of students and scientists. Forest Research Institute. vii . Sugarcane Breeding Institute. Coimbatore delivered the keynote address. Coimbatore scientists from private Companies and institutions and retired plant breeders joined the forum. J. No. To extend the services of the forum from state level to national level. The society is looking for the enrollment of scientists involved in crop improvement for strengthening its existence and activities in the years to come. the members felt the need of changing its nomenclature as Indian Society of Plant Breeders (ISPB) and the society was reregistered as a national body. Swaminathan and the forum was registered as per S. The society is actively involved in organizing seminars. 1995 by Dr. Central Institute for Cotton Research (Regional Station).11. President Indian Society for Plant Breeders TNAU.1995. Dr.The plant breeders’ forum was inaugurated on February 26. A total of 110 breeders from Tamil Nadu Agricultural University. Now the society is having 200 members including 140 life members and 3 foreign scientists. S.P.Evaluation and utilization of crop biodiversity 1. Ganesh. Advances in breeding of vegetables Peter. and K. R. Tirumeni 5. Gowda 4. Ravi and S. V. and K. C. Moorthy.. H. K.V.R. R. Ram.. C. Enhancing utilization of plant genetic resources in crop improvement Upadhyaya. Dinesh.S. Genetic diversity of Robusta . Mythrasree. and C.V. Viraktmath and S. Inaugural address Presidential address Keynote address Valedictory address Technical Session I . Murugan. L. K.SECOND NATIONAL PLANT BREEDING CONGRESS PLANT BREEDING IN POST GENOMICS ERA CONTENTS I.V. Sabir.K. Ram Prasad. N. M. Manoharan.Arabica hybrids of coffee and utilization in breeding Santa Ram. Swamy 2. III.D.S. T.L.R.K.) genotypes and evaluation of genetic divergence Preetha-.S.S. Sandhyarani. Shobha Rani. Evaluation and utilization of biodiversity in cassava (Manihot esculenta Crantz) Santha V. and S. and T. Ravindra Babu. Rice biodiversity and its utilization Subramanian. Subbaiah 8.M. Ravindran. Mishra and Jayarama 6.C.C. Raveendran viii .V.Pasalu.R. M. Nair. A. V. C. B. Agro-morphological characterization and evaluation of rice germplasm for major biotic stress tolerance Subba Rao. K. Reddy. S. Sree Lekha 7. A. N. Pillai. D. S. Advances in spices breeding Peter. M. Nirmal Babu 3.N. I.S. Characterization of cotton (Gossypium hirsutum L. Palaniswami. A. II.L. IV. Alarmelu and R. B.. Genetic analysis of leaf anatomical characters associated with jassid resistance in cotton (Gossypium spp.) Hepper) Murugan. Interfamily variation and family selection in intervarietal crosses in sugarcane under excess water stress condition Govindaraj. V. Bentur. R. 10. S.. Nagarajan. Ravikesavan and T. J. Pre-breeding through ploidy manipulation to exploit alien genetic variability Amala J. Quantitative genetics . Nadarajan 4. 2. Breeding for improved yield and yellow mosaic virus disease resistance in black gram (Vigna mungo (L. V. R. Genetic studies on plant. Raveendran Technical Session III .Utilization of ploidy breeding in crop improvement 1. Kumar 6. Complex inheritance in rice variety MR 1523 of resistance to gall midge biotypes Suneetha. E. Developing high yielding rice varieties for Kerala a new approach Chandrasekharan. Variability for yield and quality attributes in interspecific progenies of Saccharum sp. R.Ram Mohan Rao 5.) under rainfed and irrigated conditions Subba Rao.K.P. P. Arunachalam and P. Ravikesavan and M..M. P.Quantitative genetics and analysis of genotype x environment interaction 1. Leaf trichome density – an indicator of jassid tolerance in cotton Kannan.M. Kumaran 3. S. P.Where are we today? Arunachalam.D. V. M. K. Hima Bindu. and R. maturity and physiological characters of maize (Zea mays L.S.. Singh 8. Cheeralu.9. Niral. Technical Session II . and N.) Shimna Bhaskaran. P. Variability and association analysis for floral traits of coconut genotypes Augustine Jerard. Shanthi 7.S. Vijaya Lakshmi. Prabhakaran 2. Wheat polyploids as a model system for crop improvement ] Dalmir Singh and P. Meena ix . K. C. Development of male lines resistant to Fusarium wilt in castor (Ricinus communis L) Lavanya. Raveendran 9. Cytological analysis Vigna radiate x V. C.A..) Anjani. U.. Development of superior inbreds and selection of efficient restorers for diverse CMS sources in sunflower Ranganatha. Cytological observations in colchicine induced hexaploids and their triploids of cross between Gossypium hirsutum [2n=4x=52. and T..) and wild species. Violet D’Souza. and Vinita P. R. Anil Kumar. Rukminidevi x . Cryptic genomic exchange between cultivated safflower (Carthamus tinctorius L. M. S. S. Thangasamy 7. B. Kumar Technical Session IV . Bieb. AR. Hybrids Pandian. Gunasekaran. S.K. N. Pallavi 5.. Vijay.K. Subbalakshmi. M. R.Koodalingam.S. Lavanya and K. umbellata L. glaucus M..3. Transgenic hybrid cotton technology and some genetic observations Narayanan.A. Role of polyploidy in cotton Khadi. V. Michalakopoulos and S. B. C. Mythrasree. Kumar 8. Hareesh. K. Cytological studies on sugarcane intergeneric hybrids Babu. C. N. Gotmare 4.R. M.Hybrid breeding in crops 1. and M. SantaRam and Jayarama 6. A. Raveendran and M. (AD1)] and Gossypium raimondii [2n = 2x = 26. Subsp anatolicus (Bioss. Expression of Brix in tomato intervarietal hybrids Panagiotis A.and Raoof. Sabir. Morphological. Natarajan. K.G. Muthiah and M.S.S. Shanthi and S. T. A.R. D5] Saravanan. Sree Rangasamy 3. Studies on the effect of preconditioning of pollen and dynamics of pollen tube growth in Gossypium sp.M.M. 2. M. M.B. biochemical and molecular characterization of ploidy variants in coffee for genetic improvement Mishra. 4.S. R. Sandhyarani. C. In vitro breeding tools in genetic enhancement of crops 1. Veluthambi Transformation of three antioxidant genes from a highly salt tolerant gray mangrove.. M. Millsp. Kulkarni 7. K. Gnanam and A. Mukund Shiragur. M. Combining ability studies for quality traits in Indian mustard Mahak Singh and R. Poovannan. R. Sudhakar and P. H. Ramesh and R. N.S. Thiyagarajan and K. Combined expression of chitinase and â-1. Sivaprakash In vitro genetic transformation for the Helicoverpa resistance using Cry 1 A(B) in pigeonpea (Cajanus cajan L cv Maroti) Sandhyarani.) Josnamol Kurian. Jena and David J. Restorer identification for CMS line IR 66707 A with O.N. C.Contributions of genomic tools in crop improvement 1. S. perennis cytoplasm Banumathy. 6. Samiyappan.S. Maruthasalam. Mackill 2.R. G. Parameswari. S. Ramakrishnan.. D. xi .. C. 3. T.) in Indica rice Ajay Parida.Dixit Technical Session V . Prashanth.Umadevi and Susan Eapen Engineering sheath rot resistance in rice Rajesh. 4.3-glucanase generates high levels of sheath blight resistance in homozygous transgenic rice lines Sridevi. K.. Kalpana. Technical Session VI . S. Sabapathy and K. (vierh.5. Siddeswaran 6. K.E. A. Molecular breeding for brown planthopper (BPH) and blast resistance in rice Kshirod K.. R. DNA markers and candidate genes What do we do with these? –Shashidhar. 5. Aveicennia marina Forsk. Mohan Rao. N.K.R. Manickam Somatic embryogenesis and plant regeneration from immature inflorescence and leaf explants of sorghum cultivars Kumaravadivel..Kuruvinshetti Direct organogenesis and somatic embryogenesis in pigeonpea (Cajanus cajan L. Jithesh and K. K. Sumangala Bhat and M. Balasubramanian 2. Quantitative trait loci. S. Evaluation of isonuclear alloplasmic hybrids in chilli (Capsicum annuum L) Nanda. N. K. J. S. S. P. G. V. Arumugachamy. Vinod. Molecular tagging of fertility restorer gene in cotton Amudha. Sundaravel Pandian 8.. P. Dandin 7.) Souframanien. Shanmugasundaram.K. Suresh Ramraj and K. serrata) collections of India through DNA marker analysis Girish Naik .Singh. A. J. Elaiyabharathi. Suman. Kadirvel. S. M.Singh and B. Balasundaram and N. Mathi Thumilan. Gunathilagaraj Sessionwise recommendations xii . Singh 4. aerobic and drought situations Shailaja Hittalmani. P. Tracing quantitative trait loci – the best and rest with reference to brown plant hopper resistance and nitrogen uptake in rice Maheswaran. Microsatellite and isozyme based genetic diversity measures for deciding productive cross combinations in sugarcane improvement Hemaprabha.K. Malarvizhi and K. G. Gopalakrishna 5. Manjaya and T. Grace Arul Selvi and Pavana J.M. A. Bhaskar Roy and S.Balasubramani.. P. Natarajan. roots and plant characters under submerged. Govindaraj.) Millsp. U. Senthilvel.. M.S. B. Use of SSR markers for the identification of interspecific and intergeneric hybrids of Saccharum Vijayan Nair. P. B. Assessment of genetic diversity and interrelationship among wild mulberry (Morus laevigata and M. Joshi Saha. J. S. N. T..3.B.. Geethanjali.G. Meenakshisundaram. Sequence characterized amplified region (SCAR) marker for the identification of cytoplasmic genic male sterile (CGMS) lines in pigeonpea (Cajanus cajan (L.. QTL pyramiding for rice root morphological traits and its effect on grain yield. Hiremath 9.Khadi 6. P. Selvi. N. xiii . by the year 2020. Coimbatore The world population is expanding rapidly and may reach 7. With the appointment of a separate economic botanist. This was primarily due to the advent of high yielding varieties by various crop breeding strategies.5 billion. the crop breeding work was initiated in sugarcane. 1922 for cotton. 1923 for millets. The first crop breeding station was established in the year 1901 at Kovilpatti for cotton and millets followed by a research station for paddy. 1930 for oilseeds. xiv .tonnes in 1950 to 220 m. to achieve these targets. sugarcane and groundnut at Palur in 1905. 1976 for forage crops. According to the projections. By establishment of full fledged breeding stations at Coimbatore in 1912 for sugarcane. food grain production must increase at the rate of 5 m.tonnes during 200405. Agricultural production in India has made great strides during the post independent period. The food grain production has increased from 50 m.t. India’s food grain production must be increased from 200 m.75 billion by 2020 and 10 billion by 2050 from the current population of about 6. per year over the next two decades to meet food demand of the growing world population. The new varieties supported by other inputs had resulted in a multifold increase in food grain production and saved millions of lives from starvation. 1943 for pulses. Vice Chancellor. in 2000 to about 300 m. Currently 800 million people are chronically malnourished and 2 billion people lack physical and economic access to sufficient food to meet their dietary needs.INAUGURAL ADDRESS Dr. in 1898. The crop breeding work in Tamil Nadu commenced as early as in 1870 by way of introduction of a foreign cotton variety from Mauritius.t.t. The discovery and successful transfer of dwarfing genes from Norin 10 in wheat and Dee gee woo gen in rice had opened a new chapter in the history of global agriculture. 1912 for paddy. C. Crop improvement is the introduction and adaptation of genetically improved crop varieties giving higher yields than the local varieties used by farmers. Ramasamy. To meet the demand of increasing population. Limited availability of additional aerable land and water resources. Tamil Nadu Agricultural University. providing sustainability to national food security.334 billion by the year 2020. the population may increase from the current 1. the crop breeding work was intensified. and the declining trend in crop yields globally make food security a major challenge in the 21st century. In India.025 billion to 1. in development of GMS based hybrids in Pigeon pea and leader in the development of photoinsensitive lab lab varieties. Dr. officinarum.barberi and the wild S.N. there are 31 research stations which are actively engaged in crop breeding work for evolution of crop varieties and hybrids and for maintaining crop genetic resources. Revolutionary changes in sugarcane cultivation and sugar industry with vastly improved yield and quality under nobilization programme by crossing among tropical S. G. SPV 462 (CO 26) Sorghum and PT 732A. Appadurai’s contribution to biometrics. Rangaswamy Ayyangar o o o o A great doyan among millet researchers Millet Breeding Station started in 1923 Set strong foundation to millet breeding in India Made land mark contributions in genetics and improvement of Sorghum and minor millets. particularly little and Italian Millets Dr. Prof. 155 in horticulture. he led the International Rice Commission of the FAO Initiated the indica-japonica hybridization program in 1952 First and the only Rajya Sabha M. Venkatraman (1912). Coimbatore PBS is the oldest rice research station in India He was the founder Director of the CRRI.Ramaiah o o o o o o Started scientific career in 1914 in the Paddy Breeding Station. among Agricultural Scientists Dr. 9 varieties in mushroom and two tree species.S. Concerted efforts by TNAU scientists through research programmes resulted in the release of 262 crop varieties in agriculture. Tamil Nadu Agricultural University is the pioneer in release of first rice hybrid in India.Simultaneously. K.spontaneum Dr. crop breeding stations were started for these crops in other centres of this state also. Subramanian’s role in green revolution are note worthy. A. famous Sugarcane Breeder who developed sugarcane varieties incorporating with biotic and abiotic stress and high biomass production gene complexes. At present.P. o I am pleased to recollect the works rendered by our earlier breeders and genetists like Sir. V. the indigenous Bellary xv . in the identification of CGMS system in pearl millet and sesamum. Cuttack In 1949. T. It is our pride to mention the contribution of GEB 24 and TKM 6 rice varieties as a donor of genes to many international rice varieties. sub-tropical S.S. Raman’s contribution to cytogenetics. The conventional approach of breeding crops by itself may not be able to deliver the goods in the required time frame given the magnitude and urgency to feed the growing millions. Biotechnology offers several advantages over classical breeding. development of transgenics etc. The first transgenic plants engineered for insect resistance in cotton. in terms of precision. Application of biotechnology in crop improvement programmes has started giving dividends. We will have to look for newer genes. The area under Bt cotton has increased tremendously. molecular breeding. diagnostics. It has organized First National Plant Breeding Congress during 1998. which is genetically engineered to produce beta-carotene. Another exciting development in Biotechnology is the GM rice called ‘golden rice’. The growth rate of agricultural productivity is in declining trend and we need to intensify our efforts to enhance the rate of genetic upgradation in crops. methodologies to transfer them at a much faster rate so that the variety developed with the required new trait in the already well adapted background can be transferred to the field without much loss of precious time.7 million hectares in 1996 to 81. Cotton variety MCU 5 conforming to high fibre qualities required by mills is the only variety that can spin to 60s counts. and gene transfer for specific traits even from the unrelated organisms. gestation period. DNA fingerprinting. area under biotech crops has increased more than 47 times globally.cytoplasm in Pearl Millet are important contributions from Millets. Bioprospecting will have to essentially lay the foundation for effective mining and transfer of genes for specific traits. a xvi . technology. In less than a decade (1996 to 2004). In the context of a holistic agricultural development and ensuring household food security. TMV 2 and TMV 7 groundnut varieties highly demanded by groundnut growers even after so many decades of release are land marks in Plant Breeding. corn and soybean were released for commercial cultivation in 1996. The conventional breeding methods will have to be complemented by an array of biotechnological tools and in a variety of ways such as tissue culture. genomics. from 1.0 million hectares in 17 countries in 2004. I am happy that the Plant Breeders of this prestigious institution have started a National Society called Indian Society of Plant Breeders in 1995 to promote the science of Plant Breeding and the society is effectively functioning by organizing special lectures honoring eminent Plant Breeders etc. role of biotechnology is going to be essentially much more important and vital than ever before. Bt cotton and Bt corn are the important transgenic crops now under cultivation in India. Often referred to as “Gene Revolution or Biorevolution”. New varieties offered farmers a far higher yield and profit than traditional varieties. neem. when the seeds of many high yielding varieties evolved by scientists were in high demand. jamun. Incidentally. blended with traditional and conventional technologies and supported by policies .if judiciously harnessed. There was no demand for ownership on plant varieties during the days of the Green Revolution. and cyanide in tapioca. Seed saving and sharing by farmers met most of the demand. proteomics and DNA microchips must be brought to developing countries for progress in scientific research and development. especially children and pregnant women. This rice is a product of genes transferred from a bacterium and a flower plant (daffodil).can lead to an ever-green revolution synergizing the sustainable pace of growth and development. the onus lies on the public sector institutions. neurotoxins in khesari dal. For agricultural sector. pomegranate. the seeds of these varieties were in high demand. mainly because the Indian Patent Act xvii . which could be commercially exploited to benefit the community. sweet pea. Also. it was a kind of anathema. There is no end to innovating the transformations in our future crop varieties/hybrids but it is important to look for our own indigenous gene constructs and promoters so as to be self-dependent and cost-effective in the wake of strong global IPR regimes. Sthalavrisksha (trees) etc. The uncommon opportunities provided by fast developments in functional genomics. the formation of harmful substances such as aflatoxin in groundnuts. we need to redesign the crop and to add value to the farm produce so as to make agriculture more rewarding to farmers. a condition which afflicts millions of people in developing countries. While pursuing for higher productivity levels. which undertake most of the transgenic research in India. orchid. besides several undesirable elements in chickpea. It is high time to come up with the strategies for protecting our own varieties with new era of WTO and TRIPS.substance which the body can convert to Vitamin A. Naturally. paulownia. can be prevented by the use of modern biotechnological methods. TNAU has developed protocols for successful dihaploid production in rice and micropropogation of banana. and potato. rose. biotechnology . The new rice could prove effective to overcome vitamin A deficiency. while the public and private seed supply systems met the rest. Tissue culture is yet another area with lot of scope for commercial exploitation. market or distribute the seeds or planting material of that variety. agricultural scientists have a unique orientation. By registering a variety. Generally they develop varieties as they have to develop varieties for resource poor farmers. In India. induce investment in agricultural research. Member countries will have to provide a legal framework for the protection of inventions relating to plant varieties. To protect the rights of the breeders and farmers. Under the PPV&FR Act. IPRs and Outlook for Scientific Research in Agriculture Out of the eight IPRs of the TRIPs Agreement. Indian Patent Act (1970) does not permit the patenting of plant varieties and animal breeds which are existing in nature. With a legal system in place for the protection of plant varieties. TRIPS Provisions Relating to Agricultural Sector The provisions of the TRIPS Agreement have widened the scope of protection of intellectual property rights relating to agriculture through plant variety protection. The provision for the protection of new plant varieties will have all pervasive effect in various fields of agriculture. Research especially in agriculture will not be carried out for the name sake of research. sell. the person or the institution becomes its PBR holder. strengthen domestic agricultural industries and generate confidence among domestic trade associations in our country. 2001). Plant Breeders Right on a plant variety is established by registration of the variety. The PBR holder can be one person. patents and plant variety protection will produce a marked change in the outlook for scientific research in agriculture. They do not visualize or anticipate any monetary reward to them forthcoming from their research. Agricultural scientists will endeavor to come up with inventions which can prove to be a commercial success. A reference to Article 27 of the TRIPS will show that all inventions regardless of the field of technology are eligible for protection. The protection available to them xviii . However. of India has enacted the Plant Varieties Protection and Farmers Rights (PVPFR ACT. The PBR holder alone has the exclusive right to produce. intellectual property protection has received enormous attention since 1986 when it was included in the Uruguay Round of Talks and particularly when Dunkel’s Proposal relating to GATT was published in 1991. Sensitizing agricultural scientists in IPR related issues will enhance the inventive capability of the agricultural research system.1970 clearly prohibited patenting of methods of agriculture and horticulture. a group or community or an institution. the scientists will try to come up with research and inventions of commercial value. Govt. IPRs and Inventive Capability of State Agricultural Universities Achieving self-sufficiency in food has been the cherished policy objective of our planners. the level of involvement of public sector in agriculture and the size of the market of the new products. Assured protection of IPRs may induce the private sector to take up the protected varieties for commercial production. They may gear up their research system to meet the quality requirements of the consumers. reasonable infrastructure for agricultural research has come up. animals. However. The domestic seed industry in India may expand and flourish. The inventories will enhance the bargaining power of our country. However. The SAUs will also be induced to catalogue indigenous germplasm and develop an inventory of the plant genetic resources. the level of investment in agriculture may increase. the State Agricultural Universities and ICAR institutes may have to be necessarily active and vibrant. They should try to ensure before launching a research project that the products of their inventions are in demand in the market. Our agricultural scientists may modify their approach from quantitative gains in crop yields to qualitative attributes of the crop products. It will change their outlook for research. the provision for the protection of new varieties in India will prove to be a great motivating force for the scientific community in agriculture. IPRs and Regulations of Access to Biological Resources The Biological Diversity Act (BOA) 2002 envisages regulation of access to biological resources.with Plant Breeders’ Rights will induce them to develop varieties which may command premium price in the market. The biological resources have been defined as resources which include plants. As a result. Our agricultural research system will thus experience many changes leading to their enhanced inventive capabilities. With a legal system of protection of inventions in place. xix . a. the prospects of enhanced investment in agricultural sector through IPRs will depend upon the configuration of the private sector. the SAUs will be induced to prioritize research from the standpoint of the commercial value of the research. having high willingness to pay for the quality of the product. This infrastructure strives for developing varieties which can contribute to food production. In other words. IPRs and Investment in Agriculture With increased inventive capability of SAUs and assured protection of new varieties and agricultural inventions. xx . The NBA may dispose such application for permission in 90 days and impose benefit sharing. It is therefore appropriate that the Congress will be useful to consolidate the research findings and plan for Plant Breeding activities in the 21st century so that the food and clothing needs of the growing population can be readily met without any shortage. If we consider the plant breeding research early part of the 20th century was devoted to gaining basic information. Thus IPRs will be used to regulate access to biological resources of India which is a very important for the economy of India. plan for the future. It is appropriate and worthy to take stock of the results achieved in each of the research area so far document and discuss them and based on the outcome. growth of domestic industries. molecular biology and genetic transformation started. cytogenetical and biometrical investigations during middle part. trade association. Now it is the blend of conventional and biotechnological investigations. inventive capability of SAUs.micro-organisms or plant thereof (excluding value added product) with actual or potential use but do not include human genetic material. heterotic exploitation and germplasm conservation and utilization took place while during the current phase the beginning of biotechnological research. Section ‘6’ of the BDA-2002 stipulates that application for IPRs cannot be made without the prior approval of the National Biodiversity Authority (NBA) if the research is based on the use of biological material from India. It would thus appear that new developments relating to IPRs in India have wide ranging implication for various sections in Indian economy. and regulation of access to biological resources. investment in agriculture. All the IPR granting authorities will endorse a copy of the sanction issued by them in relevant cases to NBA. I am happy to inaugurate the congress and wish that fruitful results should come out from the deliberations and the results should be transformed into action. They will have implication for change in the outlook of scientists in agriculture. However. for Mahatma Gandhi himself had cautioned against it. this was an unwise step. where there have been success stories. India would require 400 million tones of food grain for its population of 120 crores. the food production of crops such as rice. Plant breeders would face marketing challenges to sustain “production by the masses rather than mass production” xxi . K. Planners and administrators had predicted that by 2015. saying that import of agriculture amounted to import of unemployment. In 2006. Vice Chancellor. and the wisdom of plant breeders was “tremendous”. However.C. India was likely to import rice. barley and millets was about 208 million tonnes. Peter. Kerala Agricultural University. vanilla and pepper. Despite adequate food stocks in the country. Indians had adopted agriculture as early as 2000 B.. at least regarding micro propagation in cardamom.PRESIDENTIAL ADDRESS Dr.V. Biotechnology is one of the answers. Thrissur. by nutritional standards. wheat. the country needs 260 million tonnes. having accumulated over a period of 4000 years. a large section of the people did not have the purchasing power to buy what they needed for adequate nutrition. Kerala India was rich in biodiversity and home to a large numbers of medicinal plants. Farmers’ rights are primary rights and those should not be construed as secondary or concomitant benefits and privileges only.e. Regulatory and operational bio safety regulations should be rigorously followed. S. We shall not replicate anything similar to what happened to maize land races in Mexico. the Indian Society of Plant Breeders. and its subsequent relocation at Coimbatore during 1906. There is a need for construction of an Integrated Database on Bio safety and use of GMOs in India. Truly. The future of agriculture essentially lies in the new science-led agricultural growth towards farm prosperity. National Academy of Agricultural Research Management (ICAR). Its graduates are recognized throughout the world. The University. Tamil Nadu. I am happy to note that keeping in line with the great tradition of the TNAU. which lies in one of the most progressive states of India. Prakash Tiwari. The whole biological world now belongs to a single gene pool. The science and practice of crop improvement has made great strides in the recent past. both being not mutually exclusive. Coimbatore has very timely organized this Second National Plant Breeding Congress on “Plant Breeding in Post Genomic Era”. Hyderabad It is my pleasure and privilege to be here at the TNAU. and is a leading agro-technology provider of India. i. bio safety of endemic variability riches such as that of Western Ghats are to be preserved. Our bio resources should be utilized on sustainable basis with equitable benefit sharing. The farmers’ interests have to be protected. Gene of any organism can be transferred to any other organism. In the new era of the advent of GMOs / transgenics. need deft handling in the interest of human welfare at large. eco-friendly and to be made available to farmers at affordable cost in a scale-neutral manner. Chennai. The technologies have to be robust. farm-worthy. Director.KEY-NOTE ADDRESS Dr. We can have designer plants. however. xxii . The new tools of science. it is a post genomic era for plant breeding. has already completed its 100 years with laudable achievements. Crop improvement will benefit in an overall manner but mainly through the use of hybrid technology (used earlier as well) and agricultural applications of biotechnology. since its genesis as an Agricultural School at Saidapet. Genetically modified improved plant varieties or transgenics can be produced. International efforts are underway for the sequencing of banana. India has contributed in this endeavor as one of the global partners in the International Rice Genome Sequencing Project. can now be examined in terms of its whole hereditary organization through study of expression and interaction of genes – a field that is broadly referred to as ‘genomics’. The old paradigm of looking for the phenotype is giving way to the new paradigm of looking for the genes. Eventually. The science of genomics offers tremendous opportunities for the humanity in the field of medicine. There could be myriad positive implications of genomics with respect to food. The focus of genetic research has now shifted from highthroughput sequencing to elucidation of gene function i. fine mapping and reducing the number of candidate genes would enable gene identification and validation. including crop plants. Each of these genes will also have several alternative forms (alleles) and their structure and function needs to be deciphered by allele mining. Plants. xxiii . several genes such as Am A1 and OXDC have been isolated. nutrition and environmental security of the nation. plants can be engineered to produce novel products including vaccines and nutraceuticals. For example. Hence. from structural to functional genomics. In India. tomato.e. We shall start with developing mapping populations such as RILs. Still bigger challenge is to understand the functions (functional genomics. so far sequencing of only two genomes of higher plant namely Arabidopsis (125 Mb) and rice (400 Mb) have been completed. agriculture and industry alike.Any organism. cotton and maize genomes and the gene-rich regions of wheat. serve as bio-factories. QTL analysis. the size of maize genome is 6 times and that of wheat is 40 times bigger than the rice genome. Also. and undertake molecular characterization and systematic phenotyping. scientists have predicted nearly 62. The major challenge for decoding genomes of crop plants is their enormous size. Novel genes and DNA markers linked to agriculturally important traits are being identified and these can be used for rapid variety improvement in a more precise and targeted manner using markers assisted selection (MAS). The genomics of Arabidopsis thaliana and rice has already provided a wealth of information. thus. proteomics) of each and every new gene. NILs etc. For example.000 genes in rice. High power computing and a range of DNA analysis and data base management software along with the Internet revolution have played a crucial role in the wide spread genomic research. Successful isolation of protease inhibitor and lectin genes and promoter sequences from indigenous legumes have been obtained. Holder of one of them can block the commercialization of the product. have a desirable confluence with biotechnological applications and these two should not be taken as mutually exclusive approaches. It has enabled scientists to work from anywhere in the world. and (iii) gene pyramiding for (a) durable resistance for biotic stress and/or. Bioinformatics through orthologs identification and display. Continuous gene and allele mining is needed for eventual gene deployment by (i) transgenics development. A single biotech-generated product may have several IP-protections. Innovative and Strategic Research in crop improvement is called for towards novel methods of gene transfer. for building up core collections etc. the research has to traverse the journey from gene discovery to trait synthesis for crop improvement. The conventional plant breeding efforts should. tissue-specific expression and more insecticidal toxins. The country is well-poised to benefit from the new approaches in crop improvement. These genes are being mobilized in different crop species for developing transgenic crop plants. Gene detection technologies can also help in minimising adventitious presence of transgenes in germplasm collections and farmers’/traditional varieties and land races. marker-free selection of transformants. (ii) marker assisted selection. Use of the new tools of science is also enormous in biodiversity management viz. We are in the new IPR-regime as well. for IPR protection. We have to stake the claims of national sovereignty on our germplasm and varieties. Gene Bank EST resources for crop plants are rapidly growing day by day. super promoters. Thus. xxiv . for bio resource utilization. (b) multiple stress tolerance. This calls for partnership among public and private sectors to overcome IPR-encumbrances. Genomic synteny and comparative genomics can help in gene discovery for desirable traits. Map-based cloning and allele mining is gaining importance (e. molecular characterization for biodiversity assessment.sequenced and used for transformation. Rice blast resistance Pi-kh gene). auto-pipeline and availability of gene expression data centralized to enable comparative analysis data mining would greatly help in plant breeding efforts.g. however. Santhanam. the eminent Rice breeder. President of this Session Dr. Sivasamy. Dr. T. Indian Society of Plant Breeders. Among the older pioneers who are not here the names of Dr. who recognized the importance of rice quality with yield in varietal xxv . Dr. It may be pertinent to recall the names of the some of the early pioneers in plant breeding who built up the high traditions for the vibrant plant breeding programmes which are actively being continued by the present generation scientists in this campus and its regional stations. research and extension in this part of the country which have gained national and international recognition. FAO Expert President. Narayanan had very ably summarized the recommendations followed by the presidential address by Dr.S. that I should deliver a formal valedictory address which will add only to your fatigue at the end of the day. Dr. Raveendran.M. K. Raveendran. and all his colleagues of the organizing committee. Dr. my esteemed colleagues. The institution which has grown around this main clock tower building in which we are meeting today during last 100 years. I see many known faces and distinguished scientists among the audience and it may be difficult for me to list out all of them. S. I do not think therefore. and distinguished participants of the Second National Plant Breeding Congress. I deem it honour and privilege to have this opportunity to address the galaxy of plant breeders and biotechnologists in the broader sense who have gathered at the Second National Plant Breeding Congress. provides testimony to the vibrant growth of agricultural education. Secretary of ISPB Dr. The crop improvement and breeding sections established at the Coimbatore campus as a part of Agricultural College and Research Institute during early decades of 20th century have rendered yeoman service to the cause of agriculture and increasing crop production and quality. Ramasamy and very critical review of the entire congress presented by Dr. T. Ramaswamy.S.S. Thanks to the dynamic efforts of the President. Ramaiah. N.VALEDICTORY ADDRESS V. I understand that you had a very hectic schedule during the last 3 days with comprehensive presentations and discussion on the widest range of topics covering the entire gamut of technological tools now available with the plant breeders before arriving at this closing session. Narayanan. N. the function for an agricultural institute being laid for this very building in the year 1906. Raveendran. It is a very happy coincidence that this campus is in its centenary year. Chairman. Swaminathan. the best ever hirsutum cotton released in India through introgressive hybridization. now proudly holds his head high in the international scenario due to Green Revolution. in 1950 to over 200 mt. Dr. Patel in 1970 and the extension to commercial cultivation of first generation hybrid cottons. in millet breeding. R. Balasubramanian in cotton breeding come to my mind. was responsible for milestone development of cotton variety MCU 5. The world’s worst recorded food disaster happened in the year 1943 in Bengal of British India when an estimated 4 million people died of hunger. Madhava Menon in the millet breeding station in the early 1950’s who was the first breeder to exploit hybrid vigour in the pearl millet improvement and Dr. C. a predecessor to Dr. Mr. He joined Agricultural College. Centre for Advancement of Philanthropy and also a trustee of MSSRF introduced Dr. P. Bombay in December 2005. The average Indian who was leading dependent life on food grain shipment in mid 1950’s literally had a slip to mouth to existence.T. Subsequently a large number of hybrids both of intra and interspecific nature like Varalaxmi and DCH 32 from Karnataka and TCHB 213 from this Institute have all been extended in large scale cultivation. estimated for the current year with enough stock to feed over 1 billion people. Ramanatha Iyer and Prof. Some of the early pioneers or stalwarts like Dr. Swaminathan.V. the main speaker at the function with the information that the Bengal catatrosphy in the year 1943 ignited a spark in young Swaminthan to choose an agriculture based career for himself. Rao Baghadur Dr. A major landmark in the history of cotton breeding in India is the exploitation of hybrid technology with the release of the intra hirsutum hybrid in Gujarat by Dr. B. Raveendran. Lala. Dr. Currently. Ponniah. The latest history is too well known to be repeated to this august audience. I started my professional career in the Cotton Breeding Station of this Institute in mid 1947 and I may therefore take the liberty of a couple of minutes saying specifically on the cotton breeding and varietal improvement scenario. the former Director of School of Genetics. It is the miracle of application of science and technology complimented with administrative support and political will.M.X.S. P. is now spreading a movement for an ‘evergreen revolution’ to sustain the development.improvement.W. Food production has increased from 50 mt. The Indian cotton crop is the most diverse in the world in terms of botany and fibre quality range. nearly 50% total cotton area is estimated to be covered by xxvi . as you all know. M. Marappan. Coimbatore in the year 1944 and graduated in 1947. In a recent meeting held at CIRCOT. Dr. Norman Ernest Borlaug. I quote “An ideal crop variety is an elusive to secure as an ideal wife”. he will retire from service. during the year 2005-2006. To commemorate this achievement. the transgenic Bt hybrid cotton is estimated to have covered about 18% of National cotton area and contribute about 25% of production. S. xxvii .hybrids developed by the public sector as well as the dynamic private sector research and hybrid seed production contributing to over 50% of total cotton output in the country. Narayanan yesterday. the Nobel Laureate who is mainly responsible for high yielding varieties of Mexican dwarf wheat which seeded the green revolution in many parts of the world apart from India during 1970’s used to observe in mock seriousness. Insecticidal and herbicidal resistance. I am sure this subject would have been dealt at length by my esteemed colleague Dr. seed and feed’ the Nation. I would like to thank once again the Society and Organizing Committee for giving me this valuable opportunity to meet you all in this afternoon. Perhaps seed alone in the broader sense includes agro industry also apart from alleviating hunger of billion mouths. I wish to congratulate one and all of you for the significant contributions made by you to breed and feed. I wish to close with relevance to plant breeders. To say. seed oil and protein improvement. fibre modification and inducing male sterility are other avenues in biotechnological research. as a frustrated person without releasing any variety. drought tolerance.S. Before I conclude. Genes for jeans is the slogan with target genes in mind. May I close and wish you all good future. Similarly the gentleman waiting for an ideal wife will remain unmarried for life. I may venture to suggest that the Indian Society of Plant Breeders consider their motto of ‘breed and feed’ to be amended as ‘breed. If the breeders were to wait to release an ideal variety combining in one cultivar of all desirable traits. The phenomenal increase in cotton production to about 240 lakh bales of cotton lint in the current year 2005-2006 as against 26 lakh bales only in 1947 – 48 at the time of independence may well be considered a “white revolution” comparable to the praiseworthy green revolution in food crops. Another significant milestone in the cotton breeding programme is the recent utilization of transgenic technology utilizing the Bt gene conferring resistance to Helicoverpa bollworms. Thank you. TECHNICAL SESSION I EVALUATION AND UTILIZATION OF CROP BIODIVERSITY . Scope for horizontal expansion of area under vegetable crops is much limited due to lack of suitable land and thus option is for vertical increase by enhancing productivity. . Division of Vegetable Crops. .Production of more biomass. companion and intercropping. .0 million ha and production is 95 million tonnes with productivity of 13.5 million ha and production should be 200-250 million tonnes with productivity of 20 tonnes/ha. Kerala Agricultural University. Philippines (167 g) and Thailand (163 g). minerals and proteins. Japan (523 g). West Bengal. a large number of vegetable crops are grown here and a great deal of research work conducted in the disciplines of vegetable breeding. Estimated area under vegetables in India is 8.Export potential..Digestible protein. area should be 12. . Swamy2 ABSTRACT Vegetable crops are important sources of carbohydrates.Nutritional security. Quantity of vegetables produced / capita in India is much lower than what is recommended by dieticians. Italy (593 g).Higher income. Major milestones of vegetable research * 1940 – Successful attempt of seed production of temperate vegetables at Quetta (now in Pakistan). Advantages of vegetables are as follows: .Economical to grow. In a few developed and developing countries. Canada (428 g). and K.Suitable for small farmers. . Jammu and Kashmir and Tamil * 1949– Establishment of Vegetable Breeding Station at Katrain in Kullu Valley.15 tonnes/ha. sub-Saharan Africa and Latin America. . India has to go a long way for boosting vegetable production to meet minimum need for nutritional security of population. World’s per capita availability is 160 g/day as against 236 g/ capita/day in developed countries.Himachal 1.Source of supplementary income. * Simultaneous start of ad-hoc schemes by Indian Council of Agricultural Research in different states like Punjab. Uttar Pradesh.Intensive employment. In general. History of vegetable breeding in India Vegetable research in India is of recent origin. .V1.g. 2. Kerala. USA (469 g). Because of varied agro-climatic conditions in India.Well fitting in farming systems. * 1947 – Sanctioning of nucleus ‘Plant Introduction Scheme’ at Indian agricultural Research Institute. average/ capita / day availability of vegetables in South Asian region is only 96 g which is higher than only South-East Asia (63 g). Australia (346 g). . . New Delhi. Bangalore 1 . Indian Institute of Horticultural Research.M.Maximum output and more income / unit area. India is credited as the second largest producer of vegetables in the world next only to China. Thrissur. . seed production and postharvest technology. . e.Suitable for mixed. Maharashtra Himachal Pradesh. In India. K. plant protection. China (195 g). By 2020. production technology.R. per capita availability is around 135 g against minimum requirement of about 300 g for a balanced diet. per capita /day consumption of vegetables is very high. . vitamins.ADVANCES IN BREEDING OF VEGETABLES Peter.Reduction in malnutrition. * 1995 – Initiation of ICAR research network on promotion of hybrid research in vegetable crops (ad-hoc project) for 3 years with total cost of Rs. * 1994.59 lakhs for 3 years spread over various centers engaged in vegetable research. State agricultural universities establishment on the pattern of land grant colleges/ universities of United States of America had full-fledged and separate Departments of Horticulture and/or Vegetable Science started from 1960 onwards.B. New Delhi headed by a Project Co-ordinator. * 1970 – Initiation of All India Co-ordinated Vegetable Improvement Project (AICRIP) with headquarters at Indian Agricultural Research Institute. In the past. Twenty six state agricultural universities plus one central university on agriculture as given in Table-1 are now engaged in the conduct of research on vegetable improvement.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Pradesh for production of seeds of te mperate vegetables. Pantnagar was the first agricultural university to be established on land grant pattern in 1960. there has been a shift towards creation of separate and independent Departments of Vegetable Science after bifurcation/trifurcation of existing Departments of Horticulture to carry out vegetable breeding and production work more efficiently. New Delhi to undertake research on temperate vegetable crops. These developments gave thrust to vegetable research. * 1956 – Creation of Division of Horticulture at Indian Agricultural Research Institute.Initiation of All India Co-ordinated Nadu Research Project under National Seed Project (NSP) for production of breeder seed of vegetable crops with a financial outlay of Rs. Manipur came into existence in 1993. * 1984–Recommendation of Quin quennial Review Team (QRT) of the Indian Council of Agricultural Research to upgrade the All India Co-ordinated Vegetable Improvement Project to the level of Project Directorate of Vegetable Research (PDVR). * 1992 – Shifting of headquarters of PDVR from New Delhi to Varanasi.Establishment of Indian Institute of Horticultural Research (IIHR). a Central University on Agriculture with headquarters at Imphal. * 1955 – Transfer of Vegetable Breeding Station. formerly known as Uttar Pradesh Agricultural University (UPAU). * 1968 . New Delhi * 1960 – Establishment of State Agricultural Universities (SAUs): The G. * 1987 – Start of Project Directorate of Vegetable Research during the Seventh Five Year Plan by upgrading erstwhile All India Co-ordinated Vegetable Improvement Project. Lately. standardization of seed production technology and to produce seeds of improved varieties of temp erate vegetable crops.330. vegetable improvement programmes were located in combined Departments of Horticulture. Besides these 26 State Agricultural Universities conducting researches on 2 vegetable improvement.Pant University of Agriculture and Technology. with head quarters at IARI. Bangalore with a strong focus on vegetable improvement among other things.38 lakhs spread over different vegetable research centers/ .This University has various colleges including a College of Horticulture with a separate Department of Vegetable Science. New Delhi. Katrain to Indian Agricultural Research Institute.303. pedigree methods and combination of backcross and pedigree method are employed in breeding. family breeding. 19 voluntary centers and 34 private seed companies for conducting experiments/trials on vegetable crops. mutation breeding (Table 10).esculentum x L. recurrent selection). Over 400 varieties of different vegetable crops comprising solanaceous fruits. line/ family breeding (Table-5). Resistant varieties Vegetable crops are highly susceptible to a number of diseases. and it includes seven main centers. cole crops. inbreeding/ inbred selection (Table-6).melongena x S.baccatum var. botrytis). Several resistant varieties were developed by simple selection and incorporation . In polygenic control of resistance. Varanasi. In certain cases. hybridization and selection. etc. (Sinapis alba x Brassica oleracea var. Non-availability of seeds of improved varieties is one of the major production constraints in India. heterosis breeding etc.integrifolium).peruvianum). Biotechnological approaches like embryo rescue and protoplast fusion techniques need to be employed to overcome interspecific and even inter-generic barriers as shown by the crosses: (S. resistance to diseases forms a significant objective in vegetable breeding programmes. leaf vegetables and others developed/identified by different ICAR institutes and agricultural universities by adopting breeding methods like introduction and acclimatization (Table-2). synthetic varieties development (Table 9). Achievements in breeding of vegetables Significant achievements were made in breeding of vegetable crops in India since 1950’s by adopting different methods of breeding such as plant introduction. The PDVR was later upgraded as an Institute. recurrent selection. selfing and massing. mass selection. Indian Institute of Vegetable Research (IIVR). Specific programmes need to be taken to integrate resistance breeding with heterosis breeding to develop promising disease-resistant hybrids. Development of improved and high yielding varieties Tremendous progress was made in the development of improved and high yielding varieties of different vegetable crops. pendulum). pure line selection. For simply inherited resistance. (C. 18 sub-centers. and back cross method of breeding (Table 11) are recommended for cultivation in various agro-climatic conditions based on multilocation and multidisciplinary 3 testing. pure line selection (Table-3). hybridization and selection/ pedigree selection (Table 7–8). All India Co-ordinated Research Project on Vegetable Crops (AICRP-VC) has its headquarters at IIVR. (L. bulb crops. depending upon crops involved. cucurbits. S. mass selection. back-cross method of breeding. mass selection (Table-4). gilo x S.annum x C. Parents resistant to indigenous pathogens or races of pathogens should be developed for their subsequent utilization to develop resistant hybrids. Breeding for disease resistance is given due importance to develop varieties against important diseases. At present. plant selection (individual plant selection. around 30 % of area under vegetable crops is covered by improved varieties. peas and beans. back-cross method of breeding is commonly employed to transfer resistance from donor parent to commercial variety.sisymbrifolium. In India. Breeding methods depend on source of resistance and its inheritance. controlled matings (among resistant progeny) in F2 and succeeding generations and other breeding methods involving gene pyramiding are employed. root crops. synthetic varieties. line breeding. mutation breeding. simple selection. recurrent selection.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era State Agricultural Universities. Over 80 disease-resistant varieties/hybrids are developed in 13 vegetable crops (Table-11). there is competition among the private seed companies (both national and multi-national) in the present liberalization of seed policy. Most of hybrids released at national level were developed by public sector but their popularity among farmers is rather poor due to very weak seed production and marketing infrastructures at Government level. * Varieties suitable for export purposes. needs exploitation. especially in tropics and sub-tropical regions. Resistance in breeding should be viewed as a continuous process.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era of resistance from donor parents.23%) which needs commercial exploi tation. resistant varieties would be of little use unless it possesses good horticultural characters. Yellow vein mosaic virus resistant varieties of okra (Arka Abhay. Private seed companies did commendable work in popularizing hybrid varieties in India. At present. chilli. Arka Anamika etc. 4 . Development of hybrid cultivars in various vegetable crops is receiving due and increasing attention by the All India Co-ordinated Vegetable Improvement Project. Two leaf curl resistant tomato varieties. * Varieties suitable for processing purposes. Importance being given to heterosis breeding in vegetable crops in India by Indian Council of Agricultural Research can be recognized from the fact that ICAR sanctioned a special adhoc research project on promotion of hybrid research in vegetable crops for a period of 3 years (1995-96 to 1997-98) with a total cost of Rs. bitter gourd. Private sector establishments are rather prompt and well planned in seed distribution. Future Thrusts * Emphasis needs to be given to introduce germplasm resistant to iotic and abiotic stresses. capsicum. okra. At present. less inter-nodal distance need to be bred.330. Vegetable crops included in this programme were tomato. Hisar Anmol and Hisar Gaurav were developed by transferring resistance from Lycopersicon hirsutum f. Resistant varieties so far developed in India are presented in Table-11. In vegetable crops. cucumber. cabbage and brinjal.glabratum. manihot and ssp. Hybrid varieties ICAR Research Institutes and Agricultural Universities contributed considerably to develop F1 hybrids. Due attention must be paid to develop new varieties with higher level of resistance coupled with high quality attributes. * Being sensitive to day length. most of the hybrids grown in India are of private sector origin. onion. Over 200 F1 hybrids in 15 vegetable crops are being sold by seed companies in India (Table 13). * Development of highly stable resistant cultivars of okra to yellow vein mosaic virus which normally results in breakdown.) were developed employing resistant wild species Albemoschus manihot ssp. * Short duration cultivars with branching habits. besides resistance to other diseases. Resistance breeding must be integral part of any breeding programme. more nodes.. Interspecific hybridizations are successfully accomplished to develop resistant varieties.38 lakhs. early flowering. over 80 F1 hybrid cultivars of 16 vegetable crops were developed by public sector organizations Table 12. ability to flowerthroughout the year. For this reason. tetraphyllus. insects and nematodes. hybrids and varieties with high export potential (Table 14). * Okra seed contains good amount of oil (1820%) and crude protein (20. Punjab Agricultural University. Haryana. Himachal Pradesh. Horticulture Vegetable science Vegetable science Horticulture Horticulture Horticulture Horticulture Horticulture Vegetable science Vegetable science Vegetable science Horticulture Horticulture Vegetable science 1972 1974 Horticulture Horticulture 1975 1975 1978 1982 1982 1984 1986 1987 Horticulture Vegetable science Vegetable science Horticulture Horticulture Vegetable science Horticulture Horticulture . 12. Gujarat Agricultural University. Punjab Rao Deshmukh Krishi Vidyapeeth. Rajasthan Agricultural University. 25. Rajendra Agricultural University. Ludhiana. Assam 11. Orissa University of Agriculture and Technology. Kanpur. Kerala. Kumarganj. Bihar 23. Junnagadh. Narendra Deo University of Agriculture and Technology. Karnataka 8.Coimbatore. Gujarat (with Colleges of Agriculture at Anand. Samastipur. Uttar Pradesh 21. Bidhan Chandra Krishi Viswa Vidyalaya. 5 Vegetable science Horticulture. Rajasthan 3. Jawaharalal Nehru Krishi Viswa Vidyalaya. Karnataka 26. Andhra Pradesh Agricultural University.B. Ratnagiri. Jabalpur Madhya Pradesh 6. Maharashtra 16. Dapoli. Hissar. Konkan Krishi Vidyapeeth. Indira Gandhi Krishi Viswa Vidyalaya. Y. Sardar Krishinagar Vegetable science 18. Tamil Nadu 13. Ranchi. 17. Bangalore. No. Bihar 14. Uttar Pradesh [Vegetable Improvement under Economic Botanist (Veg. Sl.Parmar University of Agriculture and Forestry. Assam Agricultural University. Parbhani.) at Kalyani] 20. Maharashtra. Rajendra Nagar. Dantiwada.Pant University of Agriculture and Technology 2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1. Marathawada Agricultural University. Palampur. University of Agricultural Sciences. Chaudhury Charan Singh Haryana Agricultural University. Jammu & Kashmir 24. Punjab 5. Faizabad. Jorhat. Tamil Nadu Agriculture University. Birsa Agricultural University. Himachal Pradesh 22.Kalyani. State Agricultural University Year of Establishment 1960 1962 1962 1963 1964 1965 1965 1969 1969 1969 1970 1971 1971 1972 1972 1972 Department 1. Orissa 4. Dharwar. Krishinagar.S. Himachal Pradesh Krishi Viswa Vidyalaya. Srinagar. G. Hyderabad. Maharashtra 9. Navsari. Sher-E-Kashmir University of Agriculture and Technology. 10. Mahatma Phule Krishi Vidyapeeth. Maharashtra 15. Bikaneer. Kerala Agricultural University. Nadia. University of Agricultural Sciences. Raipur. Akola. Bhubaneswar. Rahuri. Sardar. List of State Agricultural Universities showing combined Department of Horticulture/ independent Department of Vegetable Science. Solan. Vellanikkara. Madhya Pradesh. Andhra Pradesh 7. West Bengal 19. Narendranagar. Pusa. Chandra Shekhar Azad University of Agriculture andTechnology. Table 2. Promising introductions in various vegetable crops Crop Tomato(9) Variety Roma Labonita Sioux Marvel Best of All Money Maker VC 48-1 NDT-10NDT-5 California Wonder Yolo Wonder World Beater Chinese Giant Golden Cal Wonder Bullnose Early Superb Meteor Arkel Little Marvel Early Badger Bonneville Lincon Alderman Perfection New Line Sylvia Contender Giant Stringless Kentucky Wonder Bountiful Masterpiece Jampa Philippines Early Improved Japanese D-96 Golden Acre Copenhagen Market Glory of Enkhuizen September Red Acre (Red cabbage) White Vienna 6 Sweet Pepper (6) Pea (10) French bean (6) Cowpea (1) Cauliflower(2) Cabbage(5) Knol-khol(3) Introduced from USA USA USA USA USA USA Taiwan --USA USA USA USA USA USA UK UK UK UK USA USA USA USA USA USA Sweden USA USA USA USA USA Mexico Philippines Israel Israel Denmark Denmark The Netherlands Germany -Europe . Brussels sprouts(5) Radish(3) Carrot (3) Garden beet (4) Turnip (4) Onion(3) Watermelon(6) Cucumber(4) Summer squash(2) Bitter gourd (1) Purple Vienna King of North Hilds Ideal Amager Market Catskill Danish Giant Danish Prize White Icicle Scarlet Globe Japanese White Nantes Chantney Danvers Detroit Dark Red Crimson Globe Crosby Egyptian Early Wonder Purple Top White Globe Golden Ball Snowball Early Millan Red Top Early Grano Barmuda Yellow Brown Spanish Asahi Yamato Sugar Baby New Hampshire Midget Improved Shipper Dixielee Fuken Japanese Long Green Straight Eight Poinsettee China Australian Green Patty Pan MD-4 Europe Europe Europe Europe Europe Denmark Denmark Europe Europe Japan Europe Europe Europe USA USA --Europe Europe Europe Europe USA Philippines Philippines USA USA USA USA USA -Japan USA USA -Australia USA -- 7 . Vegetable varieties developed by pure line selection Crop Tomato (15) Variety Improved Meeruti HS-110 Sonali Pant Bahar Arka Vikas Arka Saurabh Punjab Tropic Pusa-120 S-12 Arka Abha Arka Alok Arka Ahuti Pant-T-3 CO-1 CO-2 Pusa Purple Long Pusa Purple Cluster Pusa Purple Round Pant Samrat Arka Shirish Arka Kusumakar Arka Sheel Punjab Chamkila T-3 Krishnanagar Green Long Punjab Neelam Punjab Bahar G-2 G-3 K-1 CO-1 CO-2 GCA-154 Kaliayanpur Yellow Kaliyanpur Red Kaliyanpur Chaman Sabour Angar Sabour Arun Arka Lohit CA-960 Bhagyalakshmi Sindhur Genetic stock Indigenous Exotic Exotic Exotic Exotic (USA) Exotic(Canada) Exotic (USA) Exotic (USA) Exotic (USA) Exotic (Taiwan) Exotic (Taiwan) Exotic (Canada) Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Exotic (Portugal) Exotic (Sri Lanka) Exotic (C. 960) Brinjal (12) Chilli (15) 8 .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 3.A. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Pea (2) French bean(4) Variety Asauji Harbhajan Pant Anupama VL Boni-1 Arka Komal Arka Bold Cowpea 263 Pusa Barsati Pusa Phalguni Sheetal RM-43 Durgapura Madhu Arka Rajhans Arka Jeet Pusa Madhuras Durgapura Meetha Durgapura Kesar CO-1 CO-2 CM-14 Arka Chandan` Punjab Chappan Kaddu-1 Early Yellow Prolific Arka Suryamukhi Coimbatore Long Pusa Do Mousami Arka Harit VK-1a-Priya CO-1 MC-23 Pusa Vishesh Punjab BG-14 NDB-1 Phule BG-6 Kaliyanpur Sona Pusa Nasdar CO-1 CO-2 Pusa Summer Prolific Long Punjab Long Arka Bahar Pusa Naveen 9 Genetic stock Indigenous Exotic Indigenous Indigenous Exotic(Australia) Exotic(Hungary) Indigenous Exotic (Philippines) Exotic (Canada) Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Exotic Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Cowpea (3) Cucumber(1) Muskmelon(5) Watermelon (2) Pumpkin (4) Summer Squash(2) Winter Squash(1) Bitter gourd (11) Ridge gourd (3) Bottle gourd (7) . Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Variety Pusa Summer Prolific Round Punjab Round CO-1 Genetic stock Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Exotic (Taiwan) Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Wax gourd (2) Snake gourd(3) CO-1 KAU Local CO-1 CO-2 TA-19 Tinda S-48 Pusa Chikni Arka Sheetal Karnal Selection Badi Chaulai Kannara Local Pusa Kiran Chhoti Chaulai Pusa Kriti CO-1 CO-2 CO-3 Arka Suguna Arka Arunima Pusa Early Prolific JDL-79 JDL-53 K-6802 JDL-37 HD-18 HD-60 Deepaliwal Rajni CO-1 CO-8 Pusa Sadabahar Pusa Mausami PLG-850 CO-1 Perkins Long Green Punjab No.13 Pusa Makhmali Gujarat Bhendi-1 10 Indian Squash (Tinda) (1) Sponge gourd (1) Long melon(2) Amaranth(10) Dolichos/ Hyacinth bean(11) Cluster bean(3) Okra (5) . Vegetable varieties developed by mass selection Crop Tomato(1) Capsicum (3) Variety Arka Ashish Arka Mohini Arka Gourav Arka Basant Genetic stock Exotic Exotic Exotic Exotic Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Indigenous Exotic Indigenous Cauliflower(1) Onion(16) Pusa Katki Punjab Selection Pusa Red Arka Niketan Arka Kalyan Agrifound Dark Red CO-2 Nasik Red Arka Pragati Patna Red Pusa White Round N-53 Kaliyanpur Red Round Agrifound Light Red Hisar-2 Arka Bindu Pusa Madhavi Radish (5) Pusa Desi Punjab Safed Punjab Ageti Kaliyanpur-1 Arka Nishant Palak (1) HS-23 11 .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 4. 2-3 x Exotic cultivar Sel. Crop Cauliflower (2) Variety Pant Gobhi-4 Pant Shubhra Genetic stock Indigenous Indigenous Table 8. Vegetable varieties developed by Line/Family breeding Crop Cauliflower (6) Variety Hisar -1 Pusa Himiyoti Snowball-16 Pusa Snowball K-1 Punjab Giant-26 Punjab Gant-35 Genetic stock Exotic Exotic Exotic Exotic Exotic Exotic Exotic (Denmark) Exotic (USA) Indigenous Indigenous Indigenous Exotic Cabbage (1) Onion (2) Radish (2) Turnip (1) Pride of India Pusa Ratnar Hisar-2 Pusa Chetki CO-1 Pusa Sweti Table 6. Vegetable varieties developed by recurrent selection.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 5.7) 12 Parents involved Improved Meeruti x Red Cloud Sioux x Improved Meeruti Sel. Vegetable varieties developed by Inbreeding/Inbred selection Crop Cauliflower (3) Variety Pusa Deepali Dania Kalimpong Pusa Snowball-2 Genetic stock Indigenous Exotic Exotic Indigenous Indigenous Muskmelon (1) Palak(1) Hara Madhu All Green Table 7. Hybridization and selection from advanced generations /Pedigree selection Crop Tomato(17) Variety Pusa Early Dwarf Pusa Ruby HS-101 HS-102 Hisar Arun (Sel.12 x Pusa Early Dwarf Pusa Early Dwarf x K-2 . 18) Hisar Lalit Pusa Sheetal Sweet-72 Pusa Gaurav Punjab Kesri Marglobe Keck-Ruth Ageti Pusa Red Plum Sel.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Variety Punjab Chhuhara Hisar Lalima (Sel. Bulgaria) x Jemnorrosnej (exotic.pimpinellifolium (HS-101 x Punjab Tropic) x (H-14 x Punjab Tropic) Arka Vikas x IIHR 554 (Pusa Purple Long x Hyderpur) x Wynad Giant Pusa Purple Long x Hyderpur Aushey x BR-112 Aushey x R-34 T-3 x Pusa Purple Cluster Pusa Kranti x Pusa Purple Cluster Pusa Purple Cluster x R-34 Japanese Long x R-34 GR x Pant Rituraj GR x Pant Rituraj GR x PB 91-1 Dingrass Multiple Purple x Arka Sheel Dingrass Multiple Purple x Arka Sheel Dingrass Multiple Purple x Arka Sheel B-70A x Sathur Samba Kalipeeth x Pusa Jwala Bhagyalakshmix Yellow anther mutant G-2 x B-31 Local x Puri Red NP 46-A x Puri Red Perennial chilli x Long Red NP-46-A x Kandhari (natural cross) G-3 x Huntaka (Exotic. Japan) Lavang Mirche x G-2 Indigenous 13 Brinjal (14) Chilli (12) K-2 Jawahar Mirch-218 X-235 (Bhaskar) G-5 NP 46A Pusa Jwala Punjab Lal Pant C-1 X-197 X-200 Arka Lohit .2 Arka Meghali Pusa Kranti PH-4 Hisar Shyamal (H-8) Hisar Jamuni (H-9) Pant Rituraj Pusa Anupam Punjab Barsati Sadabahar Baingan Pusa Uttam Pusa Bindu Pusa Upkar Arka Nidhi Arka Keshav Arka Neelkanth Parents involved Punjab Tropic x EC-55055 Pusa Early Dwarf x HS-101 Bangalore (resistant) x HS-101 Balkan (exotic.esculentum x L. Russia) Pusa Red Plum x Sioux Glamour (exotic) x Watch (exotic) Punjab Tropic x EC-55055 Marvel x Globe Kachmethi x Rutgers L. escuelntusx A.escuelntusx A.manihot ssp.TM-3 (Sesquipedlais) Pusa Komal x Arka Garima Arka Garima x P. Tetraphyllus A.esculentus x A. Tetraphyllus (MGS-2-3 x 15-1-1) x D-96 EC-12012 x EC-12013 P-88 Cowpea (11) Hyacinth bean (5) Cluster Bean (2) Okra (7) Cauliflower(2) .manihot ssp. Manihot A.manihot ssp.Komal Local Avare x Red Typicus Hebbal Avare-1 x US 67-31 Hebbal Avare x CO-8 Wal-2-K2 x Wal 125-36 CO-8 x CO-1 Pusa Sadabahar x Pusa Mausami Pusa Naubahar x IC-11521 Pusa Makhmali x IC-1542 (Pusa Sawani x Best-1) x (Pusa Sawani x IC7-194) A.manihot ssp. Manihot A.esculentusxA.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Pea (13) Variety Arka Suphal Jawahar Matar-1 (GC-141) Jawahar Matar-2 (GC-477) Jawahar Matar-3 Jawahar Peas-54 Jawahar Peas-83 Hisar Harit Pusa-2 x Morrasis-55 Jawahar Peas-15 (JP-15) JM-6 (JP-4) VL-3 Matar Ageta-6 Arka Karthik Pusa Dofasli S-203 S-488 Pusa Komal Aseem Pusa Rituraj Narendra Lobia-1 BCKV-1 BCKV-2 Arka Suman Arka Samrudhi Hebbal Avare-1 Hebbal Avare-3 Hebbal Avare-4 Wal Konkan-1 CO-2 Pusa Naubahar P-28-1-1 Pusa Sawani Selection-2 Punjab Padmini Punjab-7 Parbhani Kranti Arka Anamika Arka Abhay Pusa Shubhra Pusa Snowball-1 14 Parents involved Pant C1 x IIHR 517A T-19 x Greater Progress Greater Progress x Russian-2 T-19 x Little Marvel (Early December) (Arkel x JM-5) x (‘46C x JP-501) (JM-1 x JP-829) x (‘46C x JP-501) Bonneville x P-23 VL-7 (VL Ageti Matar-7) IP-3 x Arkel (JM-1 x R-98B) x JR-501 A/2 Local Yellow Batri x (6588 x ‘46C) Old SugarxEarly WrinkledDwarf-2-2-9 Massey Gem x Harabona Arka Ajit x IIHR 554 Pusa Phalguni x Philippines Bush Sel.escuelntusx A. Manihot A.2 x Virginia Virginia x Iron Grey (Pusa Dofasli x EC-26410) x P-426 Pusa Dofasli x Philippines Bush Pusa Dofasli x EC-26410 Pusa Komal x Varanasi Local EC-243954 (Unguiculata) x EC-305827 (Sesquipedalis) V-70(Biflora)xSel.manihot ssp. Development of synthetic varieties.29 Local Red x Nantes Pusa Kesar x Nantes EC-9981 x Nantes Snowball x Japanese White Local Red Round x Golden Ball Golden Ball x Japanese White Kutana x PUR-6 (Cantaloupe) Hara Madhu x Edisto Pusa Sharbati x 75-34 IIHR-21 x Crimson Sweet Tetra-2 x Pusa Rasal LC-11 (inbred) x LC-5 (inbred) Swiss Chard x Local Palak Sugarbeet x Local Palak Local Palak x Beetroot IIHR 10 x IIHR 8 UD-102 (White) x IHR-396 (Red) T3(Raj) x T8 (Punjab) IIHR 54 x IIHR 18 IIHR 54 x IIHR 18 Carrot(5) Turnip(3) Muskmelon(3) Watermelon(2) Bottle gourd(1) Palak (4) Onion (1) Round Melon (1) Ridge gourd (2) French Bean (1) Arka Suvidha Blue Crop X IIHR 909 Table 9. Crop Cauliflower(4) Variety Pusa Early Synthetic Synthetic 78-1 Pant Gobi-3 Pusa Synthetic Number of inbred lines involved 6 8 7 - Cabbage (1) Pusa Synthetic 15 .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Cabbage (2) Radish (2) Variety Pusa Mukta Pusa Drumhead Pusa Himani Pusa Safed Pusa Reshmi Imperator Selection-233 Pusa Kesar Pusa Meghali Pusa Yamadagni Pusa Chandrima Pusa Kanchan Pusa Swarnima Pusa Sharbati Punjab Sunheri Hisar Madhur Arka Manik Pusa Bedana (triploid) Punjab Komal Pusa Palak Pusa Harit Banarjee’s Giant Arka Arunima Arka Pitambar Arka Tinda Arka Sujat Arka Sumeet Parents involved EC-10109 x EC-24855 F1 hybrid from Japan Radish Black x Japanese White White-5 x Japanese White Green Top x Desi Type (Asiatic) Nantes x Chanteny Nantes x No. I. Assam Bhubaneswar Dapoli Ludhiana Late blight (Phytophthora infestans) Verticillium wilt (Verticillium sp.H.I.H.I. Arka Neelkanth Pusa Purple Cluster Pusa Anupam Utkal Tarini (BB-7) Soorya (SM-6-6) ARU-2C Pant Rituraj JC-1. Arka Nidhi.TRB-2 Source* Kerala I.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 10.) and Fusarium wilt (oxysporum f. BT-10 Sonali TRB-1. Katrain Bhubaneswar Kerala Almora Pantnagar Assam . Vegetable varieties developed by backcross method of breeding / Disease Resistant varieties Crop Tomato(15) Disease Bacterial wilt (Pseudomonas solanacearum) Resistant or tolerant Variety developed Shakti (LE-79) Arka Alok. Utkal Deepali (BT-2).A. Hisar Gaurav (H-36).R. Vegetable varieties developed by mutation breeding Crop Tomato(4) Variety S-12 Maruthan (CO-3) PKM-1 Pusa Lal Meeruti Chilli (1) French bean (1) Hyacinth bean (1) Okra (1) Bitter gourd (1) Ridge gourd (1) Palak (1) MDU-1 Pusa Parbati CO-10 EMS-8 MDU-1 PKM-1 Jobner Green Mutant type X-ray mutant of Sioux Mutant of CO-1 Mutant of Annagi Gamma ray mutant of Meeruti Gamma ray mutant of K-1 X-ray mutant of Wax pod Gamma ray mutant of CO-6 EMS-treated mutant of Pusa Sawani Gamma ray mutant of MC-103 — Spontaneous mutant from local cultivar Table11. Arka Abhay VC-48-1 Utkal pallavi (BT-1). JC-2 16 Hisar I. H-86.lycopersici) Leaf curl virus Pant Bahar Pantnagar Brinjal (13) Bacterial wilt (Pseudomonas solanacearum) Hisar Anmol (H-24).R. H-88 Arka Keshav.R.I. wilt and die back Bacterial wilt Powdery Mildew Yellow vein mosaic Virus I.K.B.R.R.CMV and TMV. Pusa Sadabahar Pant C-1 Punjab Lal.H.RI.R.I. AAUM-2 Arka Suphal Arka Anamika. Arka Abhay Sel-2 Parvani Kranti Punjab Padmini. Hisar BHU. IIHR Dapoli IIHR IIHR I.A.H.A.I. AAUM-1. JP-83.I.I.R.R.I. Punjab Surkh Utkal Rashmi. Pantnagar Kovilpatti I.P.H. JP-885 Pant P-5.V.A. Cowpea(3) Bacterial blight (Xanthomonas vignicola) Golden mosaic virus Hyacinth(3) Dolichs Muskmelon(4) Yellow mosaic virus Powdery mildew (Sphaerotheca fuliginea) Downy mildew (Pseudopernospora cubensis) Cucumber green Virus BCKV-1 Arka Garima Wal Konkan-1 Arka Jay Arka Vijay Arka Rajhans B. VP:-8902 DMR-7 HFP-4. Punjab Rasila Ludhiana DVRM-1.R.I. Kaliayanpur Jabalpur Pantnagar Palampur Almora I.A.R.R.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Disease Resistant or tolerant Variety developed Pusa Bhairav Pant Samrat K-2 Pusa Jwala. JP-7L. Punjab-7 Varsha Upahar (HRB-9-2) Hisar Barsati (HRB-55) Utkal Gaurav (BO-2) KS-404 Arka Ajit (FC-1) KS-225. HFP-12 HUP-1 Pant Anupama Bean common mosaic Pusa Komal Source* Chilli (10) Phomopsis blight (Phomopsis vexans) Bacterial wilt and Phomopsis Blight Fruit rot (Colletotrichum capsici) Leaf curl virus Leaf curl.R. PMR-21 DPP-62 VP-9003.H. N. I.C. Pea (16) Powdery mildew (Erysiphe polygoni) French bean(1) Leaf spot (Cercospora cruenta). Pantnagar I.A.G. Parvani Ludhiana Hisar Bhubaneswar Kaliyanpur I. Pantnagar Ludhiana Okra (10) Bhubaneswar I.I. KS-245 JP-4. . DVRM-2 17 I.I. Pusa Hybrid-5.I.R. DTH-4. DVR-2 18 . Powdery Mildew (S.A. Pusa Hybrid-9 Vijay Hybrid.campestris) Pusa Mukta.R. Varanasi Pusa Hybrid-1. Onion (2) Anthracnose Arka Manik (Colletotrichum lagenarium). Pant Hybrid-10. Pusa Hybrid-6.I.Phule Hybrid-1. Pant Hybrid-2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Watermelon(1) Disease Resistant or tolerant Variety developed Source* I. Arka Abhijit Pant Hybrid-1. Arka Vardan. Arka Anand Pusa Anmol. Pusa Drumhead Katrain * Full name of the Agricultural Universities and ICAR Research Institutes have been mentioned in Annexure I Table12. NDBH-6. Rahuri I. DOH-4 JOH-5 DVR-1. NDTH-6. Azad Hybrid NDBH-1. DTH-8.H.Public sector hybrids of vegetables Crop Tomato(24) Name of hybrid Source IARI Katrain IIHR Pantnagar Faizabad Rahuri Ludhiana IIHR IIVR IIHR IARI Kanpur Faizabad Rahuri Ludhiana Anand Pantnagar Ludhiana IIHR Solan Katrain Srinagar IARI Parbani PDVR. Arka Sweta Sweet pepper(4) Solan Hybrid-1 KT-1 (Pusa Deepti). NDBH-11.fuliginea) and Downy Mildew (P.H. Pusa Hybrid-2. KT-2 Sel-2 Okra (5) DOH-3. Pusa Hybrid-4 KT-4 Arka Vishal.R. Heterosis breeding. ABH-2 Pant Hybrid-2 Chilli (3) CH-1 Arka Meghana. NDTH-4 Rajashree. Hybrid-37 TH-2312 Arka Ananya Kashi Vishesh Brinjal(18) Arka Navneet. Katrain Cauliflower(2) Cabbage(2) (X.I. NDTH-2. Arka Shreshta. NDBH-7 Hybrid-2 Punjab Hybrid. BH-1 ABH-1.cubensis) Purple blotch Arka Kalyan (Alternaria porri) Nasik Red Black rot (Xanthomonas campestris) and curd and inflorescence blight Alternaria brasicicola) Black rot Pusa Shubhra Pusa Snowball K-1 I. Pant Hybrid-11 NDTH-1. Mangala. Megha Ratna. Summerset Cross B MTH-1. Avinash-2 Arjuna. Pant Sankar Khura-1 DCH-1. DMH-4 Pusa Sanyog AAUC-1. NS-386. MTH-4. Vaishali. Cross B. HOE-616 LHB-230 Source Indo-American Hybrid Seeds Zuari Agro Hindustan Lever Sun Seeds Namdhari Mahyco Beejo Sheetal Novartis Sungro Suttons Nath Seeds Century Seeds Ankur Seeds Nijjar Seeds HOECHEST Pioneer 19 . Nakul SG-9. Bhim. NA-501.Private sector hybrids of vegetables Crop Tomato Name of hybrid Karnatak. Pusa Meghdoot PBOG-1. Sonali. ARTH-16 NH-25. Heterosis breeding . NH-38 HOE-303. Manisha. MTH-16. Naveen. NA-701 Swarna. AAUC-2 PCUC-F1. ARTH-13. SG Prolific. Pusa Hybrid-2. Samridhi. Rashmi. Krishna. TC-159 XLE-006. Sun-230 Gotya. SG-18. Rupali.S-28. MHY-5 Pusa Rasaraj. MTH-15. PBOG-2 Pusa Hybrid-1 Pusa Alankar Pusa Hybrid-1 Arka Kirthiman Arka Lalima Source IARI Katrain IIHR Rahuri Ludhiana Durgapura IARI Katrain Jorhat Pantnagar IARI Faizabad IARI Pantnagar IARI Katrain IARI IIHR IIHR Hybrid-1 Katrain Table 13. Meenakshi. BRH-5 Arka Jyoti RHRWH-2 Punjab Hybrid-1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Cauliflower(1) Cabbage(2) Watermelon(2) Muskmelon(6) Cucumber(7) Bottle gourd(7) Pumpkin(7) Summer Squash(1) Bitter gourd(1) Onion (2) Carrot (1) Name of hybrid Pusa Hybrid-2 (F1 hybrid) H-64 (Hybrid). Gulmohar. MTH-3. SG-12. Sheetal JTH-9 TC-161. Rishi ARTH-3. SG Wonder NA-601. Maitri. ARTH-4. MH-10 MHY-3. Century-12. MTH-2. HOE-606.S-15 Madhuri. NH-15. ARTH-15. S-16. HOE-909. Larica. NS-815. DCH-2 NDBGH-4. NDBGH-7 Pusa Manjari. Karna. MHB-2. HOE-888 HOE-80 Bharat Indira. NAFCR-101 Green Gold Source Sungrow Indo-American Ankur Seeds Mahyco Hoechest Neembakar Pandey Beej Century Seeds Hung Nong Mahyco Novartis Ankur Seeds Bejo Sheetal Seoul Hoechest Hoechest Indo-American Hybrid Seeds Novartis Suttons Nath Seeds Mahyco Indo-American Ankur Seeds Century Seeds Pioneer Seeds Mahyco Nath Seeds Sungrow Sakata Century Nath Seeds Novartis Namdhari Indo-American Hybrid Seeds Chilli Sweet Pepper Okra Varsha.Gayatri Champion HOE-808. Shyamal MHB-1. Kanhaya. MHB-10.8 Nath Shobha Sungrow-35 Candid Charm. MHB-39. ARBH-201. Supriya No. ARBH-258. HIHC-083. AHB-4. Vardan. Adhunik NIHB-090. AROH-9 Panchali. Hot Green. HOE-414 Neembakar-01 PHB-10 Nisha. Vijay Hybrid Seeds AROH-8. MH-10 (Kalpataru). Lario Early Bounty. Cashmere Early Himlata. MH-39 (Ravalya) HOE-404. Gem Giant Hira.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Brinjal Name of hybrid Sungrow Mukta. Sungrow Pragati. No. Skyline Tejaswini Agni ARCH-236 BSS-141.7. Navkiran Suphal Hybrid Seeds AHB-2. Early Himangine Nath Ujwala. White Flesh. Shiva Delhi Hot. ARBH-527. nath Shweta Serrano Namdhari-84 Himani Cauliflower 20 . Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Cabbage Name of hybrid Nath-401. Hari Rani. MHC-6. MHW-11 Charlie Seeds Nath-101. Cabbage No. Sudha.8 Vishesh. MHW-5. Milan. BSS-32 Gloria. Mohini Hybrid Seeds MHW-4. MHC-2 Shweta Seeds Swarna. Uttam. Suvarna. Nath-202 NS-246. Green Challenger Source Nath Seeds Novartis Mahyco Hidnsutan Lever Suttons Beejo Sheetal Daehanfeldt Kaneko Sakata Takli Hung Nong Watermelon Madhur. NS-295 Suruchi Century No. NS-7455 Madhubala Mahyco Sheetal Hybrid Indo-American Hybrid Seeds Namdhari Seeds Century Indo-American Seminis (Syngenta) Golden Seeds Namdhari Senp World Nunhems ProAgro Cucumber Priya Hybrid Seeds Malini Rajdhani NS-404 US-6125 Tripti Aman Bottle gourd Gutka. Rotan Rare Ball Green Boy. OS Cross.Harit Varad Century Mahyco 21 . Sona Abhijit. Herculis Regalia KK Cross. Stone Head. Green Express. Uttara Green Express Bajrang. Nath-102.2 Indo-American Mahyco Sheetal Hybrid Nath Seeds Namdhari ProAgro Century Muskmelon MHC-5. MHW-6. Runa. Green Cornet. Nath-501 Questo Sri Ganesh Gol. BSS-44. Resistalke. Good storage capacity. good storage types and Fusarium wilt resistant. MBTH-1202 No.711 Hybrid Seeds. long shelf life and good paste type. Heat tolerant lines. MSGH-1 Utsav Hybrid-1 Source Mahyco Indo-American Sngrow Century Mahyco Sluisgroat Sungrow Mahyco Century Mahyco Ridge gourd Sponge gourd Carrot Table 14. male sterile lines. Vivek Tijarti Surekha Rohini Gaurav Harita. Future needs of introduction of vegetable materials with specific traits. Lines with high TSS and resistant to storage diseases. Heat tolerant and lines to biotic stresses 22 . Crop Tomato Cucumber Muskmelon Watermelon Onion Garlic Chillies Sweet Pepper Cole Crops Nature of germplasm to be introduced Bitoic and abiotic resistance. Lines with large bulb and clove. Hot types (Mexican types) lines. Yellow fleshed. multiple fruiting and early lines. gynoecious and breeding lines. Biotic resistance.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Crop Bitter gourd Name of hybrid MBTH-101. No.49. Vivekananda Krishi Anusandhanshala. Agriculture College. Horticulture Research Station. Onion Research Station. Ludhiana Solan Hisar Coimbatore Faizabad Kaliyanpur Pantnagar Periakulam Dapoli I. Bangalore. Anand Campus. Konkan Krishi Vidyapeeth. Regional Agricultural Research Institute. National Bureau of Plant Genetic Resources. M. Ranchi. Guntur.N. Gujarat Agricultural University.G. 23 . Udaipur. Associated Agricultural Development Foundation. Maharashtra. Rajasthan Agricultural University. Punjab Agricultural University. Jabbalpur. Rajendra Agricultural University. Kerala Agricultural University. Pantnagar. Orissa University of Agriculture & Technology.A. Bhubaneswar N. TNAU. Andhra Pradesh Agricultural University. Punjab Rao Krishi Vidyapeeth. Rajasthan Agricultural University.B.U. New Delhi. Parbhani. Rajasthan. Department of Horticulture.R. Hisar.S. T. Krishnanagar. Bihar. University of Agricultural Sciences. Sabour. Bhubaneswar. Dholi.P. Ranchi (CHES) : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : IARI Regional Station.P. Central Horticultural Experiment Station. Maharashtra. Coimbatore. Kullu Valley. Marathawada Krishi Vidyapeeth. Mahatma Phule Krishi Viswa Vidyalaya. New Delhi.I. New Delhi.A. Andhra Pradesh Agricultural University.V.R. Regional Agricultural Research Station. U. C.I. Akola. West Bengal. Bidhan Chandra Krishi Viswa Vidyalaya. Godhra. Vellanikkara.P. Srinagar. Indian Institute of Horticultural Research. Sher-e-Kashmir University of Agriculture & Technology. Kovilpetti. Jammu & Kashmir.B. Assam Agricultural University. Ranchi (of IIHR). Durgapura. Kanpur. Narendra Deva University of Agriculture and Technology.P. Hyderabad. Regional Agricultural Research Station. Maharashtra. Lam. Y. Gwalior. Almora West Bengal Anand Akola Kovilpetti Jabbalpur Rahuri Lam Madurai AADF Udaipur Nasik Sabour Ranchi Bangalore Godhra Durgapura Kurnool Vellanikara Palampur Parbhani Jobner Dholi Hyderabad Gwalior Jorhat Srinagar B. Himachal Pradesh.K. Almora. Udaipur. Rajendra Agricultural University. Madurai.C. Dapoli. Department of Agriculture.H. Solan. Kurnool. Jorhat. T. Kaliyanpur. Azad University of Agriculture & Technology. Haryana Agricultural University.P. Government of West Bengal. Tamil Nadu Agricultural University. Central Horticultural Research Station.R. Agriculture College. UP Vegetable Research Station. Coimbatore. Ludhiana. Department of Horticulture. G. Himachal Pradesh Indian Agricultural Research Institute. Gujarat (of IIHR). Maharashtra. Rahuri. Birsa Agricultural University. Periyakulam. Andhra Pradesh.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Annexure I – Source Katrain I. Katrain. Kurnool Research Station. Bihar. U. Horticulture Research Station. Karnataka.P.N. Himachal Pradesh. Maharashtra. Rajendra Nagar. Gujarat. Agricultural Research Station. U.Pant University of Agriculture & Technology.S. Bangalore. Tamil Nadu. M. Kerala. College of Agriculture. Nasik. Bihar. Faizabad.Parmar University of Horticulture & Forestry. Bihar. Jobner Campus. Jawaharalal Nehru Krishi Viswa Vidyalaya. National Conservatories have been established for all major spices. aroma. The International Standards Organization (ISO) listed about 112 plant species as spices but only 53 spices are included in spices Act. pungency and for seasoning the food. 1994. Rao and Rao. 2000. due to the specific agro-climatic requirements of most spices and their vegetatively propagated nature the conservation is mainly at Indian Institute of Spices Research (IISR). and many of these countries eventually became competitors for India in production and trade of spices. Kerala. From the Indian sub-continent. In fact. turmeric... of a large collection of germplasm and development of over 200 improved cultivars of various spices including the seed and tree spices. Ravindran and Babu. 2. Govt. Sasikumar et al. Nirmal Babu2 Spices are defined as natural plant or vegetable products or mixtures thereof. garcinia and cinnamon where the good variability exists. 1992). India is considered as the magic land of spices and is the native home of black pepper. Kerala Agricultural University. K. Of these. around the world. fennel. The research and development programmes initiated by Indian Council of Agricultural Research and various State Agricultural Universities and Departments during last few decades led to the assemblage 1. social. only 12 are commercially important and are grown at large scale in one or the other states and play a major role in the economy. spread of improved cultivars. Cultivars and land races Black pepper: Over 100 cultivars exist in 24 . seed and herbal spices as a safe additive (Krishnamoorthy and Rema.1 and K. fenugreek. Ravindran et al. which are used for imparting flavour. tamarind. 1994a. 1994. Conservation of genetic resources Conservation of genetic resources is extremely important in the context of rapid gene erosion that is taking place due to a variety of abiotic. The loss of land races and traditional varieties is rapid in certain crops such as black pepper due to devastating diseases. Indian Institute of Spices Research. Each country has its own traditional cultivars/ races/ types of the different spices. They are cultivated in many countries in wide variety of geographical regions. Nirmal Babu et al. of India. there is no state in India that does not grow spices and in turn play an important role for the lives of the people and for their own economic sustainability.. some especially herbal spices are of temperate and seed spices are sub tropical or arid in distribution. Spices are generally tropical. 1994. curry leaf and to certain extent ginger. India is blessed with varied agro-climatic and agro-ecological approaches that enable us to grow a large number of spices in one or the other. At the Indian Institute of Spices Research (IISR). However. Germplasm collections are also being maintained at the All India Coordinated Research project on Spices (AICRPS) Centers (Table 1). biotic. Thrissur.V. 1999. Mohanty and Panda 1994. The National Bureau of Plant Genetic Resources (NBPGR) also maintains germplasm collections of various spices at its regional stations. Madhusoodanan et al.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era ADVANCES IN SPICES BREEDING Peter. Kozhikode. these spices spread over to most of the tropical part of the countries. political and economic factors. The germplasm of spices is conserved in clonal field repositories and also in in vitro gene banks in vegetatively propagated crop species and seed gene banks in paprika. cardamom. paprika and cumin were introduced from other countries. deforestation etc. Other seed spices like coriander. Jobedi etc. The variability in ginger germplasm against the dreaded rhizome rot and bacterial wilt is very narrow. Narayakodi. Duggirala. There is good variation for 25 crude fibre contents and dry recovery with in the germplasm which determines the suitability of each cultivar for dry ginger making. Good variability exists in cardamom with regard to quality characters such as essential oil content and the quantity of 1. yield and quality. Considerable variability exists among cultivars with regard to morphology. 1994).8-cineole and alpha-terperyl acetate in essential oil (Zachariah et al. 2000). Kuruppampady and Bhaise are some of the local popular cultivars (Mohanty and Panda. Kottanadan. Kasturi Tanuku and Armoor are tolerant to leaf blotch. Indian ginger is known for its quality and flavour. Cultivars Armor. retention of green colour etc. Sugandham. Nadia. This also hampers the conventional breeding programmes. Kottanadan. Maran. Cultivars Mannuthy local and Kuchipudi are tolerant to shoot borer.. They might have had their origin from wild forms by domestication and selection (Ravindran et al. Turmeric: There are many popular turmeric cultivars. (Madhusoodanan et al. Exotic cultivar Jamaica has very low fibre content making it highly suitable for making ginger powder. nature of the panicle. The cultivars are grouped into short duration ‘kasturi’ types.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era black pepper. Others like Aimpirian. Turmeric sets seed only in certain locations and IISR has developed over 100 seed generated lines.have been identified. Bhavanisagar. Alleppey. Cardamom : Based on the adaptability. Ginger: There is no natural seed set in ginger which resulted in limited variability with regard to certain characters. Suguna and Sudarshana were reported to be field tolerant to rhizome rot. Glpuram-2. Mysore and Vazhukka . Chumala. Cultivars Mannuthy local. No genotype is either tolerant or resistant to these diseases. 1994). There is very little variability in pepper germplasm for resistance to biotic and abiotic stresses. Kumbhakodi and Aimpirian are cultivars with high oleoresin and essential and hence give high quality pepper (Ravindran and Babu. Waynad local. Rajapuri. are some of the popular local cultivars which are essentially named after the places where they are grown extensively. 1994). over 22 high yielding varieties have been released for cultivation. Kuthiravally. Gorakhpur. curcumin and oleoresin contents determine the quality of turmeric and high variability was observed in turmeric germplasm with respect .. Variations have also been reported in important characters like branching of inflorescence. Balankotta. Kalluvally. GLpuram. medium duration’ kesari’ types and long duration types (Rama Rao and Rao. Cultivars Assam and Thodupuzha have high dry recovery. They are generally named after the localities from where they are cultivated or collected. many commercial cultivars of ginger are known. China. Cultivar Karimunda is the most popular and it gives consistent yields under varying agro-climatic conditions. Himachal. Kothapeta is medium duration crop while Kasturi is short duration crop. shape and size of fruits three types of cultivated cardamom -Malabar. Rio-de-Janeiro. Nandyal. shape. Jamaica. 1994b). 1998). and Mydukur are long duration crops.. High variation was also observed for oleoresin and essential oil contents which contribute to the quality of the spice. which are specific to each region of cultivation. Neelamundi. Cultivar Kuching is most popular variety in Malaysia. leaf and plant pubescence. Tekurpet. There is reasonable variation with regard to reaction to pests and diseases. The hybrid Panniyur – 1 is also as popular as Karimunda. Armoor. Tekurpeta and Kodur are tolerant to leaf spot while Mannuthy local. Malligesara and Thommankodi are popular in certain locations. Dry recovery. However. In India. fruit (capsule) size. Recently a few tolerant lines were identified at IISR. As it is an obligatory cross-pollinated tree (being dioecious). all the seed spices are cross pollinated and hence the traditional varieties of these crops exist in the form of complex gene mixtures. Cinnamon is the earliest known spice and is native to Sri Lanka. Fennel (Foeniculum vulgare Miller) and Fenugreek (Trigonella foenumgraecum L. areas of adoption and important agronomic characters are given in Table 2. None of these are native to India. 12 black pepper .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era to these characters (Khader et al. branches per plant.4-3. Breeding and development of varieties In the effort to raise production and productivity of spices. High variability was observed in the chemical and aroma quality with in nutmeg populations.. A reasonable amount of genetic diversity is available in India. primary importance was given for evolving high yielding varieties with good quality attributes. Ravindran and Johny. Tree spices: Cinnamon (Cinnamomum verum Brecht.. 1987). Seed and herbal spices: Coriander (Coriandrum sativum L. yield per plant. Hence pepper breeding was essentially dependent on clonal selections. The varieties released so far in various spices.). king clove with extra bold flower bud and dwarf clove with short and spreading growth habit (Krishnamoorthy and Rema. Myristicin is the most important component of nutmeg.). while a few are from seedling selection and very few are due to recombination breeding (Edison et al. 1994). 1994). considerable variation is observed with respect to growth and vigour. Black pepper: Black pepper has good variability for various agronomic and quality attributes but variability is limited or resistance to biotic and abiotic stresses. content and aroma character of volatile oil for which there is significant variability in the cultivars (Krishnamoorthy and Rema. But presently. Except fenugreek. sex expression. 1994). et Perry) Tamarind (Tamarindus indica L.). the centers responsible for developing the variety. So far. 1994). Fennel and Fenugreek are cultivated over wide variety of agro climatic regions in the country. Clove (Syzygium aromaticum (L. 2000). days to maturity etc (Sarma. plant height. selections from germplasm and selections from open pollinated progenies of popular cultivars. Clove also is native to Moluccas and was introduced to India. In India the genetc variability for clove is very narrow because of it’s self pollinating nature. Yet Coriander. Nutmeg produces two separate spices. Nutmeg is a dioecious tree native to Moluccas and was introduced to India.) are the seed spices of relevance in India. A few variants identified are Zanzibar clove with more anthocianin.). Seed fat ranged from 1048 per cent. Good range of variability exists for important characters such as days for flowering. A few selections from curry leaf were also identified and released as varieties with high oil and flavour. Nutmeg (Myristica fragrans Houtt. & Presl. Most of these varieties were evolved by clonal selections from germplasm. the nutmeg and the mace. Cumin (Cuminum 26 cyminum L.) Merr. 1991.) Sprengel) are tree spices of importance. size and shape of nutmeg and quantity of mace.) and Curry leaf (Murraya koenigii (L.4 per cent (Gopalam and Sayed. But variability for resistance to pests and diseases is limited. most improvement programmes are based on inter cultivar hybridization and recombination breeding to develop varieties resistant to biotic and abiotic stresses. The quality of cinnamon depends on the appearance. their pedigree. Though India is the native home of tamarind not much work was done in this crop except a few dwarf and sweet types were selected from germplasm. Evaluation and selection within the germplasm has led to the isolation of many elite varieties. oleoresin from 2-14 per cent and essential oil from 1. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era varieties were released for cultivation in India. Of these, only two are hybrids while others are of clonal selections from germplasm or from open pollinated progenies. PLD 2 is a high quality variety suitable for industrial extraction of oils and oleoresins while Pournami is tolerant to root knot nematode. Panniyur 1 has bold berries while Panniyur 5 is suitable for mixed cropping. Malaysia and Indonesia have research programmes on black pepper. Malaysia has developed two important varieties. The variety Semongok Perak was developed by clonal selection and Semongok Emas by hybridization followed by back crossing. The latter is highly tolerant to Phytophthora foot rot disease. In Indonesia, two selections – Natar 1 and Natar 2 have been evolved. In Madagascar selections Sel IV.1, Sel IV.2 have been developed from cultivars introduced from Indonesia (Ravindran et al., 2000). Cardamom: Cardamom breeding depend on selections from germplasm and from open pollinated progenies of popular cultivars. Nine high yielding varieties of cardamom were released for cultivation while one more line NKE –12, a katte virus tolerant line is in the final process of release. RR1 is a variety tolerant to rhizome rot disease of cardamom while ICRI 4 is relatively field tolerant. PV 1 has long and bold capsules while CCS 1 was highly suitable for high density planting because of its compact plant type. Hybridization between NKE, RR, extra bold and Multibranch types are in progress to pyramid these characters into single varieties. Ginger and Turmeric: Five ginger and eighteen turmeric varieties were released so far for cultivation. In ginger variety IISR Varada has low fibre while Suruchi has bold and attractive rhizomes. Surabhi is an induced mutant suitable for both rainfed as well as irrigated conditions. Himgiri is suitable for green ginger and reported to have tolerance to rhizome rot. In turmeric most of the varieties are clonal selections from germplasm except Prabha and Prathibha which 27 were the first ever varieties developed from seedling progenies. They are also rich in curcumin content. Varieties Suguna and Sudarshana are short duration varieties with field tolerance to rhizome rot. In turmeric, we have varieties suitable for every turmeric growing state. Mutant and polyploid lines were also developed and are in various stages of evaluation. Tree spices In cinnamon, priority is given to develop lines with high cinnamaldehyde. The varieties Navashree and Nithyashree have high cinnamaldehyde (Krishnamoorthy and Rema, 1994, Krishnamoorthy et al., 1996). So far, five high yielding varieties of cinnamon, two high quality and high yielding nutmegs selected from germplasm were recommended for release. In curry leaf, only one high yielding high essential oil variety with good flavour, named Suvasini was released for cultivation. Seed and herbal spices: Among seed spices, powdery mildew and Fusarium wilt in coriander, Fusarium wilt and Alternaria blight in cumin, powdery mildew and sugary disease in fennel and powdery mildew and wood rot in fenugreek are the major production constraints. So far, 18 coriander, 5 cumin, 6 fennel and 4 fenugreek varieties were released for cultivation. Though most of the released varieties are high yielders, only few of them have shown partial field tolerance to these diseases and resistant varieties are not available. Only Gujarat cumin 3 was reported to be resistant to wilt (Vedamuthu et al., 1994). Fennel variety PF35 is moderately tolerant to leaf spot, leaf blight and sugary disease. Fenugreek variety Lam selection-1 has field tolerance to major pests and diseases. Coriander varieties Co 2, Co 3 and Hissar Anand are dual purpose varieties while Sadhana and Swathi are tolerant to white fly. Most of the earlier work on spices Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era improvement concentrated mainly on developing high yielding lines alone. Some of them incidentally have high quality and good adaptability. Lesser importance was given to other characters like high quality and diseases and pest resistance, though they were not lost from the programme. Only in seed spices, mass or pureline selection and in some case recurrent selection methods were adopted. Occasionally, mutation breeding was used in ginger, turmeric and cumin which resulted in development of new varieties. Recently, more emphasis is being given to convergent breeding programmes of various spice crops to develop high quality lines and resistant lines to biotic and abiotic stresses, in addition to higher yield. For example, high priority is now given to develop varieties tolerant/ resistant to Phytophthora foot rot. A large number of inter cultivar hybrids, open pollinated seedling progenies and accessions in germplasm are being evaluated for this purpose. A few intercultivar hybrids in black pepper, inter varietal hybrids and natural katte escapes in cardamom have been developed. Seedling progenies in turmeric are highly promising and are in advanced stages of evaluation. Promising and high yielding black pepper genotypes suitable for mixed cropping system in coffee and tea plantations which can give good yields at low shade and high elevations (3,000 ft MSL) are in advanced stages of evaluation (Madhusoodanan et al., 1994b, Ravindran and Babu, 1994, Ravindran et al., 2000). Biotechnological approaches for spices crop conservation and improvement The past few years have witnessed a dramatic increase in our ability to manipulate and study tissues and has resulted in commercial propagation of many crop species, development of new varieties and new breeding lines via somaclonal variation, anther culture and protoplast fusion. Production of secondary metabolites, flavour and colouring components through bioreactor technology, recombinant 28 DNA technology and use of transgenics with increased production levels have great significance in spices (Nirmal Babu et al 2005). Micro rhizomes: Rhizome formation in vitro, was reported in long term cultures of ginger, turmeric and Kaempheria. In vitro formed rhizomes are important source of disease-free planting material ideally suited for germplasm exchange, transportation and conservation similar to that of microtubers of potato. In vitro conservation of germplasm: Storage of germplasm in seed banks is not ideal in many spices as most of them are vegetatively propagated and seeds are recalcitrant and heterozygous. Hence, storage of germplasm in vitro is a safe alternative. Conservation of pepper, cardamom, seed and herbal spices, vanilla and ginger germplasm in in vitro gene bank by slow growth and through cryopreservation was reported. Conservation of genetic resources in invitro gene banks is now an established convention and two gene banks for conservation of spices germplasm functions at IISR and National Bureau of Plant Genetic Resources. Somaclonal variation and in vitro selection for tolerance to diseases Somaclonal variation is an important source of variability in crops like ginger, turmeric and vanilla where the native variability is very low and seed set is either absent or difficult. Attempts on induction of variability on somaclones for important agronomic characters and tolerance to diseases through both in vitro and in vivo selection were reported in black pepper, cardamom, ginger and galangal. Variants with high curcumin content were isolated from tissue cultured plantlets. Genetic transformation Recent advances made in developing techniques for transfer of foreign DNA into plant cells have aroused much interest in the Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era possibility of utilizing recombinant DNA technology in crop improvement. Reports are available on Agrobacterium mediated gene transfer system in black pepper, bell pepper and direct gene transfer by particle bombardment in ginger and cardamom. Production of secondary metabolites Biotechnology can be utilized to exploit the potential of spices for bioproduction of useful plant metabolites. Plant cells cultured in vitro produce wide range of primary and secondary metabolites of economic value. This technique is all the more relevant in recent years due to the ruthless exploitation of plants in the field leading to reduced availability. Trials are in progress for production of primary and secondary metabolites and flavour and colouring compounds like capsaicin and biotransformation of ferulic acid vanillamine to capsacin and vanillin in immobilised cell cultures of Capsicum frutescen and in vitro synthesis of crocin, picrocrocin and safranel from saffron stigma and colour components from cells derived from pistils. Production of essential oils from cell cultures and accumulation of essential oils by Agrobacterium tumefaciens transformed shoot cultures of Pimpinella anisum was also reported. Regulation of the shikimate pathway in suspension culture cells of parsley and production of anethole from cell cultures of Foeniculum vulgare, production of monoterpene by transformed shoot cultures of Mentha , biosynthesis of sesquturpenic phytoalexin capsidol in elicited root cultures of chilli, production of rosmarinic acid in suspension cultures of Salvia officinali, production of phenolic flavour compounds using cultured cells and tissues of vanilla, in vitro production of petroselinic acid from cell suspension cultures of coriander are also available. Though the feasibility of in vitro production of spice principles has been demonstrated, methodology for scaling up and reproducibility need to be developed before it can reach commercial levels. 29 Genomics In recent times there is increased emphasis in molecular markers for characterization of the genotypes, genetic fingerprinting, in identification and cloning of important genes, marker assisted selection and in understanding of inter relationships at molecular level. Molecular markers were used for crop profiling, molecular taxonomy, identification of duplicates, hybrids, estimation of genetic fidelity of micropropagated and in vitro conserved plants in pepper, ginger, turmeric vanilla cardamom, tree spices etc. Mapping population was also developed for construction of molecular map and to tag important genes in black pepper (Nirmal Babu et al 2005).Studies are also in progress for tagging important genes for useful agronomic traits and QTLs for marker aided selection in black pepper and cardamom. Comparative genomics has already made much headway in US for solanaceous crops to which capsicum belongs (Tanksley et al 1988, Livingstone et al 1999). Similarly Global Musa Genome Consortium involving 27 institutions in 18 countries was in operation to elucidate musa genome architecture. The Musa Genome Resources Centre (MGRC) was established at the Laboratory of Molecular Cytogenetics and Cytometry of the Institute of Experimental Botany (IEB), Olomouc, Czech Republic in 2003. The information generated helps in better understanding of other related sub families like Zingiberaceae to which important spices like cardamom, ginger and turmeric belongs. REFERENCES Edison, S., Johny, A.K., Nirmal Babu, K. and Ramadasan, A. (1991) Spices Varieties. A Compendium of morphological and agronomic characters of improved varieties of spices in India. National Research Centre for Spices (ICAR), Kerala, 63 p. Gopalan, A. and Sayed A.A.M (1987) Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Evaluating chemical and aroma quality of nutmeg accessions, Myristica fragrans L, Indian Spices 14: 9-11. Khader, M.A., Vedamuthu, P. G. B. and Balashanmugam, P. V. (1994) Improvement of Turmeric. In Advances in Horticulture, Plantation Crops and Spices. K L Chadha and P Rethinam (eds.) Malhotra Publishing House, New Delhi, Vol. 9. p. 315- 332. Krishnamoorthy, B. and Rema, J. (1994) Genetic Resourses of Tree Spices.In Advances in Horticulture, Plantation Crops and Spices. K L Chadha and PRethinam (eds.) Malhotra Publishing House, New Delhi, p. 169 -192. Krishnamoorthy, B., Rema, J., Zachariah, T.J., Abraham, J. and Gopalam, A. (1996) Navashree and Nithyashree – two new high yielding and high quality cinnamon (Cinnamomum verum Bercht & Presl.) selections, J. Spices and Aromatic Crops, 5 : 28 –33. Livingstone, K.D., Lackney, V.K., Blauth, J.R., van Wijk, R. and Jahn, M.K. 1999. Genoome mapping in Capsicum and the evolution of genome structure in the Solanaceae. Genetics. 152 : 1183-1202. Madhusoodanan, K. J., Kuruvilla, K.M. and Priyadarshan, P.M. (1994a) Genetic Resourses of Cardamom. Advances in Horticulture, Vol. 9. Plantation Crops and Spices. In. K L Chadha and P Rethinam (eds.) Malhotra Publishing House, New Delhi, p. 121 - 130. Madhusoodanan, K. J., Kuruvilla, K .M. and Priyadarshan, P. M. (1994b) Improvement of Cardamom. Advances in Horticulture, Vol. 9. Plantation Crops and Spices. In. K L Chadha and P Rethinam (eds.) Malhotra Publishing House, New Delhi, p. 307-314. Mohanty, D. C. and Panda, B. S. (1994) Genetic Resourses of Ginger. Advances in Horticulture, Vol. 9. In. K L Chadha and P Rethinam (eds.)Plantation Crops and Spices. 30 Malhotra Publishing House, New Delhi, p. 150 -168. Nirmal Babu, K., Geetha, S. P., Minoo, D., Ravindran, P. N. and Peter, K. V. (1999) In vitro conservation of germplasm. pp :106-129, In. Biotechnology and its application in Horticulture. In S P Ghosh (ed) Narosa Publishing House, New Delhi. Nirmal Babu, K., Sasikumar, B., Ratnambal, M. J., Johnson George, K. and Ravindran, P. N. (1993) Genetic variability in turmeric (Curcuma longa L.) Indian J. Genetics. 53: 91-93. Nirmal Babu, K., Minoo, D., Geetha, S.P., Ravindran, P.N. and Peter, K.V. (2005) Advances in Biotechnology of Spices and Herbs. Ind. J.Bot.Res. 1: 155-214. Rao, M. R. and Rao, D. V .R. (1994) Genetic Resourses of Turmeric. Advances in Horticulture, Vol. 9. Plantation Crops and Spices. In. K L Chadha and P Rethinam (eds.) Malhotra Publishing House, New Delhi, p. 131 – 150. Rattan, R. S. (1994) Improvement of Ginger, Advances in Horticulture, Vol.9. Plantation Crops and Spices. In. KL Chadha and P Rethinam (eds.)Malhotra Publishing House, New Delhi, p.333– 344. Ravindran, P.N. and Nirmal Babu, K. (1988) Black pepper cultivars suitable for various regions. Indian Cocoa, Arecanut & Spices J. 11 : 110-112 Ravindran, P. N. and Nirmal Babu, K. (1994) Genetic resources of Black pepper. In. Advances in Horticulture, Vol. 9. Plantation Crops and Spices. K L Chadha and P Rethinam (eds.). Malhotra Publishing House, New Delhi, p. 99-120 Ravindran, P. N., Nirmal Babu, K., Sasikumar, B. and Krishnamoorthy, K. S. (2000) Botany and crop improvement of black pepper, pp. 23-142, In. Black pepper, Piper Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era nigrum. P N Ravindran (ed.).Harwood Academic Publishers, Amsterdam, The Netherlands. Ravindran, P.N. and Johny, A.K. (2000) High yielding varieties in Spices, Indian Spices 37: 17-19. Ravindran, P.N., Sasikumar, B., Johnson George, K., Ratnambal, M. J., Nirmal Babu, K., Zachariah, T.J. and Ramakrishnan Nair, R. (1994). Genetic resources of ginger and its conservation in India. Plant Genetic resources News letter, (IPGRI) 98: 1-4. Sarma, Y.R., Ramana, K.V., Devasahayam, S. and Rema, J. (eds) (2001) The Saga of Spice Research – A voyage through history of spice research at Indian Institute of Spices Research. Indian Institute of Spices Research, Calicut, Kerala. Sasikumar, B., Nirmal Babu, K., Jose Abraham. and Ravindran, P. N. (1992) Variability, correlation and path analysis of ginger germplasm. Indian J. Genetics, 52 : 428431. Sharma ,A. K. (1994) Genetic Resourses of Seed Spices. Advances in Horticulture, Vol. 9. Plantation Crops and Spices. In. K L Chadha and P Rethinam (eds.) Malhotra Publishing House, New Delhi, p. 193 - 208. Sukumara Pillay, V., Ibrahim. K. K. and Sasikumaran, S. (1994) Improvement of Black pepper. Advances in Horticulture, Vol. 9. Plantation Crops and Spices. In. K L Chadha and P Rethinam (eds.). Malhotra Publishing House, New Delhi, p. 293-206. Tanksley, S.D., Bernatzky, R., Lapitan, N.L. and Prince, J.P. 1988. Conservation of gene repertoire but not gene order in pepper and tomato. Proc. Natl. Sci. USA. 85 : 64196423. Vedamuthu , P. G. B., Khader, M. A .and Rajan, F. S. (1994) Improvement of Seed Spices Advances in Horticulture, Vol. 9. Plantation Crops and Spices. In. K L Chadha and P Rethinam (eds.) Malhotra Publishing House, New Delhi, p. 345 – 374. Zacharia, T. J., Mulge, R. and Venugopal, M. N. (1998) Quality of cardamom from different accessions. In. Developments in Plantation Crops Research, Mathew N M and Jacob C K (Eds.). Allied publishers, India. pp. 337-340 31 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1. Germplasm collections of spices at major canters in India Crop Black pepper Cardaman Ginger Turmeric Clove Cinnamon Nutmeg Garcinia Vanilla Paprika Cumin Fennel Fenugreek Coriander — — — IISR 2299 395 659 899 235 408 482 61 68 40 AICRPS centres 367 336 406 1136 42 41 42 — — — — 420 944 1467 Maintenance centres IISR, Panniyur, Sirsi, Chinthapalli, Yercaud, Pundibari, Dapoli IISR, ICRI, Mudigere,Pampadumpara IISR, Solan, Pottangi, Kumarganj, Pundibari, Raigarh, Dholi IISR, NBPGR, Jagtial, Dholi, Pottangi, Raigarh, Pundibari, IISR, Yercaud, Dapoli, Pechiparai IISR, Yercaud, Dapoli, Pechiparai IISR, Yercaud, Dapoli, Pechiparai IISR, KAU IISR, ICRI, KAU IISR 495 Jobner, Jagudan Jobner, Jagudan, Dholi Coimbatore, Guntur, Jobner, Jagudan, Hisar , Dholi, Coimbatore, Jobner, Guntur, Hisar, Dholi, Raigarh, Kumarganj Table 2. Improved varieties of Spices Crop Breeding strategies Released varieties Important characters high yield, high oleoresin, high oil, high piperine, suitable for high elevation and resistant to Phytophthora and M.incognita Black pepper Selection from clonal and open Panniyur 1,2,3,4,5,6,7, PLD-2, pollinated seed progenies and Sreekara, Subhakara, Panchami, Hybridization Pournami, IISR Thevam, IISR Shakti, IISR Malabar excel, IISR Girimunda Cardamom Selection from open pollinated Mudigere 1, Mudigere 2 PV 1, High yield, high quality bold and seed progenies and Hybridization PV 2 CCS 1, ICRI 1, ICRI 2, elongated fruits, resistance to ICRI 3, ICRI 4, RR-1, IISR Katte and rhizome rot Avinash, IISR Vijeta Selection and mutation breeding Suprabha, Suruchi, Surabhi, High yield, low fibre, extra bold Himgiri, IISR Varada, IISR rhizomes, Rejatha, IISR Mahima Ginger 32 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Turmeric Selection from germplasm, from open pollinated and seedling progenies Co.1, Krishna, Sugandham, BSR.1, Roma, Suroma, Rajendra Sonia, Suguna, Suvarna, Sudharsana, Ranga, Rasmi, BSR.2. IISR Prabha, IISR Prathiba, Megha turmeric 1, Kanthi, Sobha, IISR Kedaram, Sona, Varna .Alleppey Supreme, Suranjana, Pant Peethabh Nithyasree, Navasree, YCD.1, Konkan Tej, RRL(B) C-6, Sugandhini, , PPI (C)-1 Konkan Sugandha, Vishwasree, Konkan Swad Guj. Cor.1 Co.1, Co.2, Co. 3 and Co.4 Guj.Cor.2, Rajendra Swathi, RCr.41, RCr 436, RCr 684,Sadhana, Swathi CS 287 CO.3 Sindhu Hisar Anand, Azad Dhania-1 RCr 20 RCr 435, Pant Haritima, Hisar Sugandh, Hisar Surabhi, CIMPO-33, CIMPO33 Mc.43, 5-404, Guj. Cumin 1,RZ-19 Guj Cumin 2, Guj. Cumin 3, Guj. Cumin 4, RZ-209, RZ-223 PF – 35, Co.1, Guj Fennel 1 Guj fennel 2 RF 101, RF 125, Azad snauf-1, S-7-9, Pant Madhurika, Rajendra Saurabh Co.1 Rajendra kanti RMt.1 Lam sel.1 Hisar Sonali, Co 2 ,RMt 303 Guj Methi 1 , Rajendra Abha, Hisar Madhuri, Hisar Suvarna, Hisar Muktha, , Guj Methi 1, RMt 1, RMt 143, RMt 305, Rajendra Khushbu, Pant Ragni, Pusa early bunching High yield, high curcumin, short duration, field resistance to rhizome rot, suitable for both rainfed and irrigated conditions Cinnamon Selections from elite lines and seed progenies High yield, high quality Nutmeg Selections from elite lines and seed progenies Bulk, pure line and recurrent selections High yield, high myristicin Coriander High yield, high quality Cumin Bulk, pure line and recurrent selections,Mutation breeding High yield, high quality Fennel Bulk, pure line and recurrent selections High yield, high quality Fenugreek Bulk, pure line and recurrent selections High yield, high quality, duel purpose types, early maturing types, bold grains, short plant types, Chilli Bulk and pure line selection, Convergent breeding About 56 vareties High yield, good colour, bacterial wilt and virus resistance, short plant High oil Dwarf high yielding and sweet types Curry leaf Tamarind Clonal and seedling selection Clonal and seedling selection DWA-1, DWA-2, PKM-1, DTS –1, Prathisthan, MH- 263 33 6% in groundnut in the last 40 years. cf Dashiell and Fatokun. These were used in research to develop improved cultivars that has resulted in increase of productivity and production considerably of various crops. characterization. mutant etc. Similarly. The ICRISAT genebank has been supplying over 21. The utilization of Norin 10 gene in wheat and Dee Geo Woo Gen in rice (sources of reducing plant height) have revolutionized the production of these crops globally.2% productivity increase in soybean and 69. 66 varieties were released for cultivation in 44 countries. genetic stocks. diverse germplasm sources having traits of 1. Currently over six million-germplasm accessions are held in over 1300 genebanks across the world. tolerance to pod shattering. The value of genetic resources in developing superior crop cultivars is well recognized.. Introduction The wealth of plant genetic resources that includes landraces. Most of the accessions have been characterized. 1997) that resulted in 93. Various institutes and organizations worldwide have donated germplasm to the ICRISAT genebank. India 34 . old and new cultivars. Germplasm seeds are conserved under very precise (cool and dry) conditions.. This paper discusses assembly and management of genetic resources of sorghum. In addition. mini-core and composite collections to enhance utilization by the breeders. cf Singh and Nigam. Molecular characterization of diverse germplasm sets is pursued for value addition and to enhance their utilization. ICRISAT has restored crop germplasm to several countries including India. mutants etc. old and new cultivars. and C. promiscuous nodulation and high yield. chickpea. From the basic germplasm supplied from ICRISAT genebank. 1997) and groundnut (broadening genetic base. The entire holding is over 118. adding disease resistance and high yield. Diverse genotypes were used in developing improved cultivars of soybean (resistance to diseases and insectpests. pigeonpea.000 germplasm samples annually to scientists across the countries. Andhra Pradesh. Wheat productivity increased by 137% and of rice by 93% in last 40 years due to the improved cultivars (Table 1). Adequate seed of each accession is conserved to meet the requests of researchers and for posterity.D1.800 accessions of the above crops from 130 countries. H. The need for collecting and conserving germplasm was realized during 1960s. Gowda ABSTRACT Crop plant genetic resources (PGR) including landraces. when there was threat of loss of landraces due to large adoption of improved varieties. groundnut and six small millets at the Rajendra S Paroda Genebank at ICRISAT-Patancheru. conservation and distribution.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era ENHANCING UTILIZATION OF PLANT GENETIC RESOURCES IN CROP IMPROVEMENT Upadhyaya. coupled with good agronomic management. India and means to further enhance their utilization for sustainable agriculture globally. The germplasm accessions receive high priority for regeneration. The focus of research is on diversity assessment and on developing representative core. environment protection and sustainable development. are vital to crop improvement.L. two hundred and thirteen germplasm collection missions were organized in 62 countries securing 33. pearl millet. Patancheru 502 324.194 germplasm accessions. International Crops Research Institute for the Semi-Arid Tropics (ICRISAT).L. poverty alleviation. has contributed enormously towards achieving the global objectives of food security. 1998). conservation and distribution of germplasm of five mandate crops 35 (sorghum. The germplasm material of chickpea and pigeonpea originally collected and assembled by the former Regional Pulse Improvement Project (RPIP). the United States Department of Agriculture (USDA) and Karaj Agricultural University in Iran. pigeonpea and groundnut) and six small millets (finger millet. little millet. The International Crops Research Institute for the Semi-Arid Tropics (ICRISAT). and USDA. much of the groundnut germplasm was received from the Indian groundnut research program. fisheries. and ICRISAT acquired 11. efforts were begun to assemble the germplasm of the mandate crops that existed with various research institutes in India and other countries. and at the USDA. Besides germplasm donations by the All India Coordinated Research Projects on various crops. one of the 15 CGIAR centers. besides 2000 pearl millet accessions. ICRISAT also acquired over 1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era short-duration.961 accessions of this collection in 1974 that existed in India and USA. Germplasm Assembly in the ICRISAT Genebank When ICRISAT was established in 1972. The development and spread of high yielding varieties of wheat and other crops by 1960s started replacing the local cultivars very rapidly leading to erosion of plant diversity. a joint project of the Indian Agricultural Research Institute (IARI). forestry. policy and environment. Germplasm contributions have helped lay the foundations of recovery by jumpstarting agricultural growth in countries emerging from conflict such as Afghanistan. Angola. which were available in several agricultural research institutes in India and Iran. proso millet and barnyard millet) and their wild relatives. This loss of native crop landraces and cultivars prompted the international organizations such as the Food and Agriculture Organization (FAO) and the World Bank to create new institutional structures for the collection and preservation of valuable plant genetic resources in ex-situ genebanks. Since the last four decades.. characterization. considerable number of germplasm were received from agricultural universities at .200 chickpea accessions from the Arid Lands Agricultural Development (ALAD) program in Lebanon. Junagadh]. ICRISAT also obtained 2000 accessions of pearl millet collected by the Institut Francais de Recherché Scientifique pour le Development en Cooperation (ORSTOM) in francophone West Africa. The concern of PGR exploration and ex-situ conservation was not serious until 1960s. available to all researchers. 1997). 1997) and pigeonpea (cf Remanandan and Singh. Over six million germplasm accessions have been collected and/or assembled in 1308 genebanks world over (FAO. were donated to ICRISAT in 1973. The Rockefeller Foundation had assembled over 16. Similarly. formed the initial collection. this program has achieved spectacular success. large seed size and disease resistance were used to develop new and high yielding cultivars of Chickpea (cf Singh et al. kodo millet. Sets of this germplasm. Created in 1971. the Consultative Group on International Agricultural Research (CGIAR) is an association of public and private members supporting a system of 15 Future Harvest Centers that work in more than 100 developing countries to achieve sustainable food security and reduce poverty through scientific research and development activities in the fields of agriculture. is responsible for germplasm assembly. foxtail millet. chickpea. [now the National Research Center for Groundnut (NRCG). Mozambique and Somalia. The CGIAR germplasm collections are a unique resource.000 sorghum germplasm accessions from major sorghum areas. pearl millet. storing in cool and dry conditions and regular monitoring of seed health during storage. Some of the germplasm accessions that do not produce seeds under ICRISAT-Patancheru climatic conditions (some wild Arachis species) are maintained vegetatively in the greenhouse. Ethiopia. -20 oC). Thailand. Pullman. ICRISAT initiated activities to add new germplasm of its mandate crops from areas that were not adequately represented in the germplasm collection. India. Germplasm sets were evaluated over locations jointly with scientists in India. the seeds are dried to about 5% . We also received 622 groundnut germplasm samples from the National Institute of Agrobiological Sciences. Germplasm Management Phenotypic characterization and evaluation Agronomic and morphological characterization is necessary to facilitate the utilization of germplasm. Kenya and more intensively with the National Bureau of Plant Genetic Resources (NBPGR). Jabalpur (Madhya Pradesh). Coimbatore (Tamil Nadu). To achieve this. Some other accessions (wild Cicer species) need long day length and cool weather to grow and produce seeds. In the ICRISAT genebank. the seeds are stored in medium-term storage (MTS) in aluminium cans. germplasm accessions of all the crops were sown in batches over the years and characterized for morphological and agronomic traits. pearl millet 10841. Ludhiana (Punjab). groundnut 2776. a total of 213 joint missions were launched in 62 countries. 21 wild). The germplasm accessions are also conserved in long-term storage (LTS) after packing in vacuum-sealed aluminium foil pouches. Nepal.8% have been conserved as base collection and 93. and small millets 2465) were collected. Fifteen Indian organizations that donated highest number of germplasm are listed in Table 2. Between 1975 and 2000. from which 33. A large number of breeding lines or germplasm selections are developed and evaluated at important locations. Germplasm screening against biotic and abiotic stresses were conducted in collaboration with various 36 disciplinary scientists. Recently. pigeonpea 3873. we obtained chickpea germplasm samples from Washington State University. These species are also regenerated in greenhouse facilities. chickpea 4228. Indonesia. Regeneration Regeneration was carried out to meet the seed increase of (1) accessions that had reached a critical low level of seed stock or viability. A recent monitoring of the health of seed conserved for 10–25 years (MTS) indicated greater than 75% seed viability for majority of the accessions.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Pantnagar (Uttranchal). 5 oC. USA (2083 cultivated. in 2004-05.833 accessions of which 73. particularly to the NBPGR. 68 wild) and ICARDA. drying to minimal seed moisture content. Grains were tested for nutritional value. The results of joint evaluations have led to a better understanding of the germplasm material. Before packing. Conservation Germplasm conservation requires cleaning the seed material. The promising/improved germplasm lines were also registered in the genebank and conserved for future utilization.194 accessions (sorghum 9011. 25-30%RH) or longterm storage (LTS. Rahuri (Maharashtra) and IARI at New Delhi.0% are designated with FAO (Table 3). (2) accessions required for mediumterm storage (MTS. and (3) germplasm repatriation. Accessions with declining seed viability (less than 75% seed germination) are regenerated on priority and the old stock is replaced with fresh seeds. Rajendranagar (Andhra Pradesh). Over 400 accessions of sorghum collected in Niger were received from our regional genebank in Niamey. India. The genebank currently holds 118. Syria (682 cultivated. Japan. This variety is also 37 . Core and minicore collections of ICRISAT mandate crops were established and the information was published for the benefit of fellow research workers. conservation. From the beginning of our work (1973) until 2005. 1827 sorghum and 922 pearl millet to Cameroon. we have about 76% of the FAO designated germplasm in the LTS facility. Repatriation of germplasm to national programs The global collections held at ICRISAT serve the purpose of restoration germplasm to the source countries when national collections are lost due to natural calamities. A Manual of Genebank Operations and Procedures was published (Rao and Bramel. A taxonomic key for the identification of wild species of the mandate crops has also been included in the manual. chickpea 19.. and one on chickpea (Mathur et al. The National Bureau of Plant Genetic Resources (NBPGR). Global germplasm supply to scientists and institutions The ICRISAT genebank is holding germplasm that was donated by various institutes. We supplied 362 sorghum accessions to Botswana. organizations and farm communities and is ever willing to supply the same for research. As part of ICAR/ICRISAT Partnership Projects. and pearl millet (Mathur et al. on germplasm exploration. the genebank has repatriated almost full set of this germplasm by July 2004 (Table 5). and 71 pigeonpea accessions to Sri Lanka. Existing procedures were reviewed and revised to maintain the collections according to international standards. Remanandan et al. India requested ICRISAT for restoration of this germplasm. 1993a). Pigeonpea germplasm accession ICP 8863 collected from farmer’s field in India was found very promising against fusarium wilt and was purified for the trait. we have supplied 674. 1993b and 1993c). documentation. etc. 1988). 1988.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era moisture content in a walk-in drying room (100 m3 size. pigeonpea 7. groundnut 6. and evaluation at a number of locations. 1991. 1436 and 445 sorghum accessions respectively to Nigeria and Somalia.822 accessions received from or jointly collected with the Indian National Programs. 2000) documenting the procedures for germplasm acquisition.. 1723 sorghum and 931 chickpea to Ethiopia. India. Thus the NARS of several countries have regained their precious heritage which could have been lost if this was not conserved in the ICRISAT genebank. At present.108 germplasm samples to scientists in 142 countries (Table 4). Impact of germplasm supplied to NARS worldwide Besides the utilization of germplasm in ongoing research at other institutes. 838 sorghum and 332 pigeonpea to Kenya. The purified line was found high yielding and it was released for cultivation in 1986 as Maruthi in Karnataka state. India. finger millet 2. The data on joint germplasm evaluations were analyzed and published two catalogs each on forage sorghum germplasm (Mathur et al. and distribution.. 15 oC and 15% RH) facility. civil strife. 66 germplasm accessions (sorghum 30. 1992).. and 1 each of pearl millet and barnyard millet) supplied from the ICRISAT genebank have been directly released as cultivars in 44 countries (Figure 1). During the last 20 years. Documentation and supply of information The vast germplasm data gathered on chickpea and pigeonpea germplasm has been summarized and presented to the users in the form of catalogs (Pundir et al. The germplasm collection maintained in the ICRISAT genebank includes 44. and results were published as ‘Collaboration on Genetic Resources’ (ICRISAT 1989). we had a very purposeful collaboration with NBPGR.. maintenance. . Rabat and S 26. pigeonpea: 60.9% and rice: 22. 2006). The two most often used cultivars were Robut 33-1 (3096 times) and Chico (1180 times). The means for different agronomic traits differed significantly between regions. This was selected from a germplasm collection from Ghane Gaon. area remained nearly unchanged. Maharashtra. and the USA (Knauft and Gorbet. namely. IP 58. This variety is an excellent Maldandi-type [predominant postrainy (Rabi) sorghum landrace in Maharashtra and Karnataka states of India) with large lustrous grains and high yield. 1998).820 accessions) was characterized for seven morphological and 13 agronomic traits and reaction to fusarium wilt to determine phenotypic variation in different geographical regions. Maharashtra and Andhra Pradesh (Bantilan and Joshi 1996). This variety yielded 45. Another example is the release of barnyard variety (PRJ 1) in Uttranchal state during 2003. a total of 86 varieties was developed through hybridization that traced back to 95 unique parents.887 parents (586 unique parents) were used in developing 3548 breeding lines.. For example. 2004).2003. in 2002. the use of basic germplasm in breeding programs is scanty. India. there is much to be done to further improve productivity of the crops to meet the food requirement of ever increasing population.9%. Most frequently used parents were Pb 7. Strategies to enhance germplasm utilization Assessment of diversity in the germplasm collection The germplasm characterization and assessment of diversity is important to plant breeders for crop improvement and to genebank curators for efficient and effective management of their collection. but this included only 132 unique germplasm accessions of groundnut and 10 of wild Arachis species. made by ICRISAT genebank staff during 1989. For other crops such as wheat and chickpea.7%. this figure indicates satisfactory germplasm distribution service of the genebank. The chickpea germplasm collection (16. The two most frequently used cultivars were L 550 (903 times) and K 850 (851 times). According to Marshall (1989). F 8. A glance of ICRISAT genebank service to researchers revealed that on an average. In the ICRISAT chickpea-breeding program (1978-2004).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era grown on large hectarage in adjacent states.4%. groundnut: 47. The top 10 parents contributed more than 35% to the genetic base of the released varieties.. During the last 40 years. Parbhani Moti was released in Maharashtra. This variety is a selection from ICRISAT germplasm collection IEC 542 that originated in Japan. This has resulted in area increase under some crops. There are similar reports from China (Jiang and Duan. The data analysis from the Indian chickpea research program revealed that during 1967 . 21. Present scenario of PGR utilization Much progress has been in developing stable and high-yielding cultivars using diverse germplasm resources. which included only 91 unique germplasm accessions of chickpea and five of wild Cicer species (Upadhyaya et al. Sholapur. 1989) in groundnut. A sorghum variety. area under soybean increased by 250. Productivity has improved considerably in most of the crops (Table 1). However. 12. in future. It provides substantial fodder yield as well.4% higher grain yield compared to the check variety VL 29. However. About 41% varieties developed have Pb 7 as one of the parents in their pedigree (Kumar et al. the summary of parental lines used in the ICRISAT groundnut-breeding 38 program at ICRISAT (1986-2002) revealed that 986 unique parents were used in developing 8279 breeding lines.065 germplasm samples are supplied annually to users outside the ICRISAT (mean from 1974 to 2005). Middle East. Developing core collections One of the reasons that plant breeders are using less basic germplasm in research is the lack of information on traits of economic importance. Haiti. The means for different agronomic traits differed significantly among regions. South Asia. PCA using 38 traits and clustering on first seven PC scores delineated three regional clusters. Three of the six botanical varieties. cluster 2 from India and adjacent countries. The germplasm accessions from Oceania were conspicuous by short growth duration. 1988) revealed that in general. West Asia.402 accessions from 54 countries grouped into 11 regions) was analyzed for patterns of variation for 14 qualitative and 12 quantitative traits.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era The variances for all the traits among regions were heterogeneous. Thailand. Comoros. Indian accessions were highest yielding and the accessions from Chile had higher plant height and greater seed mass. The germplasm diversity. green stem color. America and the Caribbean countries. Southern Africa. The groundnut germplasm collection (13. indeterminate flowering pattern. hirsuta. Cluster analysis delineated two regional clusters consisting Africa and South and Southeast Asia in the first cluster. also revealed highest range variation. and others like Bahamas. smaller seed size. and larger seeds. 2003) (Figure 2). Europe. 2005c). and Panama are not adequately represented in the collection. The cluster analysis delineated three clusters: cluster 1 includes accessions from Oceania. Variances for all the traits were heterogeneous among regions. Oceania. primary seed color among morphological traits and leaflet length among agronomic traits showed highest pooled H‘. consisting North America.. The accessions from Africa were of longer duration. and East Asia in 39 the first Cluster.. short height. pods with fewer seeds. Resistance to fusarium wilt was more common in accessions from Bangladesh than from other countries. Uganda. Africa. The accessions from Spain and Syria had longer flowering duration and the accessions from Greece and Russia had erect growth habit. was highest for Africa and lowest for Oceania. From South America among regions. 1949) diversity index (H‘) was variable in different regions for different traits. An earlier study of chickpea germplasm data at ICRISAT (Pundir et al. 2002b) (Figure 3). Primary seed color had maximum variability and orange color. Mediterranean and East Asia in the second cluster (Upadhyaya. Pigeonpea-rich countries such as Myanmar. which often shows high genotype x environment interactions and requires . followed by cream were the two most frequent seed colors in the collection. and cluster 3 from Indonesia. and peruviana were poorly represented indicating the need to be collected. Semi-spreading growth habit. with multiseeded pods. South America. Europe. The Philippines. The pigeonpea germplasm collection (11. which showed 100% range variation for 12 of the 16 morphological traits.342 accessions) was characterized for 16 morphological and 10 agronomic traits in two seasons to determine the phenotypic variation in different geographical regions. Central Africa. Europe. Eastern Africa in second cluster and Southeast and Central Asia and the Caribbean in the third cluster (Upadhyaya et al. and yellow flower color were predominant among qualitative traits. The Shannon-Weaver (Shannon and Weaver.. Analysis revealed the need to secure more germplasm collections from Mediterranean countries and Ethiopia. and need priority attention for germplasm exploration (Upadhyaya et al. indicated by H‘ pooled over all traits. fewer branches. Burundi. aequatoriana. South Asia region contained the largest range of variation for all the traits. and the Americas. and lower seed yields. South America in the second cluster. taller. and West Africa. The variances for all the traits among regions were heterogeneous. 2001.. Upadhyaya et al.. groundnut Asia core (504 accessions. accessions with economic traits and some representation of the related wild species. 2001).. and has led to the formation of Generation Challenge Program (GCP) entitled “Unlocking Genetic Diversity in Crops for the Resource-Poor ( www. Sabharwal et al. 2003).290 accessions. 2001). 2003.247 accessions. 2004.” which are about 10% of the entire collection. Ivandic et al.. To overcome this. pearl millet (1. disease resistance.. and quantitative traits (Thornsberry et al. pigeonpea. groundnut (1. Reddy et al. The GCP is designed to utilize molecular tools and comparative biology to explore and exploit the valuable genetic diversity existing in germplasm collections held at the CGIAR and NARS genebanks. Upadhyaya et al. which were time taking and costly measurements.org)”.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era replicated multilocational evaluations.. Sun et al. with particular focus on drought tolerance.. The composite collections will be genotyped using SSR markers. 2005a) and foxtail millet (155 accessions. geography.704 accessions. The data generated will 40 .. we have already developed mini-core collections of chickpea consisting of 211 accessions (Upadhyaya and Ortiz. Developing composite collection The revolution in molecular biology.generationcp. This mini-core collection still represents the diversity of the entire core collection. 2002. 2001. 2001c). ICRISAT and collaborating institutes have constituted composite collections of chickpea (Upadhyaya et al. chickpea (1. 2003. 2004. but represent almost full diversity of the species. and selecting a further subset of about 10% accessions from the core collection. pigeonpea (146 accessions).. agronomic.. Upadhyaya et al. 2000). 2001. The first stage involves developing a representative core collection (about 10%) from the entire collection using all the available information on origin. 2003. Upadhyaya et al.. In recent years. 2005). and Amirul Islam et al. The second stage involves evaluation of the core collection for various morphological. even a core collection size becomes unwieldy for evaluation by breeders. which consists of 10% accessions in the core collection (and hence only 1% of the entire collection) (Upadhyaya and Ortiz.956 accessions. and characterization and evaluation data of accessions. Upadhyaya – unpublished data) (Table 6). 2004) demonstrating that it is a viable alternative to classical QTL analyses... Gebhardt et al. Developing mini-core collection When the size of the entire collection is very large. From the germplasm collection in the ICRISAT genebank. To overcome this. Grenier et al. At ICRISAT. Evaluation is very costly and resource-demanding task owing to the large size of the germplasm collections. our research now focuses on studying the diversity of germplasm collection and developing “core collections. we have already developed core collection of sorghum (2. groundnut (184 accessions) (Upadhyaya et al.. Russel et al. 2001). and quality traits. Bhattacharjee. and finger millet (65 accessions) (Upadhyaya – unpublished data) (Table 6). several studies conducted on plants have detected DNA markers associated with ecology. Turpeinen et al. 2002a). 2006a) and sorghum (3000 accessions each) and groundnut. At both stages standard clustering procedures should be used to form groups (clusters) of similar accessions and then select desired number of accessions from each cluster. geographical distribution.600 accessions. and information technology has provided the scientific community with tremendous opportunities for solving some of the world’s most serious agricultural and food security issues. bioinformatics. finger millet (622 accessions. pigeonpea (1. ICRISAT scientists developed a seminal two-stage strategy to develop a minicore collection. finger millet (1000 accessions each) (Table 7) that contain maximum diversity known in the species. 2001a). 2004) have been identified. These new sources performed better than or similar to the best control cultivars for particular trait (s). but were diverse from them. 2005c). Also found were 15 Valencia. The evaluation of groundnut core collection resulted in identification of 21 accessions with early maturity (Upadhyaya et al. 158 accessions had low temperature tolerance at germination (Upadhyaya et al. the core collection can be evaluated extensively to identify the useful parents for crop improvement. compared to the other entry pairs. Such information has high value to chickpea breeders. botrytis grey mold in 55 accessions. large seeded kabuli (16 accessions) and high-yielding (39 accessions) types. By evaluating core collection of chickpea. 2005b).. 2005). The mini-core collections of chickpea and groundnut have been evaluated and diverse sources of useful traits were identified. and 25 Virginia type germplasm lines in groundnut with high yield. 2005) and 29 accessions tolerant to soil salinity (Serraj et al. 20 Spanish. Some accessions also with multiple resistances were identified. Thirteen entries constituted cluster-3 and no control among them. Seven test accessions formed cluster-3 and these accessions are more distinct from the three 41 controls used in this study (Figure 5). Cluster-2 was formed of 14 entries including control Annigeri... Cluster-1 was formed of five entries including three controls (ICCVs 2. 1993) for resistance to the groundnut root-knot nematode (Meloidogyne arenaria (Neal) race 1) and resistance to pre-harvest aflatoxin contamination (PAC) (Holbrook. 96029 and Harigantars). about 10% accessions will be selected containing maximum diversity and those could be used in the breeding programs. Pande et al. (1997) achieved similarly through examining all accessions in the groundnut core collection (Holbrook et al. moderate resistance to ascochyta blight in 3 accessions.. and to dry root rot in 6 accessions. good shelling percentage and 100-seed weight through multilocational evaluation of the ‘Asia region core collection’ (Upadhyaya et al. India during 2002 to 2004 seasons revealed 12 very promising accessions. we identified new sources of important traits. 2001b). From the chickpea mini-core.. 1998) while Franke et al. (2006) screened the minicore collection for resistance to various diseases and identified 67 accessions resistant/highly resistant to fusarium wilt. Identification of new sources for traits of economic importance for use in crop improvement program Due to the reduced size. Cluster-1 comprised of four entries including two controls (Gangapuri and Chico). 18 accessions having traits related to drought tolerance (Kashiwagi et al. Using all available information. namely. Of these six accessions . The clustering of 28 early maturing accessions along with four controls revealed three clusters. (1999) later did similarly for resistance to Rhizoctonia limb rot (Rhizoctonia solani Kuhn AG-4).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era be used to define the genetic structure of the collection for functional and comparative genomics. Similarly. The cluster analysis done on these 21 accessions and three controls revealed three clusters. It can be presumed that these 13 accessions are more distant from controls than other accessions (Figure 4). The evaluation of chickpea mini-core at the Indian Institute of Pulses Research (IIPR). The analysis of genetic diversity will help to elucidate population structures that influence the analysis of the associations between molecular markers and the morphological or reaction traits. The evaluation of groundnut mini-core resulted in identification of 18 diverse accessions with high water use efficiency (Upadhyaya. Holbrook et al. Cluster-2 contained 13 entries including one control (JL-24). Kanpur. In the groundnut core. early maturity (28 accessions). The phenotypic diversity index was highest between ICC 14648 and ICCV 96029.. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era were involved in hybridization to develop large seeded kabuli cultivars. Molecular characterization of germplasm Characterization of germplasm with molecular markers can help improve their utilization.0276). 2004). The genetic similarity (Sij) ranged from 59.53 to 0. 7101.and 6 late-maturing) were analyzed with 37 SSR markers.0 to 98. 2001). Middle-East and Ethiopia. echinospermum) formed two groups of their own flanking two ends of the chickpea accessions (Upadhyaya et al. Some accessions with diverse DNA profiles (ICGs 1448. six with high oil content and four with high Oleic and low Linoleic acid. The evaluation of groundnut mini-core in Thailand (2004-05) indicated ten accessions high-yielding. 2004). 26-accessions were analyzed with random amplified polymorphic DNA (RAPD) assays.2%. genotypic data from 210 accessions screened with 40 SSR markers was used. Overall most individuals were assigned with a high degree of confidence to the original (phenotypic) clusters from which accessions constituting mini core collection were selected. and 20 accessions of wild Cicer species from ICARDA were genotyped using 40 SSR markers.94 with an average of 0. Validating the chickpea mini core collection: Discriminant function analysis was used to determine the level of congruence between the genotypic data set and the 28 phenotypic clusters 42 of the chickpea mini-core (Upadhyaya and Ortiz.85. Genotyping chickpea accessions A total of 288 chickpea accessions including 211 mini-core subset accessions consisting of 75% desi type (Upadhyaya and Ortiz.. and 1471. The groundnut mini-core evaluation in China during 2005 resulted in identification of 14 accessions highly resistant to bacterial wilt. Only 27% of the individuals were reassigned into new clusters according to genotypic data. Mean heterozygosity was low (0. The accessions from ICARDA consisted of more heterozygous individuals compared with mini-core accessions. 6. reticulatum and C. 2006b). Three accessions had highest Oleic: Linoleic acid ratio. The polymorphic information content (PIC) values ranged from 0. The results indicated that the chickpea mini-core developed at ICRISAT was allelically more diverse than the germplasm from ICARDA. The dendogram constructed based on shared allele distance using unweighted pair group mean average (UPGMA) method indicated two main groups: one consisting mainly of accessions from the Indian subcontinent and the other group of accessions from Mediterranean. Genotyping chickpea accessions of varying maturity duration Sixty-two chickpea germplasm accessions (50 early-. For DFA analysis. Molecular marker based diversity estimates are useful to select diverse lines for developing populations that may be used for . 6 medium. Both multidimensional scaling and unweighted pair-group method with arithmetic averages (UPGMA) dendograms revealed the existence of five distinct clusters. The accessions of wild species (C. which were mainly identified within clusters 4. Genotyping groundnut accessions In groundnut. This confirmed that the chickpea mini core was well selected. A total of 673 alleles were found. 57 accessions of kabuli chickpea. 2001) based on morphological and agronomic traits. The principal component analysis (PCA) plot of Rogers’s distance indicated three distinct clusters (ICRISAT. It can form the basis for mining and cloning of genes of agronomically important traits.. The number of alleles per marker varied from 4 to 28 with an average of 18. 2001). and ICGVs 99006 and 99014) were identified for mapping and genetic enhancement in groundnut (Dwivedi et al. and 7 of the mini-core (ICRISAT.8% with an average of 86. Using raw germplasm resources. Molecular characterization of the germplasm of agronomic importance has been pursued for value addition and to enhance their utilization. Sadore. 2003). J.S. Bhattacharjee.56%. Chandra. and Joshi. 3-5 May 1995. India. in Partners in impact assessment: summary proceedings of an ICRISAT/ NARS workshop on methods and joint impact targets in Western and Central Africa..L. Using molecular markers to assess the effect of introgression on quantitative attributes of common bean in the Andean gene pool. Beebe. I: RAPD analysis. K. H. Tohme. 116 pp.. D.53%) amongst the nine rosette resistant accessions used. namely. Yuejin. S. Conclusion Crop genetic resources have contributed enormously towards sustainability of agriculture and alleviation of poverty... 1998.. These accessions possess high levels of resistance to rosette. K. FAO. Thesis. and Fatokun. S. Pages 3639. 502 324. W. a large number of crop varieties and hybrids have been developed and released for cultivation. Chandra. New strategies on core and mini-core collections were developed to enhance the precision of germplasm characterization and reducing cost on germplasm regeneration and conservation. Sears L and Stapleton P (eds. Patancheru. 2000. S. Soybean. India. Adoption and impact pigeonpea ICP 8863. Niger. and Nigam. AFLP Diversity among selected rosette resistant groundnut germplasm.N. Italy: FAO. R. Upadhyaya. Nine amplified fragment length polymorphism (AFLP) using primer pairs were performed on nine rosette resistant and one susceptible accessions. T. ICRISAT. 9558 and 11968 showed greater genetic diversity (36. R.D. These are being assembled and conserved at several genebanks for future use.. International Arachis Newsletter 23: 2123. S. 162 pp. Pages 181-190 in Fuccillo D. UK Dwivedi.N. 43 REFERENCES Amirul Islam.B. Cambidge. Phenotypic and genotypic characterization of these sets will provide vast scope of identifying useful and unique germplasm resources for utilization in crop improvement. Ph. M. Cambridge University Press. average d”2% compared to e”90% infection in susceptible control ICG 7827 across four seasons’ evaluation at Lilongwe. ICG 11044 with ICGs 3436. and Holbrook.L. 1996. Brenneman.. F.K. Studies on the establishment of a core collection of pearl millet (Pennisetum glaucum). M.4 markers per primer pair. 2004. with an average of 10. C. Redden. Gurtu. Groundnut accessions.M. 1997. These accessions therefore could be intercrossed among themselves to produce diversified rosette resistant breeding populations (Dwivedi et al.. and Basford. and Nigam. S.C. Munoz.53% with an average of 19. S. Plant Breeding 120: 345-349..59 to 50.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era mapping studies to identify DNA markers linked with resistance to rosette disease in groundnut. Page 90 in The state of the world’s plant genetic resources for food and agriculture. Dashiell. 2003.). The genetic dissimilarity (Dij) values ranged from 3. Malawi. P. Composite sets of ICRISAT mandate crops are being developed under the Generation Challenge Program. Assessment of genetic diversity among selected groundnut germplasm. 2001. Dwivedi. M.92 to 50. S.E... CCS Haryana Agricultural University. Franke. Rome. Across the 10 accessions. The state of ex-situ conservation. Bantilan.D. Hisar – 125 004. S. Theoretical and Applied Genetics 108:243-252.. . S.J. Gurtu. the nine primer pairs identified 94 unique markers. Biodiversity in Trust. IIPR. India.). C. C. Agron. Proceedings of the American Peanut Research & Education Society 30:21. Identification of resistance to Rhizoctonia limb rot in a core collection of peanut germplasm. Holbrook. Gupta.W. H. B. Patancheru 502 324. 2003. W. Utilization of groundnut germplasm resources in breeding programme. ICRISAT (International Crops Research Institute for the Semi-Arid Tropics).. Vincent Vadez.. P.F. 105-120. geography and flowering time. E.. and Singh. . V. Holbrook. 1989. Jiang. Crop Science 41: 234– 240. M.C. Crop Science 33: 859-861.B.W. Chandra. Assessing genetic potential in germplasm collections of crop plants by marker-trait association: a case study for potatoes with quantitative variation of resistance to late blight and maturity type.R. and Schuler.N. Genetic variability of drought-avoidance root traits in the mini-core germplasm collection of chickpea (Cicer arietinum L. A. India: International Crops Research Institute for the Semi-Arid Tropics. New York. 1998. Selection of a core collection from the U. 1998. Zhang. 14–15 Nov 1988. K. H.. Chandra.. 1999. B.P.A.A. ICRISAT (International Crops Research Institute for the Semi-Arid Tropics). R. R.E.D. D.S. Plant Breeding 122:300-304. 2004. S. Ivandic. J. R. Z. Patancheru.. H... 2002. Kumar S and Dhar V (eds. and Serraj.G. Kumar. Association of simple sequence repeats with quantitative trait variation including biotic and abiotic stress tolerance in Hordeum spontaneum. P. India. C.B. Core collection of the genetic resources of sorghum: 1. S. C.. E. S. 2005. Upadhyaya. and Forster. L. Krishna. Andhra Pradesh. Kanpur. How wide is the genetic base of pulse crops? In: Ali M. ICRISAT. Stephenson. W. and Matheron. and Gorbet. pp. Grenier. 83: 944-948. Euphytica 146: 213-222. 2004. Keith. V.T. W. Frankel OH. Krishnamurthy. Hackett. Limitations to the use of germplasm collections. germplasm collection of peanut. Sources of resistance to preharvest aflatoxin contamination in peanut.). Crop Science 29:1417-1422. 1997.... 211-221. Abstr. In: Brown AHD. Kashiwagi. 1989. Bramel.F. D. Gebhardt.. Harnessing Biotechnology for the Poor – 44 Archival Report 2004. A. Plant Molecular Biology 48:511-527. Stratification based on ecogeographical data. C. Analysis of simple sequence repeats (SSRs) in wild barley from the Fertile Crescent: associations with ecology..C. and Johnson.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era C. Collaboration on Genetic Resources: summary proceedings of a joint ICRISAT/ NBPGR (ICAR) workshop on germplasm exploration and evaluation in India. Indian Society of Pulses Research and Development. N. Thomas. Nevo.B. pp.. and Pittman. Anderson. Level and geographical distribution of resistance to Meloidogyne arenaria in the germplasm collection of peanut.C. India: ICRISAT. Oberhagemann. S. Marshall.W. Thomas.. B. Walkemeier. M. Ballvora. and Forster BP. and Duan.). Knauft. Patancheru.. The use of plant genetic resources Cambridge Univ. 1993.:157. D.J.. C. and Hamon. Genetic diversity among peanut cultivars. Nevo.T. P. Holbrook. Ivandic.X. D. Wilson. Singh BB. Marshall DR and Williams JT (eds.. 2001. 2004..C.. Crop Genetic Resources 2:24-25. Plant Dis. Press. Molecular Breeding 13: 93-102. Pulses in new perspective. 1989. . Plant Disease (in press). S. Groundnut.. D.H. New Delhi. Mengesha.H. Patterns of polymorphism detected in the chloroplast and nuclear genomes of barley landraces sampled from Syria and Jordan.. R. R. Part1: NBPGR-ICRISAT Collaborative Programme.. 2000. W. 94 pp. L. Technical Manual no. The mathematical theory of Communication.D. Remanandan.S.. P. P. Remanandan. A. Genetic Resources and Crop Evolution.R. India: International Crops Research Institute for the Semi-Arid Tropics. P. Pundir. Rana. and Rana.N.H. Singh. R. Sastry.. and Weaver. Rao. NBPGR.E. R. 1997. Singh. 2006. Patancheru.. 1993c.N.N. NBPGR. Biodiversity in Trust. 2003. UK. Urbana. 1988. India.. 2004. P. NBPGR. Illinois Press. International Chickpea and Pigeonpea Newsletter Shannon.L. Identification of sources of multiple fungal diseases resistance using mini-core collection in chickpea. M. A P 502 324. Agrawal. M. Fuller. K.P.E. 1992.N. Mathur. India. 200 pp. Evaluation of Chickpea Germplasm. Evaluation of Pearl Millet Germplasm.H. Cambridge University Press. Sabharwal. Negi.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Mathur. NBPGR..C. Pundir. S.S. L. 1993a.. L.. ICRISAT Pigeonpea Germplasm Catalog: Evaluation and Analysis. P.. Evaluation of Forage Sorghum Germplasm. India: International Crops Research Institute for the Semi-Arid Tropics. and Rana. and Nigam. Russel. India. 1988.S.M. Rao. Reddy.. Banga. 2004.S. Sapra. J. and Mengesha. Sears L and .L. Booth. and Powel. R. 1993b.. R. I.. Mathur. V. D. and Rana.. India: International Crops Research Institute for the Semi-Arid Tropics.N. Prasada Rao. R. M.A. P. P. M.D.H. Sears L and Stapleton P (eds. T.S. P. 503 324. New Delhi. 1997. 89 pp. M. Part2: NBPGR-ICRISAT Collaborative Programme.. and Mengesha.A. Mengesha. Mengesha.H. Reddy. A. P. 215 pp. 45 502 324.D. K.. W. Evaluation of Pearl millet Germplasm. and Rana. M.C. R.N. Gowda. Sapra. Pande. Kishore. New Delhi. 194 pp. S.. Pages 114-127. Mathur. S. Upadhyaya. R. R. and Bramel. 269 pp. C.. A. Patancheru..K. Pages 156-167. N.1949. A.A. H. Baum . Upadhyaya. Screening of chickpea minicore germplasm for tolerance to soil salinity.. 296 pp. Krishnamurthy. Mengesha. J.J. Grando.. M. Thomas. Ceccarelli. Cambidge. 190 pp. 6.D..L. ICRISAT Chickpea Germplasm Catalog: Evaluation and Analysis.. Serraj.).N. M.. Mapping of AFLP markers linked to seed coat color loci in Brassica juncea (L) Czern. Part-1: NBPGR-ICRISAT Collaborative Programme.S. India.N. Patel.S.. Pigeonpea. and Lakshmikumaran. Prasada Rao. 52:1049-1056. and Singh..S.. and Sube Singh.V. in Fuccillo D.L. R. S. H. Patancheru.K. Part-1: NBPGRICRISAT Collaborative Programme. Agrawal. G. in Fuccillo D. 2005. S.P. H.S. NBPGR.H.P. Part-2: NBPGR-ICRISAT Collaborative Programme. Evaluation of Forage Sorghum Germplasm. P. Theoretical and Applied Genetics 107: 413-421. 1991. J.. and Upadhyaya..K. New Delhi. Development of core collection in pigeonpea (Cajanus cajan (L) Millsp.P. and Raom. Mathur.S. Rao. M. C. India. and Mengesha. K. Univ.R.E. Theoretical and Applied Genetics 109: 160-166. R.J. Manual of Genebank Operations and Procedures. New Delhi.. S.S.. R. and Dong..L.J. Gopal Reddy. 2002b. Molecular Breeding 7:1324.J. IARI... Bramel. and Sube Singh.. Neilsen. Cambidge. Upadhayaya . Turpenien. Pages 100113. Development of groundnut core collection from Asia region.B. H. Johansen.M.. U. S. New Delhi Upadhyaya.. and Sube Singh.. Plant Genet.).H.). K. 2003. Sun. R. Doebley.. and Sube Singh.N. Gowda. and Ortiz. P. Development of a chickpea core subset using geographic distribution and quantitative traits. Kresovitch. William . Bramel. H.. Development of a groundnut core collection using taxonomical.S. K. H.P. van Rheenen. Nigam.D.J. RAPD polymorphism in spring wheat cultivars and lines with different level of Fusarium resistance. Chickpea. H. Singh.L. UK. Microsatellites and RAPD polymorphisms in Ontario corn hybrids are related to the commercial sources and maturity ratings. . Upadhyaya. 1997. R. Ortiz.D. 2003. and Saxena. Singh.L. . Bong. M. C. Upadhyaya. R. Ortiz. Upadhyaya.. J. Robertson..D. and Nissila. Martin. 2001c. 2001. Genetic Resources and Crop Evaluation 50:139148.. R.. G. E. Upadhyaya. Ortiz. Upadhyaya. R. R. P. and Sube Singh. E. Thornsberry. Kasha.M. O..P. Tenhola. Pundir..D. Development of core subset of finger millet germplasm using geographic origin and data on 14 morpho-agronomic traits. 2005.. T. H. J.. Theoretical and Applied Genetics 102: 1292–1298. UK. Z. Dwarf 8 polymorphism associate with variation in flowering time.A. H. and Sube Singh.D. Parthasarthy Rao.M. Biodiversity in Trust. 6-9 November 2001. and Sube Singh. and Pauls. P.. I. Resources 14:165-167. 2001. H. E. R.P.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Stapleton P (eds.. Molecular Ecology 10:1577-1591. 2001. Liu. M. K. Bramel. Crop Science 42:2150–2156. Nature Genetics 28:286-289. in Fuccillo D.. 2002a. A mini core subset for capturing diversity and promoting utilization of chickpea genetic resources. Sears L and Stapleton P (eds..D. Geographical patterns of variation for morphological and agronomic characteristics in the chickpea germplasm collection. Euphytica 132:343352. Developing a mini core of peanut for utilization of genetic resources. Theoretical and Applied Genetics 106:1059-1067..S. Cambidge. Manninen. 2001. Cambridge University Press. and Buckler.. Cambridge University Press.. Upadhyaya. H. Upadhyaya.. C.D. Pundir. H. Geographical patterns of diversity for morphological and agronomic traits in the groundnut germplasm collection. 2001a. P.J...S. Bramel. geographical and morphological descriptors. 2001b. Sun. 2003. S.. H. H. P. Bramel . Nevo.D.J. Euphytica 128:191204. D. 2005a.D. L.. Genetic Resources and Crop Evolution (in press). Hundered years of post Mendelian genetics and plant breeding – retrospect and prospects. N. T. Indian J.P. Variability for drought resistance related traits in the mini-core collection of peanut. Evaluation of groundnut core 46 collections to identify sources of tolerance to low temperature at germination.D.. V.P.J.D. J.. Microsatellite diversity associated with ecological factors in Hordeum spontaneum populations in Israel. T. Nass. and Sube Singh.. Biodiversity in Trust. Crop Science 45: 1432-1440. Kelley. Goodman. Upadhyaya. Ortiz.J.V.. G.. Crop Science 41:206– 210. C.N.L. S.3 47. H.L. Table 1.5 2841 3976 2265 1328 780 1447 708 47 .4 143. Crouch. and Crouch.1 151.P.. Geographical patterns of diversity for qualitative and quantitative traits in the pigeonpea germplasm collection.2 123. Dwivedi.4 3. Buhariwalla. H.. H. H..K. Mallikarjuna Swamy.6 25.Y. Upadhyaya. Gowda.P. 2005c.2 88. P. C. Pundir.J..M..7 47. H. Plant genetic Resources: Characterization and Utilization (in press).3 11. B.K. Buhariwalla. B.9 2.7 16. M.0 4.D.S. S.V.L.K. Plant genetic Resources: Characterization and Utilization (in press).L.8 10.. Efficient use of crop germplasm resources: identifying useful germplasm for crop improvement through core and mini-core collections and molecular marker approaches... Kullaiswamy. J. Field Crops Research 93:293-299.L. Identification of diverse groundnut germplasm through multienvironment evaluation of a core collection for Asia. Baum.5 25. and Sube Singh.. R. Reddy. Furman..Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Upadhyaya. 2006b.D.D.. H. and Sube Singh. Udupa. Upadhyaya.. Kenchana Goudar. 2005b.8 18.8 1196 2062 1172 970 577 853 632 1983-85 Area: m ha 230.7 9. 2006a.. Gowda. Plant Genetic Resources: Characterization & Utilization 3(3): 331-352. Upadhyaya. Gowda. Development of composite collection for mining germplasm possessing allelic variation for beneficial traits in chickpea. B.L.5 Grain yield kg ha-1 2173 3201 1747 1466 682 1089 750 2003-05 213.8 43. Area under cultivation and productivity of the selected crops during last four decades1 Crop Wheat Rice (Paddy) Soybean Sorghum Chickpea Groundnut in shell Pigeonpea Wheat Rice (Paddy) Soybean Sorghum Chickpea Groundnut in shell Pigeonpea 1963-65 213. C.8 51. and Sube Singh.H..H.D. J.L. 419 4. Samastipur. 1973–2003.535 842 466 658 743 118.257 21.039 1.246 2. Institutions in India that donated a large number of germplasm to ICRISAT.979 1.266 6. Junagadh GBPUAT.229 770 865 1.801 345 1.836 21.116 13.366 1.594 20. Patancheru.638 31.233 251 211 3.773 Small millets 285 469 531 1. Accessions held in-trust: FAO designated germplasm freely available for use to the researchers.215 Pigeo npea 3. Crop Sorghum Pearl millet Chickpea Pigeonpea Groundnut Finger millet Foxtail millet Proso millet Little millet Kodo millet Barnyard millet Total Active collection1 37.712 14.282 14.820 4.329 16. December 2004. Ludhiana RAU. Jabalpur MPKV.620 1. Niphad.631 197 1. Coimbatore Total Sorg hum 175 115 33 90 13 11. Bihar TNAU.150 15.476 1. Pantnagar HAU.970 12.054 576 384 630 487 87.029 63 5.669 15.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 2. 2. 883 Base collection 2 31.041 5. Hyderabad ANGRAU. New Delhi PAU. Germplasm holdings in the Rajendra S Paroda Genebank. New Delhi JNKVV.919 Groun dnut 529 1. Active collection: germplasm seeds stored in medium-term storage facility and available for current utilization.949 1. Rahuri NBPGR. Base collection: germplasm seeds stored in long-term storage facility for utilization in posterity.640 Accessions held in-trust 3 35. 48 .370 Table 3.196 Rockefeller Foundation (India) 11.796 Pearl millet 66 155 164 234 170 106 45 2. Institution AICSIP.022 2.962 Chick pea 345 96 211 3.022 127 173 149 1.531 To t a l 175 529 4.167 267 161 496 197 590 4. Maharashtra GAU. Hyderabad ARS.632 16. ICRISAT.984 10.535 835 462 656 743 110. Hyderabad AICRPO. 3. Hisar IARI.035 174 479 191 40 3. 417 94.449 128.488 Sorghum Pearl millet Chickpea 362 1.460 922 931 332 Pigeonpea Groundnut Small millets Total 362 2.749 2.170 1.436 445 71 5.063 16.124 52.034 17.247 1.189 7.108 Table 5.923 1994-2005 31.302 52.720 Total 248.060 3.868 674. 1974 .474 4.893 16.738 1.991 12. Crop Number of accessions used 22.382 11.473 16.607 122.771 89. Global distribution of germplasm samples to scientists.769 45.654 1.436 445 71 44.723 838 1.290 622 155 Number of traits involved Core Sorghum Pearl millet Chickpea Pigeonpea Groundnut Finger millet Foxtail millet Groundnut Groundnut Chickpea Pigeonpea Finger millet Foxtail millet 20 11 13 14 14 14 13 Asian core 15 Mini-core 31 22 16 14 13 49 Number of accessions 2.822 Table 6.956 1.536 24.940 1.321 66. Restoration of basic germplasm from ICRISAT genebank to different countries Number of accessions Country Botswana Cameroon Ethiopia Kenya Nigeria Somalia Sri Lanka India 14.465 1984-1993 158.827 1.637 7.627 15.600 1.762 62.015 19.153 14.310 5.290 1.067 186.704 622 155 504 184 211 146 65 - . Core and mini -core collections of ICRISAT mandate crops.988 6.2005 Crop Sorghum Pearl millet Chickpea Pigeonpea Groundnut Small millets Total 1974-83 58.182 15.413 30.278 29.593 44.908 20.352 358.956 1.704 1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 4.546 20. Syria CIRAD. Number of cultivars released worldwide from the basic germplasm supplied from ICRISAT genebank 1976-2003 12 10 8 Linkage Distance 6 4 2 0 Arica Southeast Asia South Asia Americas Europe Mediterranean West Asia East asia Fig 2. Composite collections of seected crops Crop Size of the composite collection (accessions) Genetic markers used Institutes collaborating with ICRISAT Chickpea Sorghum Groundnut Pigeonpea Finger millet 3000 3000 1000 1000 1000 50 SSR markers 50 SSR markers 20 SSR markers 20 SSR markers 20 SSR markers ICARDA. of varieties 7 6 2 1 Sorghum Pearl millet Chickpea Pigeonpea Groundnut 1 Barnyard millet Finger millet 66 varieties released in 44 countries Fig 1. Dendogram of eight regions for the entire chickpea germplasm based on first three principal components. FranceCAAS.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 7. Brazil Only ICRISAT AICSMIP. India 32 30 28 26 24 22 20 18 16 14 12 10 8 6 4 2 0 30 19 No. China EMBRAPA. 50 . Dendogram of 21 early maturing groundnut landraces with three control varieties based on the first 10 principal components 51 . Cluster3 Cluster2 Cluster1 Fig 5. Dendogram based on first three principal components of 16 quantitative traits of 28 earlymaturing germplasm lines and four control cultivars capturing (74.3%) variation.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 20 18 16 14 12 Linkage Distance 10 8 6 4 2 Middle East West Africa Oceania North America Central Africa Eastern Africa Southern Africa Southeast Asia South America Central Asia South Asia Caribbean East Asia Europe 0 Fig 3. Dendogram of 14 regions in entire groundnut germplasm based on sores of first seven principal components. 40 35 30 25 Linkage Distance 20 15 10 5 0 ICCV 96029 Harigantars ICCV 2 ICC16644 ICC16641 ICC14648 Annigeri ICC14595 ICC10822 ICC8931 ICC10232 ICC2171 ICC16947 ICC12424 ICC11059 ICC10996 ICC10981 ICC8618 ICC2023 ICC11180 ICC11021 ICC11039 ICC11160 ICC10976 ICC11040 ICC10926 ICC2859 ICC10629 ICC1398 ICC6919 ICC8378 ICC1097 Cluster 1 Cluster 2 Cluster 3 Fig 4. 9. These genetic differences are very much useful to breed high yielding rice varieties resistant to biotic and abiotic stresses and quality traits improvement. The components of agro biodiversity used in the development of new plant varieties or hybrids are called genetic material. M1. and S. The plant diversity is not only distributed over the globe and India is also recognized as one of he 17 mega biodiversity areas of the world with enormous diversity in many flora and fauna. genetic stocks. animals and microorganism.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era RICE BIODIVERSITY AND ITS UTILIZATION Subramanian. Chokkanathapuram. breeding lines and wild species form the major components of the rice biodiversity found abundantly in South East Asia. extension of agriculture into marshal areas and deforestation. spread in many countries of the globe. Collection and conservation are in progress in many places of the aforesaid regions and the details are discussed in this paper. Tamil Nadu. 52 . Unlike other crop plants. VOC Street. the future progress in the improvement of rice crop largely depends on exploration. one of the components of biodiversity. Africa. Therefore. Karaikal . exploration and conservation of these valuable rice genotypes had been initiated already during 60s with a view to investigate their origin. This crop warrants resistance against abiotic and biotic stresses besides other quality characters to be improved. breeding lines and wild races are the basis of food security. VOC Street. The wild species are threatened with extinction through changes in land use. The land races. Former Director of Research TNAU. genetic stocks. India. Genetic diversity. these efforts have already been in vogue to collect and conserve the variability found in the globe and to utilize them in rice improvement work. Former Director of Research TNAU. refers to the variety of genetic information contained in all the individual plants. Besides. Karaikal . Plot No. the world’s most important staple food crop needs continuous improvement to feed the ever-growing population of the world. The responsibility of collection. Rice. Tamil Nadu.Associate Professor (Plant Breeding) AJANCOA & RI.625 014. variability and to evaluate their relationship for utilization. Chokkanathapuram. Africa. In view of the above. Agricultural biodiversity focuses a portion of the biodiversity that has undergone selection and modification over millennia by human civilization to better serve their needs. India. South Asia. indigenous cultivars. Australia and South Central America.609 603. 2.609 603. Madurai . modern varieties. Rice genetic resources comprising land races. Plot No. rice is endowed with enormous biodiversity. Madurai . 1.) the most essential food crop of the world. the conservation of rice biodiversity is taken up with great care and importance in South East Asia. conservation and regeneration of those germplasm is vested with international and national research institutes and stations of all rice growing countries. Currently. Associate Professor (Plant Breeding) PAJANCOA & RI. the land races and varieties under cultivation are declining. 2. Introduction Biological diversity or biodiversity is the variability among living organisms from all sources.625 014. Australia and Southern Central America. In spite of countless problems and constraints. modern and obsolete varieties.Tirumeni2 ABSTRACT Rice (Oryza sativa L.9. This germplasm with wide variability is the wealth of the country because of its valuable gene system. 1. is popularly known as “Global Grain”. Luziola zizanopsis). A comprehensive numerical taxonomy analysis of the grass family.nivara Sharma et 24 Shastry O. et Roehr. The wild species of Oryza are found almost exclusively within the boundaries of the tropics. Most of the species in genera related to Oryza have not been studied in detail.60. chromosome number and spikelet structure in the tribe Oryzeae (Duistermaat 1987. particularly in Chinese dishes. et al 1985). is grown as far as 50° S in Argentina.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Rice belongs to the family Poaceae (Gramineae) and the tribe Oryzeae. in the Himalayan foothills. 24 Chev. for example.96 24 24 48 30. Asian river deltas. et Roehr. 2n 24 Genome AA AA Distribution World Wide Tropical and Subtropical Asia Tropical and Subtropical Asia. Chev.rufipogon Griff 24 AA O. tropical Caribbean islands..sativa complex O.palustris L. is the wild rice of North America commonly served during the United State. Cultivated rice. two species in the genus Zizaniza are well . with specific differences among their traits. However.breviligulata A.glaberrima (Table 2). Chromosome number.28 24. O.known in parts of America and Asian cuisine. salt water (Porteresia an eco type of Leersai oryzoides) and plants with unisexual spikelets (Zizania. Genera. Pyrah 1969. Rice and its relatives are quite unrelated to other major cereal seeds and maize. shows the association between rice and bamboos and the divergence of rice from other cereals. Oryza is closely related to the bamboos and some of the forest wild rices look like miniature 53 Rice is believed to have originated in the southeast and South Asia. and the inland swamp lands of southern and western Africa as well as in temporary pools of the arid savannas of the tropics.sativa L. 24 O. Second 1985) Genus Chromosome number (2n) Spikelet structure bamboos. and geographical distribution of Oryza species (Khush and Brar. has 22 wild species and two cultivated species viz. Table 2. tropical Australia Africa West Africa Africa Tropical Australia Oryza Leersia Chikusichloa Hygroryza Porteresia Zizania Luziola Zizaniopsis Rhynchoryza Maltebrunia Prosphytochloa Potamophila 24.glaberrima Steud. genomic composition. Wild rices can be found. which probably reflects evolutionary relationship. Examples of potentially useful traits in genera related to Oryza are plants adapted to cold water (Zizania). 2001) Species O.48. number of species.latifolia is eaten as a vegetable. Amazon basin. The tribe Oryzeae consists of 12 genera (Table 1) including the genus Oryza. however. Table 1. which included North .34 24 24 24 Unknown Unknown 24 Bisexual Bisexual Bisexual Bisexual Bisexual Unisexual Unisexual Unisexual Bisexual Bisexual Bisexual Unisexual and bisexual O.longistaminata A. Several species grow in shady forest and others in vast stands in deep water swamps. wheat and sorghum (Watson.sativa and O. Thanks giving Day meal and Z. O.meridionalis Ng 24 The genus Oryza to which cultivated rice belongs. The genus Oryza consists of species adapted to a broad range of habitats. Z. 24 AA AA AA AA O. Chev. Based on local needs and traditions.alta Swallen O.ridleyi complex O. 24 et Mor.rufipogon Griff.ridleyi Hook F. many such groups have been recognized.australiensis Domin. O.nivara) . The Asian cultivated rice (O.eichingeri A..). Presl.granulata Nees et Arn.BBCC ex Steud. high yielding modern varieties were adopted by the farmers and the cultivation of land race varieties declined as high as 85100% (Saxena et al. et Roehr 48 24 HHJJ FF HHKK - O.S.B. The wild species are threatened with extinction through changes in land race. One more geographical race javanica. could have evolved in a broad area extending over “the foothills of Himalayas in South Asia and Southwest China”. 48 ex C. resembling the former morphologically and the latter physiologically. Genetic erosion In many areas.. a large number of indigenous varieties of cultivated rice and forms of wild speices are found prominent in these regions. ex Steud.minuta J. 2003) which also resulted in the loss of genetic diversity and increased the genetic erosion.brachyantha A. Peter O.longiglumis Jansen 48 HHJJ Irian Jaya (Indonesia) and Papua New Guinea South Asia Africa Papua New Guinea - and cultivated annual (O. lowland and deep water). 1965). The Asian cultivated rices have formed three eco-geographic races (indica.stiva var japonica (Kato et al 1930). changes in land use.glaberrima.latifolia Desv. They contributed for abundant habit fragmentation of destruction of wild as well as land races (OECD. 1996).sativa L. O.punctata Kotschy 24.glumaepatula Steud O. Unclassified O.) Baill O.longistaminata Chav.schweinfurthiana - Eastern zone of India. extension of agriculture in the marginal areas.sativa was divided into two geographic races viz. Bow and Aman types. japonica and javanica ) and three distinct cultural types in monsoon area (upland. O.barthi A Chev. Therefore. The differentiation also involved morphological and serological characters as well as inter varietal fertility.sativa L) has evolved from wild rices following the sequence of wild perennials (O. Chinese have traditionally recognized Hsien and Keng types.48 BB.grandiglumis (Doell) Prod.officinalis complex 24 AA South and Central America Africa Philippines and Papua New Guinea Tropical and subtropical Asia tropical Australia Sri Lanka South Asia and East Africa South and Central South and Central America South and Central America Tropical Australia 0.meyeriana complex O. Presl. The former is grown all over the tropics and latter confined to temperate and subtropical regions. Gundil and Tjereh and Bengal rice varieties are grouped into Aus.rhizomatis Vaughan O. He also asserted that O.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era O. saliva L) (Sharma and Sastri.sativa var indica and O. O. wild annual (O. genetic 54 O. Ex Watt 24 GG GG 24 BBCC CC 24 24 48 48 48 24 CC CC CCDD CCDD CCDD EE South and Southeast Asia Southeast Asia O. O.schlechteri Pilger 48 O. deforestation and natural disorders. Indonesian has grouped them into Bulu. 0. Corresponding members of African rice are O.officinalis Wall ex Watt O. and O. O. and Roehr. has also been recognized originating in Indonesia which is somewhat intermediate between indica and japonica. Unless these losses are checked.meyeriana (Zoll. America O. Based on isolation and selection. The Plant Introduction of IARI.000 accessions of rice (Table 3).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era erosion will invariably increase and replacement of such biodiversity will cost more.sativa. rice cultivars grown locally in Madhya Pradesh region were made from 1971 . ICAR and the 82 research stations established at various agroclimatic regions of the country collected more than 80. 900 traditional cultivars of Manipur in Eastern India were 55 collected. It is estimated that about 60% of these samples are unique varieties. During 1965 . A large number of collections were made by Sharma and his team from 1968 to 1983. More than 24. India. modern . The Vigyan Parishad Kendra Agricultural Station at Almorah collected 1247 cultivars from hilly regions of Uttarpradesh. exploration and conservation of biodiversity are given importance. Germplasm collection The collecting activities are closely linked to conservation and use. Additional collections of 1938 cultivars were made through a special drive for upland varieties in Andhra Pradesh. Madhya Pradesh. Tanzania. Philippines and Costa Rica during 2000. IRRI received almost 700 samples of Oryza sativa and 84 samples of different wild species form the Lao PDR. The accessions were mostly collected from land races varieties nurtured by farmers for generations.80. with the help of IARI (Sharma 1982). The collection comprises about 2% of all germplasm samples conserved world wide donated from more than 110 countries. NBPGR and CRRI jointly explored Sikkim. Collecting the variability observed in indigenous rice cultivars began in India around the turn of this century. Using this method more than 2000 samples of O. Orissa and West Bengal. Therefore.89 led to further addition of 4862 cultivars to the National Germplasm Bank. Those collections were known as Assam Rice Collection (ARC).700 samples of cultivated rice and 2400 samples of wild rice were collected in 165 missions from 22 countries (Anon 2000).76. conservation. The Jaipur Botanical survey explored south Orissa and adjoining areas of Madhya Pradesh during 1955-60 and collected 1745 cultivars. evaluation and documentation of germplasm.700 samples of Asia rice Oryza sativa (95%) and West African Rice O.67. The Raipur collections of 19.sativa) obviously conserves a very high genetic diversity of rice with its diverse eco geographic conditions. the primary centre of origin of cultivated rice (O. Karnataka. Exploration by NBPGR during 1983 . Collaborative explorations by NBPGR and State Agricultural Universities added 7000 cultivars during 1978 .02. Most samples in the collection are land race varieties of O. Setting up the Indian Council of Agricultural Research Institute (ICAR) at New Delhi in 1929 and the Central Rice Research Institute (CRRI) at Cuttack in 1946 further strengthened these efforts. characterization. This can be reduced by strategic and timely conservation action. New Delhi was converted as National Bureau of Plant Genetic Resources (NBPGR) in 1976 and acted as a nodal agency for exploration collection.116. The work received special attention following establishment of the attention following establishment of the Agricultural Research Station at Dacca (Eastern India) in 1961 and Paddy Breeding Station.sativa were collected during the second half of 1995 from Southern provinces of the Lao Peoples Democratic Republic (PDR).glaberrima (15%). The International Rice gene bank (IRG) of IRRI Philippines represents the largest and most diverse collection of rice in any gene bank. Coimbatore (Southern India) in 1912. The collection currently holds 1. South Bihar and parts of Orissa in 1985 and collected 447 local types. Farmers throughout Asia usually maintain the identity of each rice variety and help to identity different varieties for effective collection of germplasm. Shillong. Pantnagar.V. Kashmir Pura Karnataka Kerala Madhya Pradesh Manipur Orissa Mandya Pattambi I. The two major approaches conserve the rice for diversity are in situ conservation and ex situ conservation.nivara. Kihara in early 1960’s.G. Rajendranagar Titabar.5%). R.1003 1098 Tamil Nadu Coimbatore 19 20 West Bengal Chinsura and Kalimpong NBPGR Cuttack.No station/ centre 1 2 3 4 National centre Andhra Pradesh Assam Bihar Location(s) No. Shastry and his coworkers at Indian Agricultural Research Institute (IARI) made extensive collections of wild species of Oryza from Northern. 2873 81018 . the foreign scientists like H. Wild rice collection in India In addition to spectacular variability in its traditional cultivars. in the case of domesticated or cultivated species in the surroundings where they have developed their distinctive properties (UNEP 1995). Variability in Portersia coarctata has also been collected form coastal areas.granulata. Cuttack DRR. Faizabad and Kanpur. Raipur Wangbal Bhubaneswar.V. Rice germplasm maintenance at major rice research stations in India Name of S. of accessions maintained 19718 1076 3000. Sabour and Hazaribagh Nawagaon Karnal Palampur 800. Subsequently.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and obsolete rice varieties.K. 2600. O. Kota Almora (VPKAS). India is also rich in wild rice.S. Katimganj Pusa.nivara and 0.officinalis. Western. It preserves the evolutionary processes of generating new germplasm under natural selection and the maintenance of important field 56 Maharastra Karjat 15 16 17 18 Punjab Rajasthan Uttar Pradesh 1178 2370 2306 1577. In situ conservation In situ conservation means the conservation of ecosystem and natural habitats and the maintenance and recovery of viable populations of species in their natural surroundings and. Patna. Watanabe in the late 1960s and 1970s.. Jeypore and Ranital (OUAT) Kapurthala (PAU) Banswara. Table 3. Ranchi. French Scientists in 1986 came to India and in collaboration with Indian Council of Agricultural Research (ICAR) and IRRI undertook more intensive exploration all over the country and collected the wild species. Conservation Conservation is the management of resources to derive sustainable benefits and to meet the needs of future. Thrissur Total 1013.V. particularly O.1252 30 960 100 426 1850 600 20758 1119 1038 552 5 6 7 8 9 10 11 12 13 14 Gujarat Haryana Himachal Pradesh Jammu and Khudwani.1037 2248. These species were collected by the pioneer research workers. O.S. Central and Eastern India and assembled striking variability in O.officinalis and O.rufipogan. It preserves the genetic resources for a longer time without loss of viability of frequent rejuvenation and to distribute the required accessions to needy countries with collaborative approach. Besides Indian Scientists. S. some breeding lines and all the 22 wild species in the genus Oryza (8.150 CRRI. Therefore. and the mechanism poorly understood. Changing land use patterns may have an influence on diversity. and are always modern varieties and sometimes only the recommended varieties. need to increase awareness of the potential of onfarm conservation through dialogues. On farm conservation It is also an in situ conservation of the rice genetic resources under continued cultivation and management of a diverse set of rice population by the farmers in the agro ecosystem where rice has evolved. the science community and . domestication. but upon harvest are expected to pay for them. Therefore. protects specially adapted species. It allows to natural evolution to continue. and adaptation of modern high quality varieties affects the cultivation of traditional varieties. farmers will cultivate the 57 traditional varieties only if their cultivation does not penalize them. and commercial varieties on others. training and education at all levels was felt must. The varieties that were planted in irrigated plots were obviously less affected by the drought than the varieties planted on rainfed plots. as farmers plant only modern varieties in irrigated plots (Morin et al 1998). the farmers are given seeds at no cost. The seeds given in the scheme are from the certified seed growers. (Crop breeding and forestry maintained with in the same protected area facilitate research on species in their natural habitats). It was further agreed that since on farm conservation is important for many groups. It is a dynamic complex process of crop evolution involving origin. Interaction with farmers to enhance their understanding of the broader issues of plant genetic conservation would be one approach. farmers have to be provided with the right technical and economical options. so that they would be benefited by sowing the varieties targeted for conservationists. Four components of farmer’s management of diversity are seed flows. The competition between traditional and modern varieties is increasing. Nature and objectives of on farm conservations • Maintain and enhances allelic diversity • Access to and control over the diversity at the local level • Promotion of genetic diversity conservation a house hold security. Besides.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era laboratories for crop biology and biogeography. non-government organizations. irrigation sustained the use of modern varieties. It was suggested that land fragmentation may permit farmers to grow landraces on one plot of land. grow only modern varieties. a part of the Department of Agriculture system of seed procurement strategy. variety selection. this is one area in which government. serves several sectors at one place. It serves as a continuous source of germplasm for ex situ conservation. Therefore. Since the development of onfarm conservation approaches beyond current practices have hardly been started. Poor storage condition is a cause of genetic erosion. variety adaptation and seed selection and storage. Even under a scheme “Plant now Pay later scheme”. preserve pest and disease resistant species which can coevolve with their parasites. spread. The seed stores generally carry only modern varieties and certified seed growers. a simple and cheap seed drying and storage device that farmers could use to store the seeds for several years need to be supplied. the higher market price for traditional varieties does not compensate their lower yield and longer duration. Therefore. Traditional varieties are not planted by certified seed growers and were not included in the scheme. diversification and evolution. and also to conserve potentially useful alleles. There is general consensus that farmers are not conservationists in nature but are conservationists through use. Periodical regeneration and rejuvenation of collections kept in the short. * The National Plant Germplasm System (NPGS) of USA shall preserve the accessions from USA. by generating new technologies and methods of analysis that proved new approaches of supplement classical . * Institute de Recharche Scientistique et Technique out line . Meanwhile culture of isolated pollen was also carried out to induce plantlets. Conservation of wild species * The IRGC of IRRI shall preserve a complete set of genotypes. * IRRI shall preserve. Molecular biology. Bouake. Now. DNA markers (RFLP. 1997). screen houses etc. AFLP. * IITA (International Institute of Tropical Agriculture. grow houses. Ivory Coast (WARDA) plan to collaborate with IITA. the need of multilevel (National/ State/ Lesser entities) public and private collaboration in various conservation activities is felt. At IRRI about 500 rice accessions are grown every season in such a way as to characterize them and rejuvenate them. 1996). * The National Institute of Agrobiological Resources in Tsukuba Japan shall preserve. medium and long term storages are either done in the field in suitable conditions or in special situations such as green houses.rejuvenate and distribute cultivars of O. In vitro conservation This technology is used to ensure the survival of seed lots with low viability.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era farming groups should have a common interest.The above centres shall exchange and carefully compare the accession lists to minimize the maintenance of obviously duplicate accessions.sativa and Oryza species except those from Africa.glaberrima and wild species of Africa. rejuvenate and distribute Japonica varieties of East Asia. NBPGR now keeps its field collection numbering about 5000 in three centres in the field as well as in the store. Further. Ex situ conservation Ex situ conservation refers to the conservation of germplasm away from its natural habitat. tissue culture respositories or in seed gene bank (OECD. It is now being practiced to some extent in almost all countries as a means to conserve crop species diversity for posterity. This strategy is particularly important for crop gene pools and can be derived by propagating and maintaining the plants in genetic resource centres. rejuvenate and distribute Indica. The development of isozyme classification provides an unequivocal biological framework for the use and analysis of diversity patterns of germplasm based on other molecular markers. Ibadan Nigeria) will preserve. The USA also shall continue to store duplicate samples of 58 conserved IRRI stock. Japonica cultivars of O. South America and Mediterranean area.Mer FranceThe international network for rice germplasm conservation has the following components (ORSTOM) and West African Rice Development Association. RAPD and SSR) are routinely used for the management and evaluation of crop germplasm collections (Westman and Kresovich. Other national and inter national centres help IRRI on rejuvenation. embryo cultures and cold treatment of flower buds or panicles (at 9-1l°c for 14 days) induced more number of plantlets. A long-term seed store also caters to the needs of safer storage of collections immediately after field characterization and evaluation. anther float culture or cell suspension culture were also utilized. Seeds may have low viability when they are sent to gene banks for long term conservation. Anther culture. botanical gardens. The main task of a germplasm bank is to conserve germplasm in a state in which it can be indefinitely propagated. duplicates of the base collections should be conserved in other germplasm banks. The term ‘base collection’ is applied to collections stored under long-term conditions (-10 to -20°c at 4% moisture). 1996). Promising areas of biotechnology that may serve plant genetic resources activities and research are shown in Table 4. Formerly known as the International Rice Germplasm Centre. For other countries.56°c temperature seed longevity is doubled. whereas the term ‘active collection’ is used for collections stored under mediumterm collections (10°c at 4% moisture) and ‘working collection’ refers to breeders’ collections usually stored under short-term conditions (10 to 20°c at 4% moisture). Similarly. the longevity of seed viability is double. recombinant DNA technology (disease indexing. second rule says that for reduction of every 10°f or 5. For safety reasons. Biosystematics. recombinant DNA technology (gene / DNA library and cloned genes) RFLP technology.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era methods of analysis. For several countries. Utilization of Rice Germplasm The land races have an inherent genetic value because of their adaptation to different farming conditions and resistance to pests and diseases. Knowledge of these traits. such as India and the People’s Republic of China. Genetic diversity. Identifying duplicates. Genetic stability Maintenance and preservation In vitro technology. recombinant DNA technology (gene / DNA library) In vitro technology. Nevertheless. gene / DNA library and cloned genes) Dissemination and exchange The International Rice Genebank (IRG) The long-term preservation of rice genetic resources is the principal aim of the IRG. only parts . including Sri Lanka. the germplam conserved in the IRG represents a more or less complete duplicate of their national collections. Table 4. although genetic conservation activities started in the early 1960s. protein / isozyme electrophoresis of their national collections are duplicated at IRRI.66 . has contributed significantly to increased understanding of many aspects of plant biology. the gene bank has operated since 1977. At IRRI long term conservation of this strategically important germplasm collection has been achieved by exploiting the seed production environment in Los Banos to achieve maximum seed longevity in storage for all the diverse rice accessions (Kamaeswara Rao and Jackson. Activities of Research Collection or acquisition Helpful new technologies In vitro technology. cryopreservation. Lao PDR and the Philippines. Cambodia. It meets all the approved or preferred international genebank standards adopted in 1994 by the FAO Commission on Genetic Resources for Food and Agriculture. Maintenance of Germplasm The maintenance of germplasm bank is to conserve it in state in which it can be indefinitely propagated. Biotechnological tools and their potential applications in plant genetic resources activities. Storage of seeds for long term in the case of orthodox species is done based on the Harrington “rules of thumb” which define the relative influence of temperature and seed moisture content on seed longevity or viability.5. The first rule says that for every reduction in seed moisture content. their genetic and 59 Characterization. just after the Institute was founded. the IRG has provided an important safety net for national conservation efforts. Jayanti. ADT 33. Pusa 2-21. W 1256 and W 1263. Kakatiya. The drought resistant N22 was used in breeding Bala. CO 29 CO 29 CO 18 IR8 . Radhanagari 185-2. Padma. the latter lines were widely used inside India as well as in Sri Lanka and Thailand. Pusa 33. Sabari and Triveni.P. Tripti. Ratnagiri 24. Rice breeders of India have made effective use of the indigenous gene pools which provides resistance to pests or tolerance to eco-edaphic stresses.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era molecular control and stability under different conditions enhances the value of the conserved germplasm. Cauvery. Sarjoo 50. Jyoti TKM 6 Karivennel Pavizham PTB21 Daya. RatnamRudra. Palman 579. Samridshi. PTB 18 possessing multiple resistance has been widely used in India. Similarly. Subhadra. Neela. Karuna. ADT 31. Sarjoo 52. Himdhan. The tungro virus-resistant PTB 10 has been bred into improved varieties such as Aswini. became a parent of Ratna. Pennai. Indian breeders were also developing saline-tolerant varieties from indigenous sources such as Pokkali. Kanchan. Vaigai. Kiran. which is adapted to altitudes above 1.000 meters (Table 5). a local variety of H. The use of germplasm in crop improvement could be facilitated by systematic evaluation and documentation of the acquired data. Asha. TKM 9 Vytilla 2 CO 43 PVR1 Dasal. Madhu. Narendra2. Donors utilized and varieties bred for abiotic stress (Sharma et. Parijat. Usha MR 118. Radh. Cauvery. Prasanna Abha. Rohini. Birsadhan 201. CR 128-928. Madhu. 1988) Stress situation Drought / Upland Donor utilized N22 Varieties developed Akashi. Udaya Bharatidasan PTB33 Disease Tadukan Blast T(N)1 Archana. TKM 6. Poorva. Himalayan. ADT 34. Narsing Rasi. Similarly the germplasm collections were Table 6. Saket 4. Rasi. Suma Suphala. Jaya. Kalinga 3. Hema. Govind. Neela. Madhu. Kanchi. Vishnu Asha. PR 103 Pusa 4-1. Paramkudi 1. Parijat. Manhar. Saket 4. Sattari. Deepa. Jyothi. FR13 A is an outstanding source.. Parjat. Narshing. Sarasa. Ratna. vajram Donor utilized Varieties developed Manoharsali Sonasali Brown plant hopper PTB10 Bharti. IR 579. Govind.al. Germplasm utilized and varieties bred for resistance to pests and diseases Pest Insect pests TKM6 Stem Borer ARC 6650 CR 138-928. state was used to breed Himdhan. HM 95. Vishnu 60 Donor Stress situation utilized Deegeowoogen Salt IR8 tolerance BR 4-10 Dasal SR26B Varieties developed Pathara. Pratap. Kusuma. Thirupathisaram 1. Sarjoo 49. Bharathi. C 7306. Parijat. Narendral. IGP1-37. R 575. Bhagawathy. which has multiple resistance to insects and disease. Saket 4. Sayasree Pratibha. CR 44-1. MDU1. Sarasa. Sankar. Rajendra. Getu and Table 5. Tella-Hamsa MR 118. For tolerance to submergence by floodwaters. MR 118. Bala. shy tillering. Narendra 2. Chinese semidwarfing source. CR 94. Shakti. Neela. Karjat 1. 1971) tolerance to cold. IR 36. vertical resistance to several diseases and insects. Pusa 2-21. through local screening and selection. Nearly all of the national centres have made profitable use of the semi dwarfing gene (sdi) contributed by Dee-geo-woo-gen and a varying number of the pest resistance genes derived for IRRI lines or IR varieties. The Genetic Evaluation and Utilization (GEU) Programme has made successful use of the following gene pools viz. Udaya CO 44 TKM6 PTB2 Rice Tungro virus PTB10 PTB18 PTB21 Kheer. the recent IR varieties are highly resistant to bacterial leaf blight. Saket 4 Vikramarya Annapurna. 1977) amylase content and also for the genes for dwarf stature. drought (Hakkim and Sharma. The ARC have also possessed diversity for glutinous or waxy traits in rice. Ratnagiri 78-1. IR 36. Radha. drought and resistance and recovery and tolerance to certain adverse soil factors. Polao and Chokuwa and soft rice. Samalei. as well as selection of suitable phenotypes by breeders (Table 7). Ratna. Lakshmi. Samridhi.. and rices used for preparation of flaked rice. Narandra 2. Over the decades.sativa might have taken place in this region. Vijaya CO 25 Bacterial leaf blight TKM6 Bhagawathy.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Karjat 14-17. The genes for grassy stunt resistance were derived from the wild relative. Sarasa. Sarasa. in ARC and they have pointed out that racial differentiation in O.. Rajarajan Govind. 1974) flood. Shakti CR 57. Vani. early maturity and photoperiod insensitivity. the germplasm collections at IRRI have been systematically characterized for a range of morphological and agronomic traits that facilitate conservation. Assam Rice Collections (ARC) had many valuable genes for various pests and diseases (Sastry et al. 1996). used as donors and many varieties were bred in rice (Table 6). rice beer (Apong. Triveni CR 94. IR20. IR20. IR 50. Daya. leafhopper and tolerance to one or more adverse soil factors. Rao and Srinivasan (1978) found that ARC also have high field potential under low ‘P’ in the soil. Besides. Rajarajan. puffed rice and bar boiled rice were also found (Ahmed et al. IR 36. Oryza nivara. Pratap.. 2000 a. For instance. rice blast and bacterial leaf blight (BLB) and adaptation to cold temperature or saline soils (Jackson et al. short panicle etc. Thousands of individual rice accessions have been evaluated for their resistance to or tolerance of a wide range of pests. CR 138-928. diseases and abiotic stresses. Usha.. Seetharaman et at (1974) found that whole assemblage of japonica characters such as their culm. several national centres have incorporated additional resistance or tolerance genes from other sources into their improved varieties. aromatic rices (Jolia) for the preparation of 61 . Moreover. Kurum). This is special class of rice for preparation of confectioneries (Pithus. grassy stunt virus. ASD5 evaluated and screened for pests and diseases. the tungro virus. Haj) as break fast food (Salpan) and industrial use. Neela. Ramakrishna Bharatidasan. such as brown plant hopper (BPH). biotypes 1 and 2 of the brown plant hopper. Ratnagiri 1. Radha.b). high protein (Srivastava and Nanda.. Ratnagiri 68-1. 169 891 1.109 390 233 151 84 27.139 5.officinalis O.7 plant hopper Zigzag leaf 2756 10.9 9 14.873 3.sativa accessions in the international Rice Genebank collection evaluated at IRRI for their reaction to insect pests and diseases (Jackson. 1994) Stress No.6 8.nivara O.485 1.376 2. Table 9 .resseranti O.malampuzhensis Floral characteristics Utilization of wild species The use of wild rice species in breeding 62 O.6 Yellow stem 15656 3.brachyantha O.8 Rice whorl 22949 3.4 hopper biotype Brown plant 10053 1.052 20.longistaminata O .01. found Tolerant tolerant (%) (score 1-3) 19.nivara O .7 7. Number of O.genetic evaluation and utilization programme. Villegas (1991) has enlisted certain wild species used to enhance the value of agronomical traits in cultivars by way of transferring the insect resistant genes (Table 10).84.officinalis O. tested No.spontanea O.perieri O brachyantha O.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 7. Distribution of useful gene among wild rice (Siddiq 1991) Character A) Biological stress Diseases Grassy stunt virus Rice Tungro virus Species Bacterial leaf blight O.0 White backed 52042 1.8 borer More than 1.80.f.perennis .8 hopper biotype Green leaf hopper 50137 2.4 12.minuta O . Table 8.ridleyii O.525 1.3 13.eichengeri O.784 8. O.perennis Insects pests Brown Plant hopper (all three biotypes) Striped borer Yellow borer Gall midge Wet land rice Salinity Alkalinity Zinc deficiency Phosphorus deficiency Iron toxicity Peat soil Upland rice Al / Mn toxicity Iron deficiency Total 1.officinalis O.granulata O.minuta O. 1997) Stress O. malampuzhensis O.3 9.sativa accessions Number Resistant (%) Insects pests Brown plant 44335 15.latifolia O.officinalis O.1 hopper Rice leaf folder 8115 0.nivara O. Under IRRI.214 19.8 programme for various stress situations and hybrid rice development has been described by Siddiq (1991) Table (9).coaractata O.000 rice accessions were screened at IRRI for soil related stresses and tolerant lines were identified (Table 8).officinalis.rufipogon O.eichengeri O.293 44.848 1.6 7. Summary of screening tests for adverse soil tolerance in rice 1969-1986 (Neue.minuta O .9 hopper biotype Brown plant 13021 1.grandiglumis O.189 Physical stress Salinity Drought Physiological features High photosynthetic efficiently Under low light conditions Hybrid rice Cytoplasmic sterility O.granulata Portersia caractata O. 1982).minuta Resistance to BPH Resistance to WBPH O.sativa)) and MDU 5 (O. however.officinalis Resistance to BPH Resistance to WBPH O.nivara (RGC 101508) was used to introduce resistance to grassy stunt virus into cultivated rice. For example. hybrid between O. In collections held under poor storage conditions. a heavy workload in addition to the risks inherent in frequent generation.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 10. There are many potential causes of poor viability. Now.sativa and many wild species have been achieved through the use of various biotechnological tools (Khush et al. it is necessary to improve seed drying procedures and the capability of genebenks to approach this target. making it the world’s most widely cultivated cereal crop variety (Swaminathan. Seed processing problems (particularly inadequate seed drying procedures) and delays in receiving accessions at national centres are two of the more likely causes. It is clear that over the past 15 years there has been a significant increase in the use of landraces in rice breeding.glaberrima / Pokkali (O. which guide more strategically the utilization of germplasm accessions in rice breeding.perennis / GEB 24 (O. What has had real significance is the contributions to rice science through the many studies of land race varieties and wild species concerning their reaction to pests and diseases. the nature of biochemical pathways and molecular basis of resistance.punctata Resistance to BPH Resistance to GLH Resistance to Bacterial Leaf Streak Resistance to BLB O. especially under hot and humid tropical environments. Genebank management. The economic value of the rice germplasm collection for rice improvement has also been assessed. relative to the large number of rice accessions . the production or collecting of high viability seed lots of Oryza sativa and O. 1993). the use of conserved germplasm for breeding is really rather limited.latifola Increased biomass Species O. In theory and in practice at many locations.glaberrima is less a problem than is the case for many other crops. the important 63 The use of landraces and wild species in rice breeding had an enormous impact of rice productivity in many countries. Conclusion Many rice growing and consuming countries continued to explore rice biodiversity and conserve them ever. In Tamil Nadu CO 31 (O.. A moisture content of 6-8% is acceptable. Accordingly.australiensis Resistance to BPH Tolerance to drought O. This variety also had 15 land races varieties in its pedigree (Plucknett et al 1987) and at one time. it is necessary to monitor and regenerate accessions frequently. one accession of the wild species O. which led to the release of IR 36. The single most important factor in the successful maintenance of rice seed stocks in genebanks is the control of seed moisture content.10° c). it was planted on more than 11 million ha.sativa)) were the two rice varieties released by inter specific hybridization by utilizing the wild species of rice (Subramanian and Manual. 1998). Use of wild rice to transfer useful traits Useful traits Resistance to BPH Resistance to WBPH Resistance to GLH O. It is to be strengthened at regional level and mutually benefited with exchange of germplasm at international level. Conservation of germplasm. for centers that can provide subzero storage conditions (typically . Nevertheless.eichengeri conserved at IRRI and in other genebanks. Rice seed viability monitoring is the second most widespread concern. Jaipur.Masan) resistant germplasm and their utilization in . 3.) Zea and Pseudocereals. safe delivery and use. IRRI program report for Rice 2000. Therefore biotechnological approach through anther culture. It should be made as viable option to farmers and encouraged more intensively by supporting the farmers.glaberrima.108. and providing simple effective seed storage facilities are very important needs for successful seed conservation of local races. cell suspension culture. Anonymous. may ease the regeneration of large number of germplasm. 2000 b. Rice genetic resources: Conservation. pollen culture etc. Oryza. and Pathak. pp. 2000 a. besides it serves as a basic compendium for the plant science students and scientists. viability. T. Market potential of Jolia rice of Assam (Abstract) 4 th Agricultural Sciences Congress. Evolution of Crop Plants (eds.Mishra B.sativa. 1995. very accessible and provides high security. T. Ahmed.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and challenging task needs more attention and concentration. 102 . Bettencourt. Jaipur. K. Quality seed supply in affordable seed cost. Internation Board for Plant Genetic Resources.. E. Sharma. 64 Research on seed technology is yet another attempt to study the quality. Use of biotechnological tools such as in vitro techniques have to be further strengthened and practiced. T. Triticum. their regeneration is very much essential to prevent the loss of viability. and Pathak. J. Growing all these germplasm every year for the aforesaid purposes is very difficult and expensive. dormancy and storability of rice seeds to raise healthy plants ever as germplasm. 1977. Rice: O. procurement of seed at reasonable price. Chattarji S. Sorghum. These germplasm need specific location and environment to grow well and attain maturity to produce quality seeds. They should be often discussed to solve the problems and constraints encountered in preserving seeds then and there. Chang.K. REFERENCES Ahmed. Secale. in situ conservation of land races and indigenous rices through on farm cultivation in farmers field are effective. because it maintains more allelic diversity. P. In situ conservation is also a method of conserving the wild species and related genera of the genus Oryza. Prasad. Cereals: Avena. Identification of gall midge (Orseolia oyzae wood . Though research institutes all over the world grow and regenerate the germplasm. The farmers should also be trained in seed production and conservation. Documentation on the details of biodiversity of the rice germplasm and their characteristics is the most useful approach for the researcher’s choice of useful germplasm to achieve their goal in rice improvement.M. and Konopka. and O. Policy on intellectual property right (IPR) should be well documented and implemented to protect the property right of the rice germplasm from every country and also to exchange genetic materials freely on mutual under standing to breed desirable rice plants by the rice growing countries in the world. Millets. Very large number of rice accessions are being maintained in many research institutions for very long time.T. 2000. Rome. Sharma. These regions need to be brought under the control of plant biodiversity authority to prevent the loss of the valuable species and genera and the seeds collected from them should be spared to needy countries freely on mutual understanding. Export potential of bora rice of Assam (Abstract) 4 th Agricultural Sciences Congress.K. K.. Hordeum. K. Directory of Germplasm Collections.. 1990. This is a novel way not only to conserve more gene pools and also to prohibit the genetic erosion of valuable germplasm.C and Rajamani. and Jackson. Jackson.. Plucknett. M. Iowa State J. N. (Edited by D. Proceedings of the Tenth Australian Plant Breeding Conference. Loresto. Rao. Williams. IRRI. M. 1997.P. 1996.R. J. R. 1969. Cereals (V.C. G. 65 Chopraed. Sinha. Isozymes and classification of Asian rice varieties. D. CT. G.. Sci. April 18-23. G.Sci.P .C. Nelson. Morin. New Delhi..). Madras... G.. S. 65 : 626 . and Gollin 1994. T. Variability in rice to chemical stresses of problem soils and their method of identification. Gene Banks and the Worlds Food. S. L. Kameswara Rao. Princeton University Press. 1974. Appl.. Jackson. Philippines.J. Gene bank standards. Yale Univ. Managing Agricultural Biotechnology. 1993. Rice Biodiversity in Trust. M. and Jackson. Theoretical Approaches and Emprical Studies Detlef Virchow (Ed.L. Focused Plant Improvement: Towards Responsible and Sustainable Agriculture. SCRP / CGIAR. J. Senadhira). (inpress). K. U. Smith.. Integrating indigenous technical knowledge and in situ conservation: Collaborative research in Cagayen valley. E. Oxford and IBH. Kosaka. and Bottrell.and Srinivasan. M. Theor. Biol. Brar. 44 : 215 . Pyrah. Rice: In: Evolution and adaptation of crops. Neue. In : Efficient conservation of Crops Genetic Diversity.Q.). 2003.T. FAO. S. Conservation of rice genetic resources.. pp 102 -109. 1998.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era breeding J. and Murthi Anishetty.T. S.E. Evaluation of Assam Dwarfs-suitability under low P and N conditions. J.S. Seeds. Kato. Genet.B. 1930. Khush. and Nga. 1994. Duistermatt.. F. Plant. international organizations. Nmecough.174.T. M. Entomological Research. S. Costs of conservation of agrobiodiversity in India. H. and Brar. Vo. FAO. 32 :157 -193.D.S. Ceby city. Saving Biological Diversity economic Incentives. I. H. Zapata.L.L. The role of the International rice gene bank at IRRI.E. Economic Growth Centre. Localized distribution of certain characters of rice in North East India. Biotechnology for rice improvement.U. R. Glaszmann. Chandak. Gupta.T. and Anil. Taxonomic and distributional studies in Leersia (Graminae). Hakkim. Jones.276. 115 . N. Jackson M.. N. Addressing Research Programme and Needs and Policy Implications (Ed. S. J. New Heven. Appa Rao. . Plant Breeding. K. M. 1996. Agric.K. S. 4-6. Princeton. Chapter 20.H.G. Evenson R. Sebastian. 1978. Effect of planting date and harvest tie on longevity of rice seeds.S. D. M. Philippines. 1987. Saxena. Parm.62. OEDC 1996. 2001.. D. On the affinity of rice varieties as shown by the fertility or rice plants. 2001.. Cambridge University Press. In Rice and Problem Soils in South and Southern Asia. N. Bellon.S. 1993.I. Res.144. S. 35 : 61-67. and Hara. J. Khush. Blumea. Calibo.T. 1: 111 -113.J.K. and Sharma. 1999. H. 1999. Indigenous knowledge for conservation and management of biodiversity. Univ 2: 241 . N.. Ghosh. Springer Verleg. Guimzarases. Genet. Rome. 137 .270. J.. 1987. D. Managing Genetic Resources and Biotechnology at IRRI’s Rice Genbank. 74 : 21-30. Cohen).L. 1994. Genetic resources. 34 :16-21. and rice varietal improvement. Centre Agricultural Institute Kyushu Imp. March 1998. France. 1987. Jain.. Indian. Berlin.S.R. A revision of Oryza (Graminae) in Malaysia and Australia. OECD. Centre Discussion paper 7123. Mol. S. M. In Assam Rice Colelction Curr. Srivastava. Indian J. Global Diversity Assessment. Sharma. Rice Comm.. Philippines.rufipogon Griff. J. UNEP... Manila. 1-80. Cambridge University Press. Taxonomic studies in the genus Oryza O. variation in grain protein in some groups of rice varieties from the collection of North East India. B.69. Ford .J..N. 1971.N. and Dallwitz. Sensustricks and O..J. IBPGR Plant Genetic Resources Newsletter. Week. and S. 1977. S. S. Varietal description of rice. Oryza. Platinum Jubliee Publication. Oryza. Aust. Use of molecular marker techniques for description of Plant Genetic variation. International Rice Research Institute. Collection and evaluation of rice germplasm form North East India. D. Subramanian.204. Seetharaman R and Ghorai D. Guidelines for country studies on Biological Diversity UNEP. V.S. Nov. Preliminary studies in rice cultivars from North East India. John. 1998.R. 1982. Bot. p. 14 : 45-46. Swaminathan. Relation evolutives chezlegenere O.A. Indian Genet. Bot. Paper presented at the International Centers.W. B. 1997. Sharma. Sharma. W. 28 :1-17. In : Biotechnology and Plant Genetic Resources. Washington. N.D. Westman.165.P. A. of the third international workshop.nivara Sharma et Shastry nom. Newbury. A. S.D. 50 : 62 . Genes and rice improvement.V. Dhua 1988. Design and Implementation. L.P. 1991. 1991.S. Orstom etudes and theses: 1-189. Villegas. 55 :141 .1982. and Krishnaiah.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Handbook of Incentives Measures for Biodiversity. and Shastry.T. 10-12. Rice germplasm collecting. G.V. Watson. Tzvelev. S. Intern. UNEP. Srivastava. M.A. Nairobi. R. 33 : 433 . edited by J. Walling Ford.. 25 :157 . pp. D. precessus der domestication des riz. 1965. The classification of Poaceae: Subfamilies and supertribes. 1989. and Nanda.S.P. 1974.D. 1985. Plant Genetic Resources (Indian Perspectives) pp 108 -120. S.C..L .R. H. E. Shastry. Rev. World Bank.T..D. 1992. V. Plant Breeding. 22 :1-16. 66 . 1976. 34 : 3-149. Callow. The system of grasses (Poaceae) and their evolution. Seetharaman. Cambridge.and Kresorich. Second. New sources of resistance to pests and disease in the Assame Rice collections. Sharma. Occurrence of types with characters of glaberrima. P. 50: 62-69.. S. 1995. 1982. Newsletter. Beyond IR 36: Rice research strategies for the 80s.120. Proc.. 1985. Genet. M. Cliford.Lloyd and H. Siddiq. D. Krishnanusti. November 20. and Manual. Paris. preservation in USA. Genetic diversity in rice and its utilization in India. Conservation and use. March 1991. Aduthurai. and Ghorai.B.484. D. Mishra and Jayarama ABSTRACT Coffee is an important commodity of international trade and India is one of the important exporting countries. Murugan. arabica versus the diploidy of all other species of Coffea preventing ready flow of genes between other species and Arabica. 1989). A general description of the genetic architecture. Added to these. inheritance of rust resistance.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era GENETIC DIVERSITY OF ROBUSTA .6 and Sln. Sln. Four genes of resistance viz. It is not an exaggeration to state that the economies of most of the coffee producing developing countries depend on the earnings from this crop (Marshal. Sabir. Coffee Research Station 577117.K. C. which produces quality coffee with fine aroma and taste attributes. 1985). Leaf rust caused by Hemileia vastatrix is a devastating disease of coffee.K.0 per cent plants were susceptible. Leaf rust is a devastating disease of great economic significance on this crop (Kushalappa and Eskes. Another possible reason for the susceptibility of Arabica coffee is the perennial nature of the crop plant and quick adaptation of the rust fungus to the resistance offered by the host. India 67 . 1985).. A. arabica (Rodrigues et al. Chikmagalur District.0 per cent. M. SH4 and SH5 were identified in the cultivated/wild gene pool of C. et Br.canephora Pierre ex Froehner (Robusta). (Arabica) is more susceptible than C. Arabica is the species. Ganesh. Preliminary observations on RAPD markers in Sln. Central Coffee Research Institute. Thus.8 were tested against susceptible check Sln. All the new resistant selections showed a high degree of resistance ranging from 81. Eskes. quality and possible use of RAPD markers in selecting resistant plants in advanced generations is presented. a number of resistant selections were developed. S. arabica L. C.5A. 1989).25 to 95. Division of Botany. 1975. Sln. Of the two commercially important species of Coffea. Introduction Coffee is an internationally important commodity in trade volume and money value. D.P. Mythrasree. Manoharan. R. The susceptibility of Arabica is possibly due to the narrow genetic base of the commercial populations which are known to have been derived from very few plants (Smith. SH2. However.5B. Resistance to leaf rust in Arabica coffee is known to be conditioned by 9 genes symbolised SH1 – SH9 (Rodrigues et al. arabica such as Bourbon and Typica are highly susceptible to this devastating disease. Leaf rust disease has wiped out Arabica in Sri Lanka and Indonesia where only Robusta is grown now.. This disease is caused by the Basidiomycete fungus Hemileia vastatrix B. N. Karnataka. A1. Old cultivars of C.ARABICA HYBRIDS OF COFFEE AND UTILIZATION IN BREEDING Santa Ram.3 an average of 92. the resistance of coffee plants carrying these genes in different combinations 1. 1975. improving Arabica coffee with the specific objective of rust resistance without compromising on yield and quality is a task of considerable dimensions. Through selection over years. Dinesh. which tends to fix the traits and reduce the variability in adaptive genotypes or land races. In the check Sln. arabica is also the species susceptible to pests and diseases.3 in three locations.2000). C. Coffea arabica is susceptible to this disease. is the autogamous reproductive behaviour of C.R.. diversity. Incidentally. SH1. Sln6 and Sln. K.8 indicated distinctions between resistant and susceptible plants in these selections. Sandhyarani. arabica. Another important point is the tetraploidy of C. This led to gaps in the knowledge of behaviour of genes and resulted in a set back in understanding the stability of resistance in these important sources of resistance. An important point to be noted is that the evolutionary processes which led to the isolated populations of Coffea (with their morphological peculiarities) from a possible common ancestor were unable to proceed as far as creating biological species showing absolute isolation or a marked chromosomal restructuring. at least. Williams et al. 1994). the allelic composition of these hybrids is not yet elucidated. 1992). 1989). Results of three consecutive tests are presented in Table 3.5B were derived by crossing Devamachy.. Grassias and Kammacher. 1975).6 (Robarbica) is an artificial hybrid developed by crossing Robusta (S. Thus. 1990).6 and Sln. 1999. This situation prompts that breeders should generate or identify alternative sources of resistance to this important disease. arabica is an example. Current coffee breeding programmes utilize the resistance genes resident in some spontaneous interspecific hybrids. However. the early Indian coffee selections are known to carry the SH3 resistance gene putatively derived from C. Sln.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era was defeated by the virulent races of the rust fungus (Rodrigues et al. partially defeated by the new races of the rust fungus while HDT has been maintaining its high resistance (Rodrigues et al. Present study attempted a comparison of the manifested diversity of these interspecific hybrids in a bid to assess their utility as sources of resistance genes. 1946) and C. 1952.5B. Sln.. India) respectively.3 (S. Sln. SH7. RAPD markers were generated from the DNA of resistant and susceptible plants of Sln. Results and Discussion The Genetic System of Coffea arabica A brief consideration of hereditary dynamics of Arabica coffee is important to explain the observed durable resistance in the genus Coffea and propose a model breeding strategy for imparting durable resistance to C.795) was included as control. SH8. a natural Arabica – Robusta hybrid with S.333 (a natural hybrid of Arabica and Liberica from Doobla. arabica without compromising on quality. Hibrido de Timor (HDT) spotted in an Arabica field in Timor (Bettencourt. This species was considered a segmental allotetraploid on the basis of its diploid cytological behaviour with occasional quadrivalent formation at meiosis (Carvalho. Resistance of the commercially exploited hybrids of HDT ancestry was. In the coffeebreeding programme of India. 1993.8. This is commercially exploited in our country as Selection-8 (Sln. SH9 in genotype (Bettencourt et al. Arabica is the lone tetraploid in the genus and has many biological distinctions apart from its chromosome number. Bangalore.. 1975). Eskes. Incidence of leaf rust was recorded from all individuals of three populations of each of these selections in three different locations and summary of observations is presented in table2.5A and Sln.881 (Rume Sudan Arabica) and S. Materials and Methods Observations on various morphological 68 characters were recorded from a sample of 10 plants of each of the selections Sln. Thus. Beverage quality of the samples of all selections was assessed by the quality lab at Coffee Board Head Office. certain unique Robusta – Arabica hybrids carrying a high degree of resistance to leaf rust were created. HDT manifests resistance to all known races of the rust fungus and was shown to be SH6.. 1975.8 by the method described earlier (Ram and Sreenath. Sln.274) and Arabica (Kents) and backcrossing the hybrid to Kents.. 1973) is the extensively used source of rust resistance genes.6 and Sln. Sreenivasan et al. Summary of observations is presented in table 1. Sln. liberica (Rodrigues et al..8). the diploid groups that are . Most of the allopolyploid species manifest variations that are illustrative of the processes of natural selection (Darlington.5A. 2000.00 percent of the population being resistant (Table 2).. arabica in the land of its origin (Lashermes et al.3 (S. 2001) is not exactly reflective of this situation and renders credibility to the possibility of its being a compilospecies. The large diversity of C. An important point to be considered is that these commercial populations are derived from selected plants and hence segregations do not necessarily reflect genetic laws. 2004).. 1977). even while it carries a considerable degree of genetic homology with several diploids.795) also a similar ratio is observed . However. Genetic Diversity and Inheritance in Robusta – Arabica Hybrids Four selections of the present study were all derived from the natural or artificial hybridization of the commercially important species C.25 to 95. 1995. size and petiole length appear to have been a contribution of the ancestral Arabica parent. Dual modes of inheritance in the tetraploid Arabicoid interspecific hybrids (Lashermes et al. a high frequency of plants averaging 92.3 (S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era mostly homosequential in chromosome structure form a vast genetic continuum (Kammacher. In Sln. canephora. indicating that two pairs of genes are involved in conditioning resistance of these materials. arabica and are distinct from each other (Table 1). the observed resistance of Arabicoid descendants from interspecific hybrids can be effectively exploited to evolve gene pyramids (Ram. These are morphologically very similar to C. The wild populations of Coffea adapted balanced heterotic breeding as the basic strategy of evolution that facilitates relatively easy lateral transfer of genes across sympatric populations even as the so-called species maintain their relative identities (Stebbins. the control variety. This has tremendous implications for breeding and potential materials that can be used in exploiting this feature of Arabica are already available for breeding purposes (Ram et al. These distinctions indicate that the genetic architecture of each of these selections is unique even though they are derived from similar parents. 2001). 2004) and gene conversion in diploid interspecific hybrids (Ky et al. 2000) were reported and can lead to inconsistencies in realizing expected results in resistance breeding programmes. Another important point is that an allotetraploid is a permanent hybrid whose recessive gene mutations cannot segregate when it is self-fertilized. Relative uniformity of plants in each of the selections is a reflection of this. 1962) or induced mutations. Selection for young leaf colour. Dawson. The only possible mode of enlarging its variation is by secondary segregation of ancestral differences (Darlington. fruit colour. Distinctions in leaf shape. the observed ratios in Robusta – Arabica hybrids approach 15:1 of resistant and susceptible plants respectively. Heredity of Leaf Rust Resistance All these selections also manifest a high degree of resistance to the leaf rust disease ranging from 81.00 percent were observed to be susceptible. The singular major distinction of C.. The self-sterility system of its parents need not necessarily work in the allopolyploid species rendering it effectively endogamous. and frequency of A-grade beans contribute largely to this morphological and genetic homogeneity of the selections. The large genetic variability of this species in its center of origin and diversity and its ability to assimilate the genes of several diploid species indicate that it could be a compilospecies (Ram.1996. The heredity and durability of disease resistance 69 should be understood by superimposing it on this basic genetic system that is responsible for the observed inconsistencies. In this context. 1971). Teixeira-Cabral et al... 1946. arabica and C. Morphological homogeneity of each of these selections is a result of continuous selection for characteristic features. Anthony et al. arabica is its tetraploidy. In the plots of Sln. 2004). angle of insertion of primary branches.795).. 2006) and can be superimposed on the cytogenetics of interspecific hybrids to explain the longevity of rust resistance of Robusta – Arabica hybrids.5A. Sixth and seventh generation Sln.8.1994). Teixeira-Cabral et al. 1989. This genotype is derived from the homologous recombination between the chromosomes of Arabica and Robusta.3 is derived from C. Eskes.3 populations represent this situation. Lashermes et al. Complementary action of the vertical and horizontal resistance genes in these selections was elucidated (Ram.3 (S. only the latter two categories manifest the trait of interest. leading to an apparent fixation of heterosis (Brewbaker. Among them. Sln. Hereditary dynamics of this chromosomal genotype is shown in the checkerboard 1.. Structural heterozygotes carrying a Robusta chromosome or an Arabica chromosome and the structurally aberrant Arabica chromosomes carrying a segment of Robusta chromosome or the structurally aberrant Robusta chromosome carrying a segment of Arabica chromosome form the entire remaining progeny of 12/16 (~ 76%). 2004). imposing artificial selection for leaf rust resistance in the seed plots and isolating them can maintain resistance of a high order for a long time in the commercial populations. 1994). Rust resistance genes of Sln. this leads us to realize about 94% of the progeny manifesting the character of interest... canephora while that of Sln. This is the existing situation in all the Robusta – Arabica hybrid selections of the present study. 1993. Dynamic reproductive selection processes (selective fitness of structural heterozygotes. R/A-R/A and the substitution line RR breed true for the character of interest (such as disease or pest resistance) and comprise a proportion of 3/16 of the progeny (~18%). Structural heterozygosity maintains the manifested characters of these plants by suppressing chromosomal recombination in a large frequency of spore mother cells. This cytogenetic model explains the process of introgression of genes from diploid species into . This explains the importance of a genomic imprint in the context of evolutionary fitness. Structural homozygotes A/RA/R. a possible manifestation of negative natural selection (Sreenivasan et al. Sln. Sreenivasan et al. This situation is described as balanced polymorphism or functional homozygosity of a heterozygote... liberica (Rodrigues et al. 1995. In essence. A simplified picture of the dynamics of cytogenetic phenomena involved in gene transfer is as follows.6 and second generation in the case of Sln. 1975.) lead to a stabilized population over three to four generations. normal homozygotes (AA) carrying a pair of Arabica chromosomes form 1/16 of the progeny (~6%). the population tends to revert to pure Arabica type and substitution types with a few structural homozygotes. It is the third generation from second backcross in the case of Sln. 1964).5B and Sln.8 are derived from C. Plants in the commercial populations are third generation descendants from the parents in the case of Sln.5B.795) included as control is the sixth and seventh generation. From the observed resistance patterns of various selections it is evident that the resistance genes are gradually getting eliminated with advancing generations. as often observed in the case of rust resistance in advanced generations of Arabica coffee hybrids. This pattern is in conformity with tetrasomic heredity as elucidated in other studies (Ram. The genotype of an Arabicoid derived from interspecific hybridization of Robusta and Arabica and stabilized through backcrossing to Arabica is shown in the figure 1. Thus. genetic drift etc.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era with susceptible plants in higher frequency. If natural selection does not favour structural heterozygotes. 70 In the progeny shown in checkerboard 1. 2000.5A and Sln. In the interspecific hybrids generated by crossing closely related species. The selection for genes conditioning quality of coffee was also evidently very successful as reflected in the data of Table 3 even though it was not intended. Arabica. arabica. the reproductive process eliminates most of the non-homologous chromosomes received from the male parent and only those carrying the maximum homology with those of the female parent are retained in the first backcross progeny. This retention of genes is usually because they are favourably selected in each reproductive cycle. 1998). Barre et al. Thus. 1995). Sln.1997).8 that incorporate the genes of C. However.5B. Transmission of Quality Traits There is a belief that coffee quality is compromised in interspecific hybrids.5A. canephora is appreciated well in the various cup tests. bean grades assumed importance because uniform size gives uniform roasting that is important to realize good beverage quality (Ram. liberica appears not to be differing significantly. apparently the genes introgressed from other species and influencing quality appear to be unable to find expression as not only the quality of Sln. This manifestation has powerful implications for breeding to improve the quality of beverage in Arabica as Robusta and Liberica produce a very inferior beverage (Charrier and Berthaud.3 (S. is a tetraploid (carrying four sets of chromosomes) in which several other mechanisms of gene expression are likely to be operational.6 and Sln. it is possible that co-suppression is operating to prevent the expression of genes coming from the diploid species. 1995). liberica but also the quality of Sln. Fair Average Quality (FAQ) that is generally accepted in international markets is realized in the four Robusta – Arabica hybrid selections. librica that contribute to quality are suppressed in their expression in C.. as they exist in the genetic set-up. arabica genomic background. 1983. the quality of various selections derived from diverse parents combining the genes of C. C.5B. It is possible that some of the genes of C. Bean sizes above 6. Sln. on the other hand.795) are confined to the resistance factors (SH genes) and all others appear to have been eliminated or neutralized in the course of evolution of this selection. Another genetic mechanism that can possibly cause the observed quality in selections is “gene conversion”. Sln. This gets further reduced with each advancing cycle of reproduction of the backcross progeny and within three cycles only a few blocks of genes of the introgressed species will remain in the genome. From the data in table 3. In these cases. Sln. One such mechanism is “homology dependent or repeat induced gene silencing” in which. Sln. Quality of coffee is assessed on the basis of bean size and organoleptic quality of beverage. Thus. As Robusta and Liberica are diploid species (carrying only two sets of chromosomes and thereby two sets of genes) the alternative states of good versus bad 71 quality character come to expression.5A.or AA-grade) are considered important in trade and achieving higher frequency of this grade in the produce is an important breeding objective (Walyaro. 2003). canephora and C. arabica and holds good for the genes conditioning VR as well as HR as introgression of these two types of genes can be parallel. Similarly.6mm (A.8 carrying the genes of C. In Arabica. canephora and C. liberica genes introgressed into the Arabica variety Sln.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era C. beverage quality was known not to be dependent on the bean size (Roche. canephora are also not expressing them in the context of quality. the expression of a character is driven from a single gene when more than two copies of the gene conditioning that character are present in the same genome (Jorgensen. How does this .6 and Sln. Such conscious selection was practiced in our country with reference to the rust resistance genes.3 carrying the genes of C. 1988. C. 2004) as all of them are reported to possess good beverage quality. for the characters native to C... Charrier.. Quiros. Petracco. arabica x C. Thus. This analysis also provides a clear understanding of the direction and method of selection and backcrossing to be undertaken when loss of resistance is experienced in advanced generations. 2 and 3) indicate distinctions between resistant and susceptible plants in these selections. A. a combination of these selections yields produce of relatively uniform quality and forms a resistance gene pyramid that stands highly resistant to the leaf rust disease for a very long time. unique markers found to be associated with a complex of characters breed true. 2000). canephora.. Wilches. REFERENCES Anthony. These insights also help in identifying the mother plants that can be excellent seed bearers that maintain the resistance genes without compromising productivity and quality. 1960.6 (Fig.. Berthaud. O. Thus. The diversity of parents implies that these traits are conferred by a different complex of genes in each of the selections. Further work in this aspect is expected to lead to the identification of additional unique markers in the resistant plants 72 producing good beverage quality.. Some of the unique RAPD fragments inherited from specific parent were also identified in Sln. Ganesh et al. 2002) through conversion of diploid genes. Genetic diversity of wild coffee (Coffea arabica L.) using molecular . 1951). 2001. 1971. These markers have a diagnostic utility in identifying plants possessing these traits at an early developmental stage like nursery for the establishment of seed gardens and constitute the initial approach to a marker assisted selection programme.6 (Figs. Hibrido de Timor and derived lines such as Catimor. J. Thus. arabica conditioning the various traits of quality (which are well conserved in all the above hybrids) (Narasimhaswamy.. 2000). 2003) and a recently developed hybrid of Catimor x (Congensis x Robusta) (Srinivasan et al. This inference gains support from reports on the beverage quality of Icatu hybrids of Brazil (Fazuoli et al. Preliminary results obtained from the amplification experiments on the DNA of Sln. P. 1977. Considering the basic interspecific hybrid nature of C. arabica and the dual modes of inheritance for single loci observed in the tetraploid interspecific hybrids of C. natural selection played a key role in the quality improvement of Indian coffee selections.8 and Sln. it is plausible to infer that natural selection favours the genes of C. Foregoing discussion provides a deep insight into the genetic and cytogenetic phenomena underlying the evolution of Robusta – Arabica hybrids of coffee. The four selections of Robusta – Arabica hybrids are derived from diverse parents but possess similar quality. They also manifest high resistance to leaf rust. Bertrand. Conversion of genes was reported in the interspecific hybrids of Coffea (Ky et al. a new strategy combining the cytogenetic results and molecular markers is expected to result in greater efficiency of the coffee breeding programme. B. Thus. Lashermes.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era happen? Available evidence indicates that inheritance of genes in Arabica does not always conform to the simple Mendelian order. F. 4). arabica Mendelian inheritance was recorded (Krug and Carvalho. A. The insight gained is of great practical utility in identifying the particular generation that can be exploited commercially. RAPD Markers in Advanced Generations It is hypothesized that in advanced generations all characters and the genes conferring them are well stabilized and hence... Sarchimor and Colombia (Bertrand et al. This study also revealed that Indian Robusta – Arabica hybrids could be potential sources of new rust resistance genes.. These observations appear to confirm the hypothesis.. Appl.B. 335-358. arabica. G. USA). 1973.S. Jorgensen. 345 p. 2000. A. Sao Paulo (Brazil): Instituto Agronomico de Campinas. Evaluation of Coffea liberica x Coffea eugenioides and its progenies for yield. A.. A. 107: 387394. Charrier.P. Barre. Science 268: 686-691. Carvalh.. A. Broteria Genetica. et Br. Englewood Cliffs. p. 1992. caracters morfologicos dos haploides. Adv. Palma. Utilisation des ressources genetiques du genre Coffea pour l’amelioration des cafeiers cultives. Jayarama. Qualidade de bebida do café Icatu.. J. 156 p. 72-77. Genet. London (UK) and New York (USA): Elsevier Applied Science. Oxford (UK): Blackwell Scientific. Abidjan (Ivory Coast).. Monaco. N. 1977. L. Noirot. A.. p. Appl. 1951. Kushalappa. Akaffou. Darlington CD. USA): CRC Press. Coffee Rust: Epidemiology. Genet. A. B. Guyot.A. The Genetics of Coffea. 28 November – 3 December 1977. P. Luarn. J. Coffee (Vol. A. Circular # 23.S. 118: 53-65. Srinivasan. Genet. M.J.K. C. editors. Agricultural Genetics. S.. Dawson. 2 e 3 de derivados de Hibrido de Timor. Chulaki. 1962. Macrae R. Reddy. 73 Eskes. Interspecific genetic . M. Carvalho... Boca Raton (Florida. New Jersey (USA): Prentice-Hall. Kammacher. Kammacher. Cosuppression. In: Kushalappa AC. Principles and Methods in Coffee Plant Breeding: Coffea canephora Pierre. Lorieux. 10-13. Louarn.C. 1995. Noirot.G. Hamon. The Evolution of Genetic Systems. 4: 128-158. London (UK): Cambridge University Press. 151 p. J. 1964. F. 36: 165-172.. Grassias. Charrier.A. Eskes AB. Fazuoli. S. Bragantia. An Introduction to the Cytogenetics of Polyploids.L. Prakash. CRC Press.167-197. Consideracoes gerais sobre o Hibrido de Timor. 1988. Proceedings of PLACROSYM XV. In: Clarke RJ. P. Anthony... Inheritance of caffeine and heteroside in an interspecific cross between a cultivated coffee species Coffea liberica var. Mysore (India): Indian Society for Plantation Crops.. p. A. Resistance and Management.S... B. editors. Mishra.. Café Cacao The 19: 177-190. 96: 306-311. J. 20 p. Charrier. Observations sur la conjugaison chromosomique de Coffea arabica L. XIII (LXXX): 185-194. 1998. dewevrei and a wild species caffeine free C. Bertrand. Theor.IV) Agronomy. S. Ram. S.. leaf rust tolerance and quality. December 2002. P. P. P.. dos clones tipo dos grupos 1. A.C.. A. A.. C. 2002. Boca Raton (Florida. L. Bragantia 12: 201-212. Trouslot. M. A.171-292. Euphytica. 2003. S. Factores geneticos que condicionam a resistencia as racas de Hemileia vastatrix Berk.. M. Hamon.W. M.. Vinod Kumar PK. In: Sreedharan K. Barre. Theor. Ganesh.C.B.. 1952. Jagadeesan. Eskes. Akaffou. J. R. pseudoz anguebariae. Lashermes.. M.. A. D... Ahmed. Coffee Rust: Epidemiology. A..J. editors. 1989. BM..S. 1946. Flower color patterns and Metastable gene expression states. Berthaud J.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era markers. Resistance and Management.. Bettencourt. p.. Teixeira.A. Bettencourt. In: Proceedings of VIII International Scientific Colloquium on Coffee.. Ky CL. 95 p. Lopes. P. 1975. Taxonomia de Coffea arabica L. Carvalho. Association Scientifique Internationale du Café. 1977. Resistance. Krug. Impact of the Coffea canephora gene introgression on beverage quality of C. Brewbaker. 1989. . Plantn. L. Couturon. Paczek. A. Organoleptic properties of espresso coffee as influenced by coffee botanical variety. Trouslot. S. 1971. 1995. Heredity.. Phyto pathology 13: 49-70. Ram. Trouslot.F. 1996. R.1995. editors.r. 1999. C.L.S. Pandey A. A method for the isolation and amplification of coffee DNA with random octamer and decamer primers.795: Its origin and performance – A study. Single locus inheritance in the allotetraploid Coffea arabica L. Inc.S. Coffee: Botany. F. Biochemistry and Production of Beans and Beverage Westport (Connecticut. Crops. J. A. 347-353. 27:125-130.C. Bettencourt. World Coffee Trade. Crops. A. A. Coffee genetics and quality. 2006. I. Bangalore (India): 10-14 October 2004. C. segregation distortion and genetic conversion in coffee (Coffea sp. Races of the pathogen and resistance to coffee rust. Association Scientifique Internationale du Café. Rodrigues.L. Indian Coffee 35: 371-372. A. Willson KC. p. A. Origin and genetic diversity of Coffea arabica L.S. Ram.. D. Ganesh. Rijo. V. Lashermes. Kyoto City (Japan): Association Scientifique Internationale du Café..J.. 29: 10-15. 32 (Suppl. . In: Sera T. p. Kluwer Academic Publishers. Srinivasan. 9 –14 April 1995. M. Kyoto City (Japan): Association Scientifique Internationale du Café. based on DNA molecular markers. Roche. Ram. Rato. Roussos S. (Electronic Publication).J. Rodrigues. Narasimhaswamy. p. Ram.S. CR. H. In : Proceedings of XVI International Scientific 74 Colloquim on Coffee.584588. In: Proceedings of XX International Scientific Colloquium on Coffee.548556.S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era linkage map.L. (in preparation). 1995.A.528-536.C. In: Clifford MN. and interspecific hybrid C.. Petracco. Reddy. Ram. J.251-283. A. Theor.). Indian Coffee 67: (9):9-11.. P. A. Euphytica. Combes.S. J. Coffee primary processing in Kenya and Tanzania. V. Anthony. Arabica selection S. editors. 2004..G.S..C. 1960. Coffee Biotechnology and Quality.P. 1985. In : Proceedings of XVI International Scientific Colloquim on Coffee. Indian Coffee 24:197-204. C.): 5-11. S.. 9 – 14 April 1995.J. canephora.. 87: 59-64. Genetic diversity for RAPD markers between cultivated and wild accessions of Coffea arabica.A Compilospecies: Implications for Breeding. 2000.795 Arabica and Quality. New physiologic races of Hemileia vastatrix. Varzea. 2001. Charrier. 2000. In: Proceedings of XV International Scientific Colloquium on Coffee. A. A. M. P. M.C.. D. Kyoto City (Japan): Association Scientifique Internationale du Café.. Cros.. 101: 669-676. J. Marshall..S. M. p. Jr. Sreenath. Dordrecht (The Netherlands). 1993. P. C. Plantn. A. Rev. Breeding for rust resistance in coffee: The gene pyramid model. J. Annu. R. 1975.S. 2004. New dimensions in understanding inheritance of coffee rust resistance: A Mendelian perspective. 9 –14 April 1995. Godinho.. J. USA): Avi Publishing Co. Ram. R. P. Genet. Narasimhaswamy.L. Combes. Genetic basis of rust resistance in Arabica coffee. Combes. arabica x C. Crops. Soccol. p. Coffea arabica L. Ligenioides – A source of new genes for Arabica coffee breeding. 2003.. Charrier..E. Ram . Plantn.. Trouslot. Charrier.. 91: 81-85. Appl. Palma. In : Proceedings of XVI International Scientific Colloquim on Coffee. P. P... Lashermes. Lashermes.M. Recent advances on coffee leaf rust. Jr. Ram. N..J. 1985. Ram. C. Pereira. p. Sreenivasan.D. M. D.. Kumar. M. A.. Kubelik. A. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. S.. Tetraploid interspecific hybrids in coffee breeding in India. Central Coffee Research Institute. Ram. Breeding for disease and pest resistance and improved quality in coffee. Devasia J. Proceedings of International Symposium on Coffee.). Ph. Report on the International Collaborative Project “Pathology and Improvement of Coffee (Coffea arabica) for the Main Diseases”. 24 p. 1997.R. Association Scientifique Internationale du Café. Association Scientifique Internationale du Café. C. Raghuramulu Y.S. Smith. T. D. Processes of Organic Evolution (2nd Ed.J.G. Rafalski. USA): Avi Publishing Co.. Montpellier (France) 6-11 June 1993. 1993. Stebbins. 2004. Sakiyama. Myth or possibility. p. Srinivasan.F. Prakash. Walyaro. Englewood Cliffs (New Jersey.J. Robusta like coffee plants with arabica like coffee quality.. Inc. N. 119 p.J. 1990. Coffee: Botany. p. Association Scientifique Internationale du Café. Association Scientifique Internationale du Café.S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Montpellier (France).V. Prakash. A.A. 1994. USA): Prentice-Hall..V.S. editors.. 226-233. Search for new sources of resistance to coffee leaf rust.. K. G. 1971. Bangalore (India). Central Coffee Research Institute (India). editors. Westport (Connecticut. I. A.S. Biochemistry and Production of Beans and Beverage.S. (Electronic Publication). 10-14 October 2004. 1983.S. 18: 6531-6535. In: Proceedings of XX International Scientific Colloquium on Coffee... R. Guerra-Guimares. 193 p.A. Wageningen (The Netherlands): Agricultural University of Wageningen. L. 75 . In: Proceedings of XV International Scientific Colloquium on Coffee. J. Tingey. Considerations in breeding for improved yield and quality in arabica coffee (Coffea arabica L. J. Marques. Silva. Thesis.S.S.. Willson KC. M. 318321.C. 179-193. Nucleic Acids Res.L..K. Sreenivasan. Schuster. A. Teixeira-Cabral...V. L. Nairobi (Kenya).. Rodrigues. A.. Rocheta..391-404. D.).. Williams. M. Single locus inheritance and partial linkage map of Coffea arabica L. p.S. A history of coffee. Varzea . V. 20-25 July 1997. In: Clifford MN. 2004. In: Prakash NS.A. Walyaro.S. Amaravenmathy. 1-12. In: Proceedings of XVII International Scientific Colloquium on Coffee. N. 2000. Livak. Zambolim. p. Crop Breeding and Applied Biotechnology 4: 416-421. 795) Sln.8 1999 FAQ — FAQ + FAQ-FAQ+ Good Years of Quality Testing 2000 2001 FAQ Sl. 6 Semi-erect Sln. 3 (S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1.8 Sln.795) Horizontal to Semi-erect drooping Broad Lanceolate Acuminate 150-200mm 68-90mm Bronze 7-10mm Triangular Deep Red 240 days 900 60.50 10.25 87.Orange Red Red Red 240 days 240 days 1100 960 65.00 92. Quality of Robusta – Arabica Hybrids Selections Sln.50 90. 5B Semi-erect to Horizontal to drooping drooping Linear Lanceolate Acuminate 110-180mm 55-75mm Green 7-10mm Traingular Red 260 days 1020 30. Rust Resistance Patterns in Robusta – Arabica Hybrids Selection Sln.00 Broad Lanceolate Acuminate 126-190mm 63-85mm Light Bronze 5-8mm Ovate Sln.6 Sln.5B Sln.00 Susceptible (%) 18. 5A Sln.00 69.5B Sln.00 95.5A Sln.795) Resistant (%) 81.00 Lanceolate Acuminate 135-200mm 62-78mm Bronze 7-12mm Triangular Orange Red 240 days 975 75.5A Sln.00 Broad Lanceolate Acuminate 125-220mm 67-79mm Light Bronze 7-13mm Triangular Deltate Orange Red .00 Table 3.Below FAQ 76 . 8 Sln.3 (S.6 Sln.00 8.00 Table 2.Below FAQ-FAQ FAQ+-Good FAQ+ as Special Coffee + FAQ-FAQ FAQ+-Good FAQ FAQ+ FAQ-Good Sl.00 5. Dinstinctive Characters of Robusta-Arabica Hybrids of Coffee Character Angle of Branch insertion Leaf shape Leaf apex Leaf length Leaf width Young leaf colour Petiole length Stipule shape Fruit colour Fruit ripening Yield (kg/ha) A-grade beans (%) Sln.75 12.3 (S. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Checkerboard 1. RAPD profiles of Hibrido de Timor (Sln.8) A (Resistant) and R (Susceptible) types generated by the primers OPF-15 (5’ CCAGTACTCC 3’) and OPF-04 (5’ GGTGATCAGG 3’). Lanes 1& 2: HDT – A (OPF-15) Lanes 3 & 4: HDT – R (OPF-15) Lanes 6 & 7: HDT – R (OPF-04) Lanes 8 & 9: HDT – A (OPF-04) Lane 5 : PCR products of HDT (Open pollinated plant) (OPF-15) Lane M .Marker Hind III-Eco R1 double digested Lambda DNA 77 .Segregation of Chromosome genotype in Robusta–Arabica Hybrids A A/R R/A R A AA A/R-A R/A-A RA A/R A-A/R A/R-A/R R/A-A/R R-A/R R/A A-R/A A/R-R/A R/A-R/A R-R/A R AR A/R-R R/A-R RR 1 2 3 4 5 6 7 8 9 M Fig.2. Research on cassava is going on in a few Universties as well including TNAU. This information. S. R. were assembled at Central Tuber crops Research Institute. where improved varieties developed at research centres are grown under irrigated conditions. This high yield in India is mostly a contribution of Tamil Nadu. In India. polyploidy 1. As such. cyanogen content. under the University.S. Introduction Cassava (Manihot esculenta Crantz) is a popular tuber crop grown in the tropical belt of Asia. Amylose content. M. development of improved varieties. Palaniswami. it is grown as a subsidiary food crop.R. Trivandrum 695017 breeding etc. good quality and tolerance were evaluated in replicated trials and the selections are undergoing on-farm trials in Kerala and Tamil Nadu. keeping quality and tolerance to Cassava Mosaic Disease (CMD). These accessions were evaluated for economic characters like tuber yield and quality parameters like starch content. Amylopectin and AP/Am ratio which determine the suitability of starch for specific industrial use. CMD tolerant accessions are being utilized in the hybridization program. They were also evaluated for unconventional characters like leaf yield and also quality of starch. Ravindran. Coimbatore. pet animal feed and also silviculture. Still.S. The Central Tuber Crops Research Institure. by introduction of varieties from other cassava growing areas and improving them by intercrossing. India can boast of the highest productivity in the world. Research on cassava started in Kerala about 50 years ago. Nair. Moorthy. The germplasm was also screened for morphological characters. mutation breeding. was analysed.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era EVALUATION AND UTILIZATION OF BIODIVERSITY IN CASSAVA (MANIHOT ESCULENTA CRANTZ) Santha V. Trivandrum was established in 1963 and it is the main centre for tuber crops research. In Kerala. V. drought etc and genetic stocks were identified for each character. Pillai1. Trivandrum. 26t/ha. At present. white fly. C. Details are presented in the paper. more than 1600 accessions of Cassava. against the global average of 10 t/ha. Africa and South America. along with that on economic characters and passport data were utilized to arrive at a core collection of cassava germplasm. Kerala. Ravi and S. it is mostly grown in the Southern region. cooking quality. Tamil Nadu and parts of Andhra Pradesh. The quality of starch namely. at different times is a major 78 . suited to different needs. combining high yield. whereas in Tamil Nadu and Andhra Pradesh. evaluation and utilization of the biodiversity available in the crop is the basic requirement in any plant breeding program. consisting of both indigenous and exotic accessions. the land races of cassava are being analysed for microsatellite markers to study the molecular variability and diversity available in the population and also for DNA fingerprinting of farmer’s varieties. it forms the raw material for starch and sago industry. Sree Lekha ABSTRACT Collection. biochemical markers (Isozyme) as well as molecular markers (DNA-RAPD) in tune with international standards for identification of varieties and isolation of duplicates.N. Central Tuber Crops Research Institute. Some of the promising accessions. especially. Microsatellite markers are also being utilized to identify varieties resistant to CMD and white fly. Cassava leaf is increasingly being used in cattle feed. 80). The Central Tuber Crops Research Institute is maintaining more than 1600 accessions of cassava collected from different countries. The symptom free accessions (75) were evaluated for yield and quality and subjected to genetic analysis. biochemical (Isozyme) and molecular (DNARAPD). Germplasm is the raw material for the purpose. Two of the selected accessions are undergoing on-farm trials in 6 districts of Kerala and the performance is good. high tuber yield or high starch content (Table 3).60). At present H-165. Tuber yield above 2. is cultivated in these areas. The subset was screened for special characters like tolerance to drought . white fly. Weight of shoot per plant was found to have the highest correlation with yield (0. available at the Institute formed the material for the study. followed by cyanogen content (66.74). starch above 30% and cyanogen below 20 ppm were kept as yardsticks. Four months drought period existed during the season. suited for both edible purpose as well as for stach extraction were developed. for further use in the breeding program. keeping quality etc and the best performers were identified. These selections were found to be better suited to the hilly regions of the state. Sixty three CMD free accessions were screened for drought tolerance under rain fed condition in upland. along with that on genetic stocks and geographical representation. . Six promising lines identified from the subset were evaluated in replicated plot trial. Now cassava cultivation is spreading to dry areas as well. Phenotypic coefficient of variation was the highest for weight of shoot (69. screened for the incidence of CMD were found to the symptom free. was also characterized based on different markers namely. They were screened for presence or absence of Cassava Mosaic Disease (CMD) symptom and a subset of about 75 symptom free accessions were evaluated for yield.55 kg/plant. to identify and isolate duplicates and eliminate them from the field in due course. This 79 information. Trivandrum in this direction are presented in the paper. quality and other special characters. Results and Discussion Seventy five out of the 1300 accessions. starch and low cyanogen were identified for use in recombination breeding [Table 2]. was used to identify a tentative core collection of the germplasm. high Leaf Area Index (LAI). Some of the selections are undergoing on-farm trial in Tamil Nadu. a number of improved varieties. At present the germplasm is also evaluated for non-conventional characters and for varying purposes and more sophisticated tools are employed for evaluation and utilization of germplasm. Materials and Methods The germplasm collection of cassava. Over the years. followed by number of tubers per plant (0. The best promising accessions were evaluated on replicated trial for 3 consecutive years and selected ones are undergoing on-farm trials both in Kerala and Tamil Nadu. The germplasm. especially in Andhra Pradesh and there is a need for drought tolerant varieties. The varieties H-226 and H-165 developed at the Institute occupy sizeable area in the starch factory areas. a short duration variety. which escape drought. numbering about 1600. The subset was also screened for nonconventional characters like leaf yield and quality of starch. The accessions showing any of the yield / quality component in high level were selected as genetic stocks for that character.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era item of research. Genetic stocks for yield. morphological. Some of the items of work going on at CTCRI. Nineteen accessions showed very high drought tolerance based on one or other criteria namely.74) and tuber yield per plant (54.85) (Table 1). 1014. 1994. October 28-November 1. The data on genetic stocks.145-151. The proportion of these components of starch determines the suitability of starch for specific purposes. duplicates and geographical representation were utilized to arrive at a core collection of the germplasm consisting of 15% of the accessions (Table 6). Amylopectin content and Ap/Am ratio. Cassava leaf is found to be suited for pet animal feed.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Twenty one CMD free accessions were evaluated for the incidence of white fly. C. 80 About 90 accessions were found to be duplicate. 2002. CIAT. Jimenez. 2002. representing the variability is essential when the number of collection become very large (Santha and Nair. and accession no E-109 showed the highest Ap/ Am ratio of 4 (Table 5). 2002). Accession no E-34 gave the highest leaf yield of 1. Pillai Nair. Granados. 1995). C. The accession no E108 gave the highest Amylose content of 30 %. This information was used to identify duplicate accessions in the germplasm as per international standards (Ocampo et al. But the number of varieties with keeping quality is very low. Six CMD free accessions with branching character were screened for leaf yield. A. Indonesia: August 22-26..Paper presented in the Second International Scientific Meeting of the Cassava Biotechnology Network held at Bogor. The role of cassava hay as animal feed. Ocampo. The germplasm was also characterized based on morphological markers as well as biochemical (Iszoyme) and molecular markers (DNA / RAPD). Varieties having resistance to white fly infestation may be able to evade CMD and hence this approach. This is very important to safe guard the Plant Breeders’ Right as well as the Farmers’ Right in the new IPR (Intellectual Property Right) regime.68 kg per plant. Hershey. Satrch with high Amylose content is best suited for textiles whereas that with high Ap/Am ratio is best suited for fish feed. Angel.. Identification of a smaller subset.. P. 2002. Iglesias. REFERENCES Metha Wanapat. R. DNA fingerprinting to confirm possible genetic duplicates in cassava germplasm . Tubers were cut into 2 pieces and kept under net. this work was initiated to create a database.. by virtue of its binding property. Nov. Bangkok. V. Columbia. Two accessions were found to have very low incidence (Table 4). CIAT. P. in addition to cattle feed and is in great demand (Metha Wanapat. Twelve accessions were screened for quality of starch namely Amylose content. Germplasm management in cassava with special emphasis on core collection Paper presented in the National Vegetable Conference held at Bangalore. 2002. Two accessions could be kept up to 5 days without black spot. Cali. F. Santha.21. 2002). R. And hence. C. About 50 CMD free accessions were evaluated for keeping quality of tuber. Jaramillo. G.. Researches are going on to use more powerful molecular markers like SSR and ISSR to screen the varieties for resistance to CMD and white fly. Fast perishability is a very big limitation in cassava and we had observed that variability for this character exists. E.and also to study the variability and diversity available in the local collection.. CMD is a serious disease in cassava and it is spread through white fly.. . DNA/RAPD analysis was also used for DNA fingerprinting of released varieties as well as that of elite breeding lines. 1995. Paper presented in Seventh Asian Cassava Research Workshop. 7 15. Tuber Yield and Starch content High LAI (>7.60** 0.4 35. Accessions having tolerance to drought.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1.75).01 0.3 25.00 0.7 42. 1 2 3 4 5 6 7 8 9 10 Characters Tuber yield /plant (kg) No of Tubers One Tuber (kg) Length of Tuber Girth of Tuber Starch percent Cyanogen (ppm) Height of plant (cm) No of branches Weight of shoot (kg) Mean 1.1 5.8 66.4 110.80) . C(15) Y(2.no E 393 E 329 E 88 E 111 E 480 E 127 E 135 Desirable characters Y (2. Variability and correlation of 10 characters Sl.22 0.C(5.C(42) Y (2.04 0. based on LAI. C (10) Y(1.7 PCV% 54. No. C(40) Y (2.9 49. C (33) Y (1.66).15).60). C(34) Y (1. S(35).05 0. S (31) .8 4. S(36) .6 28.20) 1 2 3 4 5 6 7 8 9 E -165 E -282 E-328 I -192 I -82 High Tuber yield (>7. S(33).8 45.25).8 0.0 kg/plant) E-272 E-273 E-274 E-354 I-82 High starch content (>25%) E-33 E-39 E-430 E-440 E-459 E-500 E-534 I-82 I-120 81 .7 2.08 0.S–Starch percent.66).5 37.08 0.03 (-) 0. S (35). List of elite genotypes selected Sl.1 19.80** ** Significance at 1% level of probability Table2 . S (34) .3 69.No 1 2 3 4 5 6 7 Acc.8 28.7 Correlation with yield 1.0 18.4) Y-Yield/plant(kg). S (29).C-Cynogen content ppm Table 3. 40 2.9 26.7 23.4 21.1 27. White fly incidence in CMD symptom free accessions Sl.80 2.21 3.4 31.30 2.1 32. No.9 26.30 2.70 2.No 1 2 3 4 5 6 7 8 9 10 11 12 Genotype I-101 I-102 I-103 I-104 I-105 I-107 I-108 I-109 I-110 I-111 I-112 I-113 Starch Extractability 30.0 19.2 18.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 4.2 24.9 24. 1 2 3 4 5 6 7 8 9 Criteria High yield (>5kg/plant ) High starch(>33%) Low cyanogens(<10ppm) High carotene (>450ppm) CMD Symptoms free Released varieties Local popular varieties Geographic representatives Wild relatives Total 82 No.1 30.1 73.4 73.50 2.0 AP/Am Ratio 3.0 28.5 27.3 29.1 74.3 77.0 76.76 2.7 22.80 2.70 Table 6.8 26.2 73.7 70. of accessions 30 25 25 40 75 15 20 2 8 240 .07 3. Tentative core collection Sl.8 26.5 27. Starch quality in promising accessions Sl.30 4.0 71.9 70.0 80.9 72. 1 2 3 4 5 6 7 8 9 10 Variety E-144 E-152 E-97 E138 I-775 E-347 E-39 E-96 E-301 E-142 Nymph 8 5 32 68 61 22 24 13 42 35 pupae 0 0 27 3 7 17 0 6 3 0 Female 0 1 2 3 6 3 1 0 0 3 Male 0 0 0 0 1 0 0 0 0 0 Whitefly 8 6 61 74 75 42 25 19 45 38 Table 5.0 Amylose (%) Amylopectin(%) 23. No.8 29.4 19.3 76.7 24. Ram. Subbaiah ABSTRACT One thousand and fifty six rice accessions were characterized for 21 agro-morphological characters at directorate of rice research and also screened for major biotic stresses at 20 hot-spot locations across the country. The present results indicated that ample genetic variability exists for improving the yield potential as well as resistance to major diseases and insect pests in modern high yielding varieties. C.C 14335 and I.00 g to a maximum of 3. T. L. V.1 per cent). A.4 per cent). Some of the promising accessions with resistance / tolerance to major biotic stresses are IC 115330 and IC 115481 for BPH. N. Single plant yield of less than 15 g was recorded by 35 per cent of accessions Almost 50 per cent of accessions registered a single plant yield of 20-25 g. 41 percent exhibited intermediate vigour while 4. Rajendranagar. RTD (1.C 114507 to leaf blast and bacterial blight . plant hoppers (3. mid early (45 percent).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era AGRO . IC 113990. Shobha Rani.MORPHOLOGICAL CHARACTERIZATION AND EVALUATION OF RICE GERMPLASM FOR MAJOR BIOTIC STRESS TOLERANCE Subba Rao. Pasalu. Hyderabad 500030 83 .7 per cent germplasm showed tolerance / resistance for major biotic stresses. BLB (1. Of the 1056 accessions screened. Seed weight of 100 grains ranged from a minimum of 1. 18 percent possessed purple colour and 12 percent showed light purple colour while another 12 percent accessions exhibited purple lines.V. 29 percent accessions showed effective tillers upto10.3 per cent). while 86 per cent of the accessions showed 2-3 g and the remaining 8 per cent accessions recorded more than 3 g. Reddy. V.C 114653 and IC 114787 to bacterial blight and tungro. Less than 2 g of 100-grain weight was recorded by 5.medium(34 percent) and late(12 percent).. IC 115957 for stem borer. 57 percent of accessions recorded high number of effective tillers per plant (upto15). S. which includes blast (2 per cent). IC 114725 to blast and to BLB IC 114335 and IC 115738. IC 115905 and IC 114847 to GM. Promising germplasm with more than 25 g of single plant yield coupled with resistance to BPH are IC 114419 and IC 114430. IC 113999. while the remaining 14 percent of accessions exhibited less than 10 effective tillers. IC 114322 and IC 115924 for gall midge. C Viraktmath and S.7 per cent of accessions. Days to 50 percent flowering ranged from 74 days to 112 days and based on the flowering duration total germplasm accessions can be grouped into early (9 percent). Directorate of Rice Research.48 g. C. I. Agro-morphological characterization of 1056 accessions revealed that 54 percent of them showed very good early plant vigour. S Rama Prasad. I. B.9 per cent) and stem borer (4.0 per cent).5 percent accessions were found to exhibit poor plant vigour. Ravindra Babu. 14. The study revealed that 57 percent accessions exhibited green basal leaf sheath colour. GM (2. I. Relatively higher contribution towards genetic divergence was noticed from quality characters. agronomic characters and quality parameters will be useful not only to increase the yield level in this important fibre crop but also helps to classify and select the most desirable ones for each of the target environments. when Mahalanobis D2 technique was applied. Introduction Cotton. semicompact and compact genotypes in terms of crop growth. 20 and 5 clusters respectively. leaf area index and earliness characters. garments. The studies on suitability of particular ideotype to a particular environment have not been taken up by breeders 1. scholar. cotton is grown in three agro climatic zones .S. big bolls and longer duration. and T. Such studies will be useful to pinpoint and fix the most efficient genotype for a particular location. despite stiff competition from the man-made synthetic fibres. processing and trade in cotton goods provide employment to about 60 million people in our country. The grouping of genotypes supported that the visual evaluation was in good agreement with the character evaluation of robust and compact types but not in the case of the intermediate semicompact types. Tamil Nadu Agricultural University. physiological efficiency. The genotypes in the above three groups came under 13. Five randomly selected plants were tag-labelled for recording Ph. the export of raw cotton. either in tetraploid or diploid species. It assumes a place of pride in Indian economy. the crop attains a luxuriant growth with large leaves.northern zone where cotton is raised entirely under irrigation.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era CHARACTERIZATION OF COTTON (GOSSYPIUM HIRSUTUM L. S1. open plant type. 66 semicompact and 17 compact genotypes. textile. Material and Methods One fifty genetic accessions of Gossypium hirsutum were raised in an experimental layout in Randomized Block Design (RBD) with two replications during kharif 2002-03. cotton seed cake. as cotton production. Further. known as “the King of fibres”. central and south zones where it is predominantly a rainfed crop. Centre for Plant Breeding and Genetics. 2. Under rainfed cultivation a compact plant type with short internodes. Coimbatore 84 . Further the characterization of the robust. Tamil Nadu Agricultural University. continues to be the predominant fibre in the Indian textile scene. In India.Raveendran2 ABSTRACT An investigation was taken up to compare the genetic variability of 150 cotton (Gossypium hirsutum) genotypes after grouping them visually into three different growth habits. physiological and yield parameters for attaining the highest biological efficiency and fibre yield. The genotypes were sown in six meter long ridges spaced 75 cm apart and with an interplant distance of 30cm so as to accommodate 20 plants in each row. Centre for Plant Breeding and Genetics. Therefore. low leaf area and high harvest index is preferred to get the best yield besides withstanding the drought in different phases of crop growth. The evaluation led to the grouping of accessions into 67 robust.) GENOTYPES AND EVALUATION OF GENETIC DIVERGENCE Preetha. However. yarn. oil and other byproducts earn valuable foreign exchange. A specific plant type has acclimatized in a particular tract and is able to interact well with the weather parameters and perform well in respect of yield.D. Coimbatore Director. under irrigated conditions. the present study was attempted to define the robust and compact plant types and a group intermediate between them using the agronomic. Based on this. For each of the characters. less number of sympodias. internode length (IL). longer fruiting branches. high lint index.plant height (PH). more number of bolls and high yield. medium span length . seed cotton yield (SCY).specific leaf weight (SLW). canopy temperature and transpiration rate. By visual evaluation the accessions were grouped into robust. number of flowers per plant (NOF). with longer petioles. For analyzing the biochemical constituents youngest. number of seeds per locule (NOSL). A compact plant type can be characterized by short plant with intermediate petiole length. 2 and 3. fully unfold.. leaf size.days to first boll bursting (DFBB). ginning outturn (GOT).micronaire (MIC). boll weight (BW). number of flower bearing nodes in sympodia (NFBN). disease free leaves were collected from the sample plants and pooled to form the composite sample. seed index (SI).5%SL).canopy temperature (CT). Results and Disscussion The genotypes were visually evaluated based 85 on their stature.diffusive resistance (DR) and transpiration rate (TR). length of sympodia (LOS). Based on all the above characters robust. lint Index (LI). specific leaf weight. it occupies more ground area with more number of leaves and consequently high total leaf area but relatively low specific leaf area.uniformity ratio (UR). the robust plant types can be characterized as tall. yield and quality traits viz.root length (RL) and biochemical traits like chlorophyll content (CC).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era observations. low. Observations were recorded on morphological. more number of sympodia. number of monopodia per plant (NOM). semicompact and compact plant types were characterized and they were analysed for their genetic divergence. days to first flowering (DFF). high span length and medium bundle strength. Sampling was done at flowering stage.nitrate reductase activity (NRA) were also recorded. intermediate and high range was fixed based on the expression (minimum and maximum values) and they were assigned with scores 1. Compact genotypes had superior fiber quality like high bundle strength. They also had high lint index. physiological and yield traits a grade index was formulated for the three plant types which would be highly useful to visualize robust.5 per cent span length (2. Moreover. In order to characterize the three groups in terms of agronomic. low number of bolls and low seed cotton yield. number of locules (NOL). Then the grade index was calculated as follows: grade1 x number of accessions in grade 1 (A1) + grade2 x number of accessions in grade 2 (A2) + grade3 x number of accessions in grade 3 (A3) Grade index = Total number of accessions (A1 + A2 + A3) The grade indexes for different characters are presented in the Table 1.total phenols (TP). Apart from this physiological parameters namely leaf area per plant (LA).bundle strength (BS).soluble protein (SP).photosynthetically active radiations (PAR). days to fifty percent boll bursting (DFFBB). semicompact and compact types. short fruiting branches. semicompact and compact plant types. Average of data recorded on each character from these five plants represented the mean of that replication. early flowering. 2.elongation per cent (EL). For determining the physiological traits fourth leaf from the top was used. number of bolls per plant (NOB). branching habit. robust. specific leaf area (SLA). internode length and grouped into three distinct morphological groups viz. number of sympodia per plant (NOS). late flowering. petiole length (PL). semicompact and compact. number of sympodia. All the accessions had registered low range for length of sympodia. lint index. length of sympodia. For the characters petiole length. More than fifty per cent of the robust genotypes had high total leaf area. micronaire. ginning outturn. cluster VII (4 genotypes). root length. seed cotton yield. cluster XIII.5 per cent span length. All the other clusters had only one genotype. transpiration rate. canopy temperature. high frequency of genotypes were in the minimum range of expression for the characters number of flower bearing nodes. The genetic divergence in the genotypes was estimated by subjecting them to distance analysis. phenol content. the 66 semicompact genotypes came under twenty clusters. The 17 compact genotypes which were subjected to diversity analysis using 12 characters after stepwise elimination of less important characters were grouped into five clusters. soluble proteins and nitrate reductase activity. The percentage of genotypes of each group under different range for different characters was calculated. However. Compact genotypes had high leaf soluble proteins and chlorophyll contents. A groupwise analysis of genetic divergence indicated that the sixty seven robust genotypes could be grouped into 13 clusters. Cluster III. the agreement in respect of semicompact types was not as much as in the other two groups because for some characters it is towards robust type and for others it is towards compact type and so further detailed study is needed. high leaf temperature and low transpiration rate. and nitrate reductase activity. ginning outturn. photosynthetically active radiations. The distribution of genotypes under the different levels of expression indicated that in general. uniformity ratio. number of bolls. elongation length. 2. using Mahalanobis D2 statistics. number of sympodia. canopy temperature and phenol content. It was observed that cluster I was the largest including 54 genotypes followed by cluster XIII comprising of two genotypes. Cluster I comprised the maximum number of 14 genotypes followed by cluster II (13 genotypes) cluster III (11 genotypes). number of flower bearing nodes. High frequency of plants fell under the high range for bundle strength and nitrate reductase activity. In a similar way. boll weight. photosynthetically active radiations. specific leaf area. bundle strength. XV and XX (2 genotypes). seed cotton yield. uniformity ratio. leaf area. internode length. robust genotypes can serve as donors for earliness. Intermediate range was predominant for the character petiole length. All the other clusters had only one genotype. soluble protein and nitrate reductase activity while compact genotypes can be considered for improving bundle strength. cluster IX and XII (3 genotypes). diffusive resistance. 2. IV and V had only one genotype each.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and seed index. days to fifty per cent boll bursting. days to first boll bursting. elongation percentage. In robust group. Compact types occupy less ground area with low total leaf area but they had relatively high specific leaf area. Cluster I comprised the maximum number of nine genotypes followed by cluster II (5 genotypes). The semicompact types were intermediate for all the characters. chlorophyll ‘a’ and oil content.5 per cent span length. internode length. Semicompact genotypes fell under the 86 intermediate range for most of the characters. The above grouping supported that visual evaluation was in good agreement with the character evaluation in respect of robust and compact types as most of the genotypes came under a single cluster. diffusive resistance and chlorophyll ‘a’. high frequency of genotypes fell in the intermediate range. The clustering pattern of the . Compact group had majority of genotypes under low expression for the characters plant height. number of bolls. specific leaf weight. micronaire. Stardel. These results indicate that Stoneville and Acale-1577-D can be crossed with 47-2 to get desirable recombinants. specific leaf weight and 2. length of sympodia. cluster XIII and cluster XVI can be used in crossing programme while. internode and petiole . uniformity ratio.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era genotypes from various geographical regions into different clusters was random indicating the absence of parallelism between genetic grouping and diversity. It would be 87 a good effort to hybridize the genotype 920 with genotypes of cluster XIII to get better segregants showing good performance for yield components. specific leaf area. number of sympodia and number of bolls. However. and study of segregating progenies of the hybrids synthesized within each group will give a better result on further use of parents. Manimaran and Raveendran (2001) and Gururajan and Manickam (2002). Cluster XIII recorded highest mean value for the characters ginning outturn. selection of parents for hybridization programmes should be based on genetic rather than the geographical diversity. In semicompact group. Murthy and Arunachalam (1966) also suggested that the forces of genetic drift and natural selection under diverse environmental conditions within a country cause considerable diversity than geographic isolation. Inter cluster distances were greater than intra cluster distances. a comparison between the two methods of parental selection based on geographical and genetic diversity. Earlier studies of Kowsalya and Raveendran (1996) and Gururajan and Manickam (2002) also indicated more are less similar observations. Cluster XIII (Stoneville and Acala-1577-D) recorded the highest mean value for specific leaf area (table 5). revealing considerable amount of genetic diversity among genotypes studied. Cluster II showed high expression for bundle strength whereas cluster III registered high sympodial number and specific leaf weight (table 7). BP-52NC-62. earliness and fibre quality. cluster VIII (Buri147) will serve as a good source for yield improvement. The cluster IV (199F) recording high mean values for seed cotton yield.51(P)) and cluster XIII (Gregg and 5143) followed by cluster XII (920) and cluster XIII. micronaire value and elongation percentage. Cluster IX (Empire-16 WR) also can be involved in hybridization programme to improve the seed cotton yield. Cluster XIV (47-2) showed high expression for plant height. to combine high physiological efficiency and good fibre quality characters. Brazos and Deltapine) and cluster III (72/1). plant height. In case of robust genotypes (Table 2) the minimum inter cluster distance was recorded between the genotypes S-1622 and 560 whereas highest distance was noticed between cluster II(Able . Cluster XII recorded high mean values for number of bolls.5 per cent span length. So. the lowest inter cluster distance recorded was between clusters IV and XI and highest distance was recorded between clusters XIII and XIV followed by clusters XIII and XVI and cluster VI and XVIII(table 4). number of bolls. Cluster II showed low mean values for all the characters. micronaire and elongation percentage (Table 3). Thus. Further cluster XVI (Nectariless) which had recorded second highest distance with cluster XIII showed desirable expression for quality traits viz. To produce hybrids with wide genetic base and with pronounced hybrid vigour this genotype can be crossed with any other highly divergent cluster having desirable genotypes. The compact genotypes (table 6) registered highest inter cluster divergence between cluster II (Kapland. Use of genetically distant genotypes as parents to get most promising hybrids or segregants have been suggested by Kowsalya and Raveendran (1996). This may be due to frequent exchange of breeding material between the breeders and common objectives of selection in different locations. Relationship between genetic diversity and heterosis in cotton.). S. Raveendran. Indian Soc.S. 2002.Genet. Murthy. care should be taken to identify segregants for good yield performance from the limited variability available in the material under study. K.. B.Madras Agric. K. Genetic variability and D2 analysis in upland cotton. REFERENCES Amudha.. (1997). The nature of genetic divergence in relation to breeding systemin crop plants. R. D. 1996. Cotton Improv. Crop Res. The data pertaining to robust and semicompact genotypes (table 8) have also shown that quality characters were found to be good indices for selection of genotypes in the present study. IndianJ.J. Krishnadoss.S.S. 27: 77-83. Genetic divergence in Egyptian cotton (Gossypium barbadenseL.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era length showed high divergence with cluster II.R. Crop Res.. V. R. 12: 36-42. 1966. 26(A):188-198 88 . Similar reports have been given by Amudha et al. 1997. Raveendran.. 2001. 22 : 72-77.. T. T. Manimaran. Arunachalam.84:334337 Gururajan. Manickam. So 199F can be hybridized with the genotypes of cluster II to improve the seed cotton yield. J.N. Kowsalya. T.. Genetic diversity in coloured linted cotton varieties. Raveendran. As the yield and yield components failed to exhibit high degree of influence on genetic divergence.. 91 2.30 2.20 1.30 1.60 1.10 2.62 2.88 2.59 2.29 2.87 2.88 1.90 89 .47 1.79 1.00 1.41 1.42 2.85 2.27 2.80 1.40 2.65 1.36 2.24 2.43 1.83 1.55 1.25 1.30 2.40 2.94 2.30 2.31 1.09 1.47 1.94 2.07 1.65 2.79 2.16 1.35 1.80 2.10 2.24 2.50 2.25 2.97 2.78 1.90 1.80 1.00 2.90 2.72 2.20 2.00 1.47 1.33 2.20 2.12 1.67 1.5% Span length Uniformity ratio Micronaire Bundle strength Elongation percentage Total leaf area Specific leaf area Specific leaf weight Leaf area index Root length Canopy temperature Photosynthetically active radiations Transpiration rate Diffusive resistance Phenol content Soluble proteins Chlorophyll ‘a’ Chlorophyll ‘b’ Nitrate reductase activity Oil content Grade index for plant type Robust 2.95 1.20 2.30 1. Grade index for the three plant types Characters Plant height Petiole length Internode length Number of sympodia Length of sympodium Number of flowering bearing nodes Days to first flowering Days to first boll bursting Number of bolls Boll weight Seed cotton yield Seed index Lint index Ginning outturn 2.59 2.03 1.12 2.10 1.79 2.70 1.24 1.34 2.59 1.00 1.20 1.29 2.37 2.10 1.88 1.94 2.04 1.70 1.41 1.24 2.35 1.80 Compact 1.88 2.12 2.82 1.50 1.20 2.36 1.30 1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table1.39 2.40 2.88 1.60 Semi compact 1.94 1.97 1.10 2.91 1.24 2. 24) 9.76 (115.54 (133.60) 9.96 (194.00 (0.00 (0.22 (125.81 (139.20) 0.44 (109.23 (104.03) 10.18) 10.87) 12.17) 11.58 (134.64 (113.93) 11.73) 9.35 (128.26 (126.79) 8.79 (139.34 (152.98) 0.00 (99.16 (147.20 (104.04) 9.07 (170.00 (0.35) 0.85) 13.23) 10.08 (146.01 (100.45 (155.91 (98.68 (75.62 (92.27 (68.00) XI XI 10.17 (124.44 (180.00 (121.78 (116.53 (90.46) 11.00) X X 10.46) 0.92 (142.75 (162.91) 11.83) 0.47 (131.27) 9.00) 90 VII VII 10.09 (82.05) 12.53 (110.01 (100.60 (134.94 (98.08) 11.40) 8.24 (126.00) XIII XIII 12.00) III III 10.00 (0.00) VIII VIII 10.65 (160.83) 12.14 (124.83) 10.66 (113.18) 10.37) 12.58) 12.70 (114.20) 14.16 (103.00 (0.01 (100.04) 9.42) 11.33 (106.90) 12.94) 12.86) 10.58) 12.65) 11.54) 11.00) Second National Plant Breeding Congress 2006 V V 10.97 (120.23) 11.80) 11.93 (98.15 (147.53) 11.00) Plant Breeding in Post Genomics Era XII XII 11.21 (149.12 (146.48) 11.09) 12.00 (0.00 (0.06 (145.73) 12.75) 9.68) II II 10.97) 10.18 (173.60) 0.39) 10.00) IX IX 10.00) IV IV 10.04) 0.22 (85.00 (0.00 (0.93 (142.42 (88.09 (122.00 (0.43 (208.Table 2.76) 12.76) 9.54) 10.02) 11.84 (164.03 (121.04 (144.71) 11.23) 8.42 (130.01) 11.24 (104.11 (102.28) 11.86) 11.71 (137.05) 0.07) 12.77) 13.19 (67.67) 13.59) 11.04) 11.56) 12.81 (139.16 (147.17) 0.26) 9.91) 0.91 (98.00) VI VI 10.79 (163.93 (119.65 (93.21) 10.89) 12.37 (152.00 (0. Inter and intra cluster distances (D) (D2 values in brackets) in robust genotypes Clusters I I 9.72) 12.51 (90.70) 9.26) 10.00) .29) 9.43) 11.99 (120.29 (150.00 (0.79 (163.36) 0.85 (140.24 (104.39 (88.64) 12.08) 13.11) 0. 00 4.00 149.96 47.00 61.79 19.27 12.90 25.00 X 130.50 55.50 .00 4.50 58.45 20.20 27.50 4.67 2.34 24.21 47.76 1.00 125.70 19.70 43.00 3.50 12.24 5.00 2.54 13.05 11.00 2.58 XI 116.90 7.50 165.80 43.50 60.73 38.73 6.30 8.82 5.80 19.50 137.10 4.32 48.65 14.00 5.84 17.85 18.70 46.00 23.74 2.92 38.04 4.51 8.06 114.33 30.00 4.80 20.00 32.26 44.50 7.40 31.50 4.10 7.50 4.42 IV 121.67 130.17 2.50 37.00 4.50 64.59 10.58 141.80 50.78 21.54 39.77 7.28 12.96 120.60 27.59 11.23 7.45 31.32 10.57 3.51 47.00 2.40 5.15 33.50 33.85 5.95 27.00 4.20 6.57 55.00 17.10 19.47 1.50 130.40 6.58 8.36 8.83 91 VIII 98.07 35.61 5.75 15.07 6.50 140.92 5.00 5.85 120.38 4.83 1.47 4.10 24.58 37.50 1.41 22.70 7.85 8.5% SL MIC BS (g/tex) EL PH (cm) IL (cm) PL (cm) NOS LOS NFB (cm) N I 59.70 18.34 8.00 1.00 2.18 5.09 37.50 2.50 9.20 30.50 2.30 7.70 5.50 III 141.56 4.27 3.59 6.14 19.24 6.89 133.50 41.99 5.34 1.44 12.84 140.Table 3.50 21.84 6.30 39.55 136.00 18.75 12.40 16.00 172.02 48.43 147.05 4.00 149.37 51.00 19.00 7.35 16.52 32.40 23.50 149.94 2.00 3.72 135.33 140.00 142.50 XII 111.00 169.30 5.78 40.00 52.50 62.62 32.55 5.32 124.70 25.64 38.26 111.86 43.50 8.13 9.00 3.50 143.92 116.48 9.28 18.50 11.49 8.43 8.17 33.40 10.00 VII 126.15 36.81 18.00 4.17 5.64 38.00 IX 120.28 8.67 16.33 141.30 121.78 3.50 141.21 123.00 61.98 4.09 35.50 3.00 47.87 26.50 167.06 38.52 58.68 37.21 15.20 47.50 1.15 5.30 106.05 27.37 8.75 5.08 9.20 II 136.78 8.25 1.00 3.84 131.00 3.20 11.50 53.95 5.92 2.44 1.20 17.80 21.10 8.66 14.00 149.70 48.70 12.79 53.00 3.14 7.83 137.60 2.10 30.00 4.00 LI UR GOT (%) SLW LA LAI (mg/cm²) (cm²/g) RL (cm) 2.34 137.15 36.42 Plant Breeding in Post Genomics Era XIII 89.45 12.60 13.48 3.70 30.95 4.00 62.33 Second National Plant Breeding Congress 2006 V 124.00 12.15 37.00 136.34 1.37 15.45 16.39 8.50 43.25 19.53 3.50 4.72 26.94 5.98 48.70 20.92 7.34 1.60 52.00 4.90 13.00 7. Mean values of 13 clusters for different characters in robust genotypes DFF NOB DFBB DFFBB BW (g) SI SCY (g/ plant) 51.00 3.22 19.00 3.09 10.33 2.59 10.36 38.03 10.50 39.00 58.02 8.30 25.50 138.00 VI 102.00 53.03 9.50 1.33 1.50 41.10 46.0 93.71 3.90 108.60 49.70 26.10 47.10 23.21 3.50 60.55 19.6 8. 46) (70.45 (41.44) 7.20 8.04 10.16 (83.66 (136.35 (40.97 (99.44) (116.51 (56.71) 10.30) 10.12 10.33 (69.07 9.25) (93.69 (93.83) (71.99) 0.74) (79.76 8.57) (69.00 (0.99 (63.38 (70.61 8.33 (54.92) 7.70) (60.52 8.47) II 6.38) 9.03 7.00) 6.70 (94.07 7.19) (58.00) 0.75 10.60) 0.95 (63.07 (101.60 (57.21) 8.07 8.69) (101.54) (53.64) 8.05) (51. Inter and intra cluster distances (D) (D2 values in brackets) in semi compact genotype III 7.99) 9.38) 8.84) 7.79 (66.05 (81.20) (81.01 9.63) (61.43) (81.39) 9.59 (43.17) 0.78) 8.27) 9.36) 7.95 (35.46) 8.40) 7.79 7.87) 8.53) 9.00 (0.00) 11.66 7.42 (55.53) (76.83 9.66) (77.47 10.35 7.04 (64.28) III Second National Plant Breeding Congress 2006 IV V 92 VI VII VIII IX Plant Breeding in Post Genomics Era X XI .61 (57.44 7.57 (43.54 (90.49) (102.Table 4.09) (50.34 (107.00 (0.06) 9.10) 6.16 6.18 (84.00) (76.00) 7.35) (50.30 (55.00) 0.62) 0.07 (65.61) (42.40 7.95) 7.44 (55.51 10.10) 7.00 (0.91 (43.51) (57.34) 6.37) (101.47) 7.92) 9.40) (86.00) IV V VI VII VIII IX X XI Clusters I II I 6.45) (49.81 7.18) 10.59 8.37) 7.00 (0.74) 5.00 (0.21 (51.09 9.46 (89.62 7.71 (59.05 (100.64) (110.38 9. 36) 11.86) 12.23 (38.76) 9.81 (77.34 (87.23 (104.06 (64.71 (75.62 (58.65) 8.26) 6.18) 9.38 (70.18 (84.23) 6.37) 11.98) 10.18) 7.61) 7.64 (74.36) 8.19) 10.20 (125.98 (80.83) 9.78 (77.89) XVI XVI 7.61) 9.02) 8.94) 10.94 (63.70) 11.25 (105.47 (71.51 (110.99 (35.08) 10.78) 9.68 (114.12) 9.24 (38.73 (59.62) 8.00) XVII XVII 8.68) 8.06 (122.26 (39.34 (106.47 (109.36 (54.02) 10.10) 8.01) 11.40) 7.29 (86.33) 10.44 (108.63) 0.27 (85.26 (68.40 (129.33 (40.03) 8.58) 5.22) 6.72) 11.31 (127.62 (92.93 (98.98 (80.51) 8.51 (110.33 (106.54 (133.28 (86. Clusters I II III IV V VI Second National Plant Breeding Congress 2006 VII VIII IX X 93 XI XII XII 9.81) 8.22 (104.14) 8.01 (81.80 (116.37 (70.57) 8.88) 11.55) 10.68) 0.13) 9.86 (78.05) 9.45 (71.50 (90.75 (76.45) 10.00 (0.39) 8.61 (134.48) 11.16 (83.92) 8.59 (57.77) 12.00) XIX XIX 8.39) 6.93 (98.78 (116.10) 10.00 (0.53) 8.54 (91.97 (120.93 (79.62) 9.97) 11.78 (77.67 (44.99) 9.59 (91.86 (117.58 (91.24 (104.41) 9.27) 12.00) Plant Breeding in Post Genomics Era XVIII XVIII 9.39) 0.89 (118.54 (91.33) 9.51 (72.87) 9.80) 8.64) 8.00) .57 (111.42 (70.56) 10.92) 10.13) 10.33 (106.06) 7.93 (79.55) 7.51 (132.31) 10.87) 10.36 (129.60) 9.44 (55.70) 7.99) 8.78) 8.80) 9.51) 7.75 (95.03) 10.97 (143.13 (123.05) 10.01) 7.90 (79.07) 11.00 (0.03) 10.05) 8.90) 7.00) 9.92) 10.30 (68.85) 8.11 (65.86) 7.70 (114.39) 11.55) 9.85) 0.49) 8.10) 8.22) 9. contd.76 (76.78) 8.07) 8.85) 9.95) 11.36 (54.12) 7.36) 9.58 (73.65) 6.Table 4.42 (88.06 (122.17) 11.82) 9.66 (113.80 (96.12) 11.72 (94.91 (118.15) 11.29) 10.10 (65.32) 6.87 (97.54) 10.59 (91.71 (114.08) 10.70) 10.86) 0.95 (80.44 (108.64 (58.37 (87.92) 10.89 (78.29 (105.32 (69.59 (92.71 (114.65) 8.96 (80.95) 11.55) 8.06 (122.02 (100.12 (102.67) 10.01) 8.70) 0.69) 8.24) 10.06) 11.83 (96.08 (122.22) 8.15) 8.87 (118.39 (108.44) XIII XIII 10.10) 8.00) XV XV 9.12 (123.95 (80.94 (63.00 (81.00 (0.88) XIV XIV 8.59) 10.67 (75.00 (0.46 (155.47) 9.63) 9.99 (143.29) 10.04 (145.24) 10.99 (99.70) 10..47) 11.68 (136.94 (80.96) 9.10 (50.32 (106.00 (0.97 (63.83 (61.62) 11.52 (156.14) 9.81 (77.41 (41.28 (86.14) 9.83 (96.69) 9.26) 8.88 (62.67 (136..74 (94.08 (101.27 (86.74 (76.45) 10.67) 9.00) XX XX 7.43 (88.13 (66.53 (132. 09 1.43 8.00 134.39 128.58 2.50 4.50 15.00 2.13 3.42 12.60 37.00 13.95 1.80 35.05 7.43 1.85 122.52 10.49 1.75 26.43 8.80 30.00 30.89 11.80 5.60 25.00 149.66 66.59 9.10 6.25 IX 97.02 3.38 8.00 67.66 6.75 8.73 4.00 65.75 1.50 149.15 3.93 101.17 156.57 8.34 28.88 156.20 4.5% SL MIC BS (g/tex) PH (cm) IL (cm) PL (cm) NOS I 103.00 3.99 12.92 6.70 43.14 40.67 14.06 31.20 20.50 8.50 139.07 33.38 XVIII 151.25 18.90 47.92 8.17 69.39 X 107.83 62.00 VI 104.09 4.24 35.60 47.87 3.65 26.20 18.54 11.41 4.04 5.50 7.48 7.96 8.70 LI UR 27.00 68.90 19.23 6.56 153.50 169.00 27.62 22.56 1.80 47.65 34.78 8.25 67.98 5.67 3.20 18.50 134.00 3.60 29.20 44.44 32.55 4.69 2.92 4.77 9.48 2.23 3.92 35.10 28.15 27.56 24.40 11.67 140.92 24.70 43.50 16.44 103.00 26.84 16.70 6.62 47.30 26.92 4.00 4.00 3.50 24.30 19.00 69.34 26.69 9.46 54.90 5.87 68.76 116.04 8.28 4.83 4.03 34.00 3.58 26.92 Plant Breeding in Post Genomics Era XX 121.33 25.67 8.93 4.51 6.00 170.04 9.47 3.00 VII 102.20 50.34 140.00 3.20 26.50 11.10 6.59 26.09 XII 95.61 4.47 3.00 159.60 46.30 4.00 3.97 30.26 1.46 64.83 XVII 118.59 15.73 25.00 3.26 15.87 44.15 11.60 5.37 Second National Plant Breeding Congress 2006 VIII 126.92 23.05 18.42 4.89 II 98.10 37.86 7.00 III 104.48 25.25 7.50 167.31 2.16 7.10 20.67 59.00 46.53 1.50 3.00 4.00 16.83 XIV 160.73 2.00 26.27 2.83 47.55 11.67 150.86 3.29 1.52 36.50 140.70 25.00 3.50 4.00 3.03 122.00 24.96 37.72 4.00 17.90 21.74 10.90 23.38 24.39 8.97 5.67 2.50 15.10 19.25 94 XI 77.62 39.29 2.00 3.33 69.00 4.51 18.91 47.43 66.20 3.53 8.66 39.55 24.50 3.86 137.55 37.03 12.17 167.83 22.42 63.48 1.61 2.07 4.49 1.51 47.30 5.00 4.71 9.00 3.08 24.56 1.43 4.83 6.84 4.97 16.40 4.64 2.50 1.88 3.10 6.50 156.17 142.00 10.00 4.75 25.50 4.60 23.68 21.00 10.Table 5.27 10.67 9.04 8.30 48.75 24.90 NFB N NOB DFBB DFFBB BW (g) GOT SLW (%) (mg/ cm²) LA LAI (cm²/g) RL (cm) 2.50 13.54 68.46 4.08 29.75 IV 101.86 109.50 14.95 40.69 9.37 49.72 8.63 13.12 7.6695.00 141.11 3.00 3.00 69.00 3.54 136.37 67.56 27.50 160.96 3.96 42.09 4.39 13.68 33.67 130.50 28.10 19.25 8.83 3.05 122.89 23.96 1.51 5.65 35.21 11.90 6.6192.59104.00 4.00 11.15 37.52 10.43 5.35 24.90 32.55 20.00 7.67 19.00 4.00 3.80 47.38 9.33 66.38 121.84 155.80 45.17 11.08 27.89 56.33 46.41 48.97 17.35 112.82 8.80 26.10 5.40 45.17 1.42 142.00 137.50 143.08 8.17 17.20 2.35 XIII 63.22 4.55 7.67 .05 17.29 XVI 124.75 13.11 9.50 12.00 29.83 4.76 9.26 1.07 33.18 9.15 60.00 17.20 6.00 19.42 21.50 3.70 26.70 36.60 25.27 71.97 11.42 5.03 122.27 2.27 13.05 127.12 47.65 4.51 18.97 7.33 164.27 5.00 161.40 5.00 143.30 27.20 25.75 3.80 21.81 67.00 166.40 51.97 36.00 5.21 1.92 18.09 130.64 1.51 137.50 3.65 7.84 154.57 9.86 2.88 160.63 144.95 4.15 14.40 3.00 2. Mean values of 20 clusters for different characters in semi compact genotypes LOS (cm) DFF SI SCY (g/ plant) EL 45.88 20.00 4.50 166.41 2.95 8.76 31.53 19.85 24.11 4.75 2.81 113.35 29.24 49.24 3.65 18.60 23.93 3.52 5.33 68.15 1.28 15.08 9.00 26.50 140.87 11.17 10.75 14.33 68.17 V 101.96 115.81 52.93 111.92 1.74 18.00 XIX 111.10 20.54 3.60 21.00 28.20 20.54 8.10 26.10 12.93 6.00 18.30 121.36 5.08 11.08 5.03 45.36 136.00 26.65 148.85 23.38 9.68 40.52 8.50 68.83 XV 122.65 33.58 9. 49 (42.30) 7.88 (97.70) 7.93 (79.03) 9.67) 9.60) IV 0.16) 7.00 (0. Intra and Inter cluster distances (D) (D2 values in brackets) in compact genotypes Clusters 5.41 (70.95) 33.91 (62.00 (0.49 (56.84 (61.00) 6.73 (45.00) .00 (0.07) 6.00) 8.91 (34.39 (111.33) 8.45) I II III IV V I Second National Plant Breeding Congress 2006 II 5.Table 6.77 (33.65) III 95 0.67) Plant Breeding in Post Genomics Era V 0.63 (92. 46 19.83 11.30 III 85.16 15.95 4.58 12.20 30.49 8.40 19.38 21.61 137.14 Second National Plant Breeding Congress 2006 II 87. Mean values of five clusters for different characters in compact genotypes Character IL (cm) NOB 11.71 18.16 9.90 18.91 15.67 7.56 14.59 25.49 9.38 2.29 7.89 3.00 120.36 16.46 25.29 3.04 129.21 20.03 68.66 21.34 12.53 8.57 IV 97.30 24.50 10.19 LAI 3.83 11.64 PL NOS (cm) LOS (cm) 2.05 110.85 1.37 11.20 3.31 11.83 9.08 4.00 20.50 96 V 83.83 17.15 Plant Breeding in Post Genomics Era .05 0.15 10.Table 7.01 25.00 14.71 117.5% SL BS(g/ tex) Cluster PH (cm) SCY (g/ plant) SLW SLA (mg/ (cm²/g) cm²) I 87.66 7.90 28.61 19.87 32.50 40. semicompact and compact genotypes Character Contribution (percent) Robust Semicompact 0.79 18.74 100 Compact 1.69 100 2.37 22.76 38.57 22.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 8. Percentage contribution of different characters to total genetic divergence in robust.08 2.09 2.52 28.83 3.38 4.70 5.04 0.08 1.21 72.33 44.99 7.41 0.09 0.14 17.47 - Plant height Days to first boll bursting Days to fifty percent boll bursting Seed cotton yield Bundle strength Micronaire Uniformity ratio Elongation length Leaf area index Specific leaf area Specific leaf weight Total 1.28 100 97 .96 0. 30 – 0. Hence it is concluded that in the early generation of selection family selection followed by individual selection will improve the efficiency of selection and such families with wider variation should be repeated as proven crosses. A wide range of variability among seedlings ranging from wild cane (Saccharum spontaneum) to noble cane (S. officinarum) is observed among the intervarietal progenies.22.82 kg (CoS 932 X BO 91) with the family mean value of 1. Excess water stress is one of major limiting factor of productivity in North Central Zone. Very limited studies on inheritance of agronomically important traits have been made in sugarcane due to its complex genetic architecture and non- Senior Scientist (Plant Breeding). For single cane weight.35) and the lowest variance was recorded by Co 1158 X CoJ 64 (7. sugarcane breeders have always look for clones with water logging tolerance as an ancillary character in addition to cane yield.05).37) for sucrose % at 11th month.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era INTERFAMILY VARIATION AND FAMILY SELECTION IN INTERVARIETAL CROSSES IN SUGARCANE UNDER EXCESS WATER STRESS CONDITION Govindaraj.89 (CoG 93076 X Co 93009) with overall family mean value of 14. For single cane weight.33 (CoS 88216 X Co 87272) to 14. the highest range was recorded by UP 22 X Co 775 (2. sucrose content in juice. Interfamily differences for economic traits and the importance of family selection is discussed. Sucrose % in juice at 8th month ranged from 12. Coimbatore – 7 ..75 kg). The highest variance component for sucrose was exhibited by CoG 93076 X Co 93009 (24.52 (UP 22 X Co 775) to 10. P ABSTRACT In sugarcane breeding programmes two methods of selection viz.09 and two families exceeded this mean value. High variation was observed among the families for all the characters.74 to 10. Even though targeted breeding programes have not been initiated so far.70 kg) and the lowest range was observed with CoS 90269 X CoS 510 (1. the range was from 1. The 98 frequency of seedlings having desirable agronomical traits depend upon the parental combination used. The main effect of excess water stress is not only yield but also sugar recovery due to accumulations of low sucrose in juice at harvest. In order to study the family variation under excess water stress conditions.41kg (UP 22 X Co 775) to 0. Sugarcane Breeding Institute. the family CoS 88216 X Co 87272 had the narrow range (11. Introduction Modern sugarcane varieties are the complex hybrids involving different species of Saccharum. While the range for the family CoG 93076 X Co 93009 was the highest (13.30 to 7. Range for each characters also varied among the families.15 – 0. family selection and individual progeny selection are followed. The families with the highest variance resulted in the progenies with maximum per se values for CCS % at 11th month and single cane weight the important quality and yield contributing trait respectively. Results clearly indicated that variation was observed for both quality and yield traits among the families.30 (CoSe 92423 X CoS 510) with overall mean value of 11.92). red rot resistance and tolerant to top borer in the regular breeding programme. Variance estimate also differed among the crosses. Family selection even though laborious gives much dividend compared to individual selection. genetic control of the trait and selection efficiency. Family mean values for CCS % at 11th month ranged from 11.11 kg. two hundred progenies developed from 8 families of sugarcane intervarietal crosses were planted clonally in single row plot of 6m and were evaluated for their performance to 4 quality parameters recorded in 8th and 11th months and 3 yield contributing traits. . Co 775.. The univariate cross prediction method described by Chang and Milligan (1992) requires extensive data collection. Co 99 1158. CoS 90269 and seven pollen parents viz. Co 93009. CoJ 64. Since it is very difficult to manage waterlogging stress through either agronomical or physiological manipulations. Sugarcane breeder needs a method. Crosses were effected in the lantern method and fluff were sown to raise segregating progenies. CCS % = (1. Eastern Uttar Pradesh and certain pockets of Orissa. Data on juice brix% and sucrose% were estimated at 8th and 11th month and CCS % and Purity % were worked out. UP 22. In North central zone of India. In the present study variability for economic traits and their relationship to selection efficiency is discussed. In the individual selection the assumption of gene x environmental variance is considered as negligible hence the genotype selected in the first generation is fixed in the later clonal generations.292 x Brix %). Simple estimate of co efficient of variation. Under severe waterlogging. Materials and method Eight different parental combinations were constituted with seven pistil parents viz. variance and range were estimated. In addition.022 x Sucrose %) – (0. However another school of thought argues that in the absence of any statistical procedure adapted. the main constraints are the early drought and late water logging. it is essential to breed varieties suitable to waterlogging condition and the breeders should know appropriate breeding procedures to be adapted for this purpose. which is very simple to estimate but reliable and repeatable. CoS 932. BO 91. Co 87272 and CoS 510 among them UP 22. CoG 93076. 1991) and a univariate cross prediction method (Chang and Milligan. The factors for superior performance (FSP) method is easy to use. the probability of exceeding target value (PROB) (Milligan and Legendre. Hence. growth of the crop is reduced and sugar recovery also affected. Water logging is mainly due to excess rain during Aug-Sep and poor drainage in many parts of Bihar. cane length (CL) and cane girth (CG) were recorded in all the progenies and mean. . the families with high mean performance is repeated (proven crosses) to produce larger families to recover more elite segregants. (1986). the families with high mean performance is selected and further individual selection is within the selected families only. Co 62198. single cane weight (SCW). BO 91 and Co 87272 were tolerant to water logging. Two hundred progenies developed from these 8 families of sugarcane intervarietal crosses were planted clonally in single row plot of 6m and were evaluated. improved standard of living and demand for sugar necessitated to expand the cultivation to the sub optimal areas like water logging. CoS 88216. mean and range can also bring out required information to understand the genetic potential of the segregating families.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era fulfillment of certain assumption or design. CoS 92423.. Results and discussion Genetic potential of sugarcane families to produce superior seedlings (elite genotypes) can be estimated through several methods which include factors for superior performance (FSP) by Arceneaux et al. development of water logging tolerant varieties is the most appropriate solution and incorporation of water logging tolerance is an integral part of varietal development for these areas. Purity % = Sucrose % x 100/ Brix % Three important yield-contributing traits viz. Increasing population. but a FSP value can only be obtained after the original seedlings have been carried through all stages of selections. 1992). CoS 92423. Sugarcane breeders worldwide differ in their opinion on selection in the early segregating generation ie individual performance or family per se. the family CoS 88216 X Co 87272 had the narrow range (11.28 to 1. Variability was observed among the families for mean values for all the characters except for cane length. in a random population Balasundaram and Bhagyalakshmi (1978) reported the range for stalk thickness (1. 2001).37) for sucrose % at 11th month.. Many families recorded lower variance (<10) and the existence of low variability for quality characters indicates the difficulty in improving quality traits by selection. The progeny assessment trials also have been routinely used to identify the best families and select superior clones from these families (Cox et al. stalk diameter has the highest heritability and is the most reliable character for selection (Bakshi Ram et al. 1968). cane girth : 2.35) and the lowest variance was recorded by Co 1158 X CoJ 64 (7. For single cane weight..74 to 10.70 kg) and the lowest range was observed with CoS 90269 X CoS 510 (1. 1963).28 to 3.05). Stalk height and stalk weight were strongly correlated with cane yield both in dry and wet zone and can be considered as ideal trait for selection in these stress conditions (Bissessur et al. Under water and salt stress conditions. cane length : 200 cm.1 cm) single stalk weight (0.89 (CoG 93076 X Co 93009) with over all family mean value of 14. Number of selection for various traits in relation to mean and variance are given in table 2. the range was from 1.41kg (UP 22 X Co 775) to 0. Tai and Miller (1989) reported that selection rate between early stages of selection was highly correlated. The highest variance component for sucrose at 11th month was exhibited by CoG 93076 X Co 93009 (24.30 (CoSe 92423 X CoS 510) with over all mean value of 11.30 to 7. In the present study.14 kg) resulted in high selection (12) in UP 22 x Co 775 and the same trend reflected in CoSe 92423 x CoS 510. Family mean values for CCS % at 11th month ranged from 11.11 kg.30 to 0.12) and high mean value (1. While the range for the family CoG 93076 X Co 93009 was the highest (13. A high selection percentage indicates that the population had a high mean and/or variance for some or all desirable characters.14 to 16.0 kg.5 cm and sucrose % 16.33 (CoS 88216 X Co 87272) to 14.6 to 190.75 kg)..90).21 cm). variance estimate differed among the crosses for yield and quality characters (Table 1). Selections were made for each character based on selection cutoff value (single cane weight :1. For single cane weight. For single cane weight. A progeny test with small number of individuals is routinely used to estimate the selection rate or the evaluation of proven crosses in sugarcane breeding programmes in Australia (Hogarth. the highest range was recorded by UP 22 X Co 775 (2.15 to 0. 1992) in the progenies. Sucrose % at 11th month. more number of selections were obtained in UP 22 x .09 and two families exceeded this mean value.92) and the same trend was observed for CCS %. The estimates are less in either variance or mean number of selections are also less as evidenced from other two crosses.52 kg) and sucrose % (11. 1987). 2000).22.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era The selection percentage is a measure of the overall merit of the cross. stalk length ( 112.0). In accordance with these results. 2001 and Brown et al. The large amount of variability in single cane weight is in agreement with the observation of Wright (1956) on the existence of large amount of variability in hybrid population of asexually 100 propagated out breeding species.82 kg (CoS 932 X BO 91) with the family mean value of 1. cane girth and purity %. Sucrose % in juice at 8th month ranged from 12. Range for all characters also varied among the families. which represents all the aspects of desirability considered in these stages and the weight given to each component character by the selector (Walker. high variance (10.52 (UP 22 X Co 775) to 10. Hence all these three easily measurable traits were recorded as yield contributing traits (Malavia and Ramani. Verma et al. 2000). Like wise. the highest significant positive correlation was observed between sucrose % and brix % at 8th (0.. Earlier studies indicated that stalk 101 weight had low positive correlation with sucrose percent (Balasundaram and Bhagyalakshmi... 1971). selecting the best individual from the best families would be a stable performer. Summary Improvement of sugarcane seedling population by eliminating inferior progenies should increase the frequency of elite clones and increase the selection efficiency. In the earlier studies also the association between stalks weight and stalk diameter (Madhavi et al.. Hence it is evident that selection based on family per se followed by variance will yield more selections than selection based on individual performance to harness additive genetic variance. 2002) were found to be positive and significant.. Ortiz and Caballero. For cane girth CoG 93076 x Co 93009 and UP 22 x Co 775 produced more number of selectable sergeants due to variance and high mean respectively. Kang et al. water stress (Bakshi Ram et al. Simultaneous selection for different economical traits is possible only when the components have positive association. A number of studies have examined relationships among components of cane and sugar yield with genetically different populations and varying sample size. The families UP 22 x Co 775 and CoSe 92423 x CoS 510 recorded more family mean values whereas CoG 93076 x Co 93009 registered more variance to produce more selections.3508) at 11th month signifying the possibility of early election for quality traits in early generation. Instead of selecting the best progeny from the populations raised. 1988) and stalk weight and stalk length (Madavi. Bakshi Ram and Hemaprabha 1991 and Bakshi Ram et al. Results clearly indicated that variation was observed for both quality and yield traits among the families.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Co 775 and CoSe 92423 x CoS 510 due to high mean and variance respectively. 1983. The objective of this study is to evaluate the different families for their efficiency in giving higher selectable segregants and suggest that the families with higher frequency of selectable segregant would be designated as proven cross and the same can be repeated for raising larger families and effect selections.. The families with the highest variance resulted in the progenies with maximum per se values for CCS % at 11th month and single cane weight the important quality and yield contributing trait respectively. The families with high mean value threw more number of selections for yield components. Hence it is concluded that stalk diameter can be regarded as most stable character under different environmental conditions and can be considered for selection in various stress environment (Bakshi Ram et al. 1978. Hogarth.9475) months indicating that brix % which can be estimated easily can be used as indirect selection for sucrose % in larger segregating population (Table 3). 2002. Hence it is concluded that in the early generation of selection family selection followed by individual selection will improve the efficiency of selection and such families with wider variation should be repeated as proven crosses. 2001) and selection ( Bakshi Ram et al. 1989. et al. 1996) which can be also measured in larger population in short time. Under excess water stress condition. 1989. All the three yield contributing traits had positive significant inter correlations among themselves. Tai and Miller.9726) and 11th (0. Hence these two easily observable .. Brix at 8th month had significant positive association with brix % (0. 2001. Relationships among component traits have been found to be affected by different genetic background of populations (Bakshi Ram and Hemaprabha. Single cane weight had significant positive association with cane length and cane girth. 1991)..3575) and sucrose % (0. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era characters cane be used for selection in early generation with the greater emphasis on stalk diameter. For quality traits Brix % had significant positive association with sucrose per cent both in 8th and 11th month hence spindle brix % can be used for selection in early generation. REFERENCES Arceneaux, G.J.F., Van Breemen. and Despradel, J.O. 1986. A new approach in sugarcane breeding: Comparative study of progenies for incidence of superior seedlings. Sugar Cane 0 7-10 Bakshi Ram. and Hemaprabha, G. 1991. Character relationship in cultivar x species progenies in sugarcane. Indian J. Genet. 51: 89-95 Bakshi Ram Sahi, B.K. and Chaudhary, B.S. 2000. Effect of selection stages on relationships between attributes in sugarcane. Sugarcane International 8: 511 Bakshi Ram, Chaudhary, B.S. and Singh, S. 1996. Repeatability of important traits among seedling, ratoon of seedlings and settling stages in three population of sugarcane (Saccharum spp. Hybrids) Indian J. Agric Sci. 66: 546-548 Bakshi Ram, Kumar, S., Sahi, B.K. and Tripathi, B.K. (2001). Traits for selecting elite sugarcane clones under water and salt stress conditions. Proc. IISCT 431-438. Balasundaram, N. and Bhagyalakshmi, K.V. 1978. Variability, heritability and association among yield and yield components in sugarcane. Indian J. Agric. Sci. 48:291295. Bissessur, D., Tiney-Bassett, R.A.E and Lim Shin Chong Lim. 2001. Genetic potential of sugarcane progenies grown in extremely wet and dry environments in Mauritius. Sugarcane International Nov: 5-10 Brown, A.H.D., Daniel, J. and Latter, B.D.H. 102 1968. Quantitative genetics of sugarcane II. Correlation analysis of continuous characters in relation to hybrid sugarcane breeding. Theoretical and Applied Genetics. 38: 1-10 Chang, Y.S. and Milligan, S.B. 1992. Estimating the potential of sugarcane families to produce elite genotypes using univariate cross prediction methods. Theoretical and Applied Genetics. 84: 662-671 Cox, M.C., Hogarth, D.M. and Smith, G.R. 2000. Cane breeding and improvement. In. D.M. Hogarth and Allsopp P.G. (Eds.) Manual of cane growing. Bureau of Sugar Experiment Station, Brisbane, Queensland, Australia pp 91-108 Hogarth, D.M. 1971. Quantitative inheritance studies. II. Correlation and predicted response to selection. Aust. J. Agric. Res. 22: 103-109 Hogarth, D.M. 1987. Genetics of sugarcane. In. Heinz (Editor), Sugarcane improvement through breeding. Elsvier, New York. Pp 255-272 Kang, M.S., Miller, J.D. and Pai, P.Y.P. (1983). Genetic and phenotypic path analysis and heritability in sugarcane breeding. Crop Science, 23: 643-647 Madhavi, D., Reddy, C.R., Reddy, P.M., Reddy G.L.K., Reddy, K.R. and Reddy, K.H.P. 2002. Correlation Studies in sugarcane. Co-operative Sugars. 22: 379-381 Malavia, D. D. and Ramani, V.V 1992. Correlation path analysis of cane yield in sugarcane. Indian Sugars. 4: 19-22 Milligan, S.B. and Legendre, B.L. 1991. Development of a practical method for sugarcane cross appraisal. J. Am. Soc. Sugarcane Tech. 11: 59-68 Ortiz, R. and Caballero A. (1989). Feasibility of using family selection at the sugarcane seedling stage. Cultivos Tropicales, 11: Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 27-33 Tai, P.Y.P. and Miller, J.D. 1989. Family performance in early stages of selection and frequency of superior clones from crosses among canal Point cultivars of sugarcane. J. Am. Soc. Sug. Tech, 9:62-70 Verma, P.S., Dhaka, R.P.S. and Singh, H.N. 1998. Genetic variability and correlation studies in sugarcane. Indian J. Genet. 48: 2132-217 Walker, D.I.T. 1963. Family performance at early selection stages as a guide to the breeding programme. Proc. IISCT 11:469483 Wright, S. 1956. Modes of selection. Am.Nat, 90:5-24 Table 1. Estimates of different parameters for families under water logging conditions at 8th and 11th months Families Para meter Brix % Brix Suc. Suc. % CCS CCS Purity Purity Single Cane CaneGirth % 11th % 8th 11th % 8th % 11th % 8th % 11th Cane length cm 8th month month month month month month month month Weight cm kg 19.02 20.24 16.68 18.80 11.49 13.30 90.07 95.14 2.30 3.20 3.30 13.62 15.46 10.86 13.27 7.12 9.05 79.74 85.83 0.70 1.55 2.00 16.45 18.15 13.99 16.46 9.49 11.52 84.89 90.67 1.41 2.55 2.74 9.94 7.46 14.07 8.45 12.17 6.80 8.71 4.38 10.12 4.91 3.62 20.95 20.75 17.50 18.94 11.78 13.30 91.64 95.25 1.55 3.35 3.70 13.16 13.16 10.66 10.66 7.05 7.05 81.00 81.00 0.30 1.30 1.90 17.27 17.14 14.89 15.60 10.17 10.94 86.09 90.90 1.06 2.41 2.56 19.11 22.02 21.22 24.35 16.82 19.25 9.37 13.11 12.91 10.39 5.93 19.05 20.96 16.44 19.18 11.78 13.48 89.45 93.08 1.20 3.10 2.80 13.16 14.96 10.36 12.78 6.59 8.69 75.62 82.83 0.25 1.20 1.50 16.50 18.15 14.07 15.90 9.71 10.95 85.06 87.54 0.88 2.20 2.27 12.19 11.12 17.30 13.47 14.61 11.23 11.26 8.05 5.17 11.40 4.74 17.88 19.96 15.54 17.58 10.66 12.14 88.83 89.86 1.60 3.00 2.80 14.10 14.28 10.86 12.58 6.98 8.69 77.02 85.20 0.65 2.10 1.80 16.41 17.02 13.81 14.94 9.32 10.30 83.98 87.75 1.19 2.59 2.48 8.16 23.22 14.60 22.82 13.53 16.71 12.96 1.99 11.06 3.21 3.81 16.10 19.66 12.97 17.10 8.55 11.74 81.02 88.05 1.75 2.50 3.30 14.70 17.16 11.30 15.11 7.26 10.37 76.87 86.98 1.05 2.10 2.50 15.50 18.06 12.33 15.77 8.08 10.85 79.48 87.36 1.40 2.27 2.83 3.35 10.69 6.58 8.37 6.29 5.47 6.51 0.42 8.75 1.91 6.12 19.08 20.06 16.44 18.30 11.25 12.85 86.16 91.23 1.15 3.00 2.70 14.70 17.76 11.80 15.54 7.77 10.70 80.27 85.39 0.75 2.10 1.90 17.00 18.94 14.25 16.62 9.99 11.45 83.63 87.71 0.94 2.49 2.33 18.90 4.66 25.34 8.44 27.23 7.98 7.18 7.14 5.04 5.79 5.27 18.88 19.96 16.68 18.06 11.53 12.63 88.35 90.48 1.40 2.80 2.70 14.30 16.36 11.85 14.19 7.94 9.73 82.87 86.06 0.50 1.80 1.90 17.06 18.28 14.52 16.01 9.86 11.03 85.06 87.55 0.82 2.20 2.26 11.47 8.57 13.03 9.46 10.21 7.37 2.58 2.02 13.09 6.48 3.12 19.18 19.06 16.68 17.23 11.45 12.04 86.97 91.43 1.25 2.65 2.80 13.40 15.68 10.41 13.70 6.73 9.42 77.69 86.25 0.70 1.80 2.00 17.39 17.73 14.65 15.73 9.90 10.90 84.00 88.73 0.89 2.27 2.30 20.14 8.74 27.70 7.92 23.17 5.98 10.81 5.10 5.87 3.34 2.48 20.95 20.96 17.50 19.18 11.78 13.48 91.64 95.25 2.30 3.35 3.70 13.16 13.16 10.36 10.66 6.59 7.05 75.62 81.00 0.25 1.20 1.50 16.72 17.87 14.22 15.96 9.70 11.09 84.88 89.24 1.11 2.39 2.50 103 Max Min Mean CV Max CoG Min 93076 X Co 93009 Mean CV CoS Max 92423 X Min Co 62198 Mean CV Max CoSe 92423 X Min CoS 510 Mean CV Max CoS 88216 X Min Co 87272 Mean CV Max CoS 90269 X Min CoS 510 Mean CV Max CoS Min 932 X Mean BO 91 CV Max Co 1158 X Min CoJ 64 Mean CV Over all l Max Min Mean UP 22 X Co 775 Table 2. Number of selections, mean and variance in different families at 11th month Traits 6 5 0 5 2.58 2.47 22.82 1.19 11.06 3.21 3.81 3.40 UP 22 X Co 775 Select Mean Variance ions Single cane 12 1.14 10.12 weight Cane length 5 2.55 4.92 Cane girth 9 2.74 3.62 Sucrose % 6 16.4 8.45 4 2 5 2.41 2.56 15.6 10.39 5.93 24.35 3 0 5 2.20 2.27 15.6 11.4 4.74 13.47 CoG 93076 X Co 93009 Select Mean Variance ions 2 1.06 12.91 CoS 92423 X Co 62198 Selections Mean Variance ions 0 0.88 5.17 CoSe 92423 X CoS 510 Select Mean Variance Second National Plant Breeding Congress 2006 Table 3. hips among yield and quality characters under water logging conditions at 11th month Brix % 11 Sucrose % Sucrose % Purity % 11 Single cane month 8 month 11 month month weight 0.3290* 0.9475** 0.1678 -0.0630 0.0970 -0.0456 0.3391* 0.3290* -0.1620 -0.0091 -0.0644 0.4726** 0.0159 0.1534 0.0412 Cane length 104 Brix % 11 month Sucrose % 8 month Sucrose % 11 month Purity % 11 month Single cane weight Cane length Cane girth Brix %8 month 0.3575* 0.9726** 0.3508* 0.3575* -0.1668 0.0069 -0.0557 0.2202* 0.2000 0.2538* Plant Breeding in Post Genomics Era 0.6951** 0.7761** 0.4213** Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Fig 1. Frequency distribution for Sucrose % at 11 months 25 20 Sucrose % 15 10 5 0 1 3 5 7 9 11 13 15 17 19 21 23 25 Genotypes Family I Family II Family III Family I: UP 22 x Co 775 Family II: CoG 93076 x Co 93009 Family III: CoS 92423 x Co 62198 Fig 2. Frequency distribution for SCW at 11 months 2.5 2 SCW in kg 1.5 1 0.5 0 1 3 5 7 9 11 13 15 17 19 21 23 25 Genotypes Family I Family II Family III 105 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era DEVELOPING HIGH YIELDING RICE VARIETIES FOR KERALA-A NEW APPROACH Chandrasekharan, P ABSTRACT Crosses were done between promising rice accessions from different parts of Kerala during 1996-97, hybrids were identified and subsequent selections continued based on height (80 -120 cm), higher productive tillers, longer panicles and high grain numbers and matta (bold grain and red rice). Those selected were given PC numbers. PC 1 was identified in F6, PC 2 in F7 and both were released in February 2003. Four more short duration varieties have been identified: PC 5 in F9, PC 3, PC 4 and PC 6 in F10. These were evaluated in yield trials in the second crop of 2004-05 and in the first crop 2005-06 and the superiority of their performance was confirmed. PC 3 “Sivam” and PC 6 “Sundaram” are two varieties where genes responsible for high grain number exceeding 400 grains from TKTM have been transferred in full since the latter was the donor for this trait. PC 1 and PC 2 have now spread to about 600 and 500 acres respectively during the last 4 seasons in almost all districts of Kerala. Introduction Thavalakkannan is a tall indica variety and phenotypically very similar to Chenkazhama and both were very popular among Palakkad rice farmers before the introduction of high yielding dwarfs by IRRI, Philippines. Extreme palatability of their rice, the ability of cooked rice to preserve in cold water for 12 hours without losing hardness and taste and their high recovery from paddy after milling (above 60 %) were the welcome traits. Main difference between these two varieties is that Chenkazhama is a week earlier than Thavalakkannan (TK) of 135 days .To ensure maximum plant diversity, TK was collected from a farmer in Thiruvilvamala (TKTM) and Chenkazhama from another in Ottappalam (OTP), in 1995. In the first crop of 1996-97, when TKTM population was studied, it was surprising to observe one plant of height 182 cm, main panicle length of 31 cm and had 430 spikelets (potential grains), two plants had 344 and 327 and others between 188 and 282 spikelets. This population of TKTM represented grain production of a very high order when compared with the grain numbers of IR 36, IR 8, Athira and Matta Thriveni, the dwarfs then in cultivation, their maximum -grain number being Tamil Nadu Agricultural University, Coimbatore 641003 214. Other varieties, or TK (PTB 8, PTB 9) and Chenkazhama (PTB 26) and the one collected from Ottappalam (OTP) and included in the present study had the maximum of 250 grains on the main panicle. Thus TKTM is a distinctly superior variety from the point of view of the plant breeder. Since all characters are governed by genes, it should be possible to transfer this high grain number to the currently cultivated semi - tall and dwarf varieties. Crosses were done from 1996 - 97, hybrids were identified and subsequent selection continued based on height (80-120 cm) higher productive tillers, longer panicle, high grain number and Matta (bold grain; red rice) which farmers of Kerala prefer. Rice farmer of Palakkad gets Rs. 300 more for 500 kg paddy if it belongs to the category, Matta. Materials and methods Rice varieties, PTB 8, 9 (TK Matta and TK White rice), IR 8 and IR 36 were obtained from Pattambi Rice Research Station as also PTB 26 (Chenkazhama). Other varieties, Athira and Matta Thriveni (dwarfs of Kerala Agricultural University) were obtained from local farmers. Since the first crop commencing May is the most suitable for TK and Chenkazhama, 106 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era crossing work was invariably done in first crop. Farmers do not grow TK and Chenkazhama in second (II) crop since their yield performance is poor. Seeds collected from crossing, had to be sown and therefore, in the majority of cases, sowings had to be done in the second crop for the identification of hybrids. Dwarf varieties are grown in both crops (I and II) and therefore, selections in succeeding generations have been done in both the crops and better looking plants carried forward. Selection work up to II crop was done at Mannapra. From the year 2000, the work was done at Alampallam, Vandazhi and Vadakkencherry, all in Palakkad district. Since the aim of the study was to transfer the high grain-number of the tall Indica variety of Thavalakkannan from Thiruvilvamala (TKTM), four important characters, (I) height of the plant in cm, (2) number of productive tillers, (3) length of panicle and (4) number of spikelets on the main panicle were recorded for all plants selected. Only in the final stages was the duration of the crop recorded. Those selected were initially given culture numbers and yield trials were conducted following standard procedures. Those finally selected, based on grain yield, were given PC (my initials) numbers and also named, to distinguish them from other varieties. PC 1 was identified in F6, PC 2 in F7 (in the farmers’ fields at Alampallam and Vandazhi respectively) and named” second coming of Thavalkkannan and Chenkazhama respectively “by Karshaka Sree, a monthly Publication of Malayala Manorama for Kerala farmers in its February 2003 issue. Four more short duration varieties were identified: PC 5 “Santham” in F9 and PC 3 “Sivam”, PC 4 “Sathyam”, PC 6 “Sundaram”in F10. These short duration varieties were all evaluated in the second crop of 2004-05 and their yield performance confirmed in first crop of 2005-06 before naming them. Details of these varieties were brought to the notice of the Palakkad farmers by the Malayalam daily, Mathrubhoomi on February 6th 107 2006 followed by Karshaka Sree, in March 2006. The Scientific aspects of the study are presented and discussed in this paper. Results and Discussion Table 1 gives details of these characters for I and II crops. Data for the second (II) crop clearly show reduction in height, length of panicle and number of spikeiets while the tiller number gets increased in the II crop in some (e.g., TKTM;Chenkazhama (OTP), IR 8). Excepting PC 6, Sundaram, all others showed the ability of producing more tillers, especially in the II crop (Table, 4). Table 2 gives details of number of inter varietal hybrids between tall Indica (TKTM) and Chenkazhama (OTP) and dwarf rice varieties IR 8, IR 72 (IRRI) matta Thriveni, Athira (Kerala Agr. Univ.varieties). Spikelet fertility or seed - fertility percentage provides an index of relationship (close or otherwise) of varieties involved in the cross. Usually, it is the maximum fertility that should be compared and for the study to be completed a number of F1 hybrids should be available. Seed fertility of IR 8 x PTB 8 and Chenkazhama (OTP) X IR 8 are similar indicating that Thavalkkannan Matta of Pattambi research .station (PTB 8) is similar in genetic relationship to Chenkazhama of Ottappalam (OTP). Seed fertility of TKTM X IR 8, TKTM X Matta Thriveni and its reciprocal (about 30 %) showed that IR 8 and Matta Thriveni are the most diverged from TKTM. Seed fertility of IR 36, Athira with TKTM (maximum 69 %) compared with those of Chenkazhama (maximum 99 %) do indicate great divergence of TKTM and Chenkazhama (OTP). If fertility indicates close relationship, seed sterility (100seed fertility per cent) percentage shows how far are the two varieties distant. An attempt has been made to pictorially represent these varieties, TKTM and Chenkazhama (OTP) based on sterility per cent. While Chenkazhama Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era (OTP) is comparatively recent in evolutionary scale, TKTM is ancient. Table 3 gives details of the maximum grain number recorded and the number of selections made in F2 to F10 as well as details of range of number of spikelets in F1 generation. However, it is the responsibility of the plant Breader to select a variety if it is likely to be superior to the current variety under cultivation by the farmer. This happened in the case of the cross, IR 36 X TKTM. In this cross although the range of number of spikelets in the 3 F1 hybrids suggested maximum of 322, maximum of 272 was reached in F6 in 135 days of duration; further increase was difficult to be achieved. The figures underlined indicate those studied in II crop and the number of 272 was achieved in the II crop and since this variety had grains which are bold and 1000 grains weighed 28 g (more than the weight of TKTM) the plants of this line was harvested and seeds mixed to form a culture. After yield trials, this was named PC 1. In the case of the cross, Athira X Chenkazhama, there were eight F1 hybrids raised in the second crop. Subsequently in each generation there was rise in the maximum of spikelets if the crop was in I crop, a temporary decrease if it was in II crop and a dramatic increase in the subsequent I crop (216,388 in I crops in F2, F3» 289 in second crop of F4and 379 in I crop of F5). Maximum of 496 was reached in F8. By that time the panicles started showing symptoms of disease and selection work had to be restricted to F7 (maximum of 417 spikelets). As can be seen in table 4 this was a semi - tall (about 120 cm). One thousand grains weighed 25.0 g. Yield trial of this culture was done at Vandazhy Village of Palakkad District. PC 1 is dwarf and capable of yielding 6.0 mt/ha in a duration of 135 days while P6 2 gives 5.6 mt/ha in 120 days (Table 5). Subsequently PC 1 and PC2 have now spread to 600 and 500 acres respectively in almost all the districts of Kerala, during the last four Seasons. 108 TKTM X Athira This cross needs special mention because it has yielded two short duration varieties, one of 100 and the other of 110 days duration. This cross succeeded only when Thavalkkannan was used as mother. Three F1 hybrids were identified in the second crop (Table 3) and their maximum spikelets ranged from 127 to 184. Thereafter it rose to 369 in F3 and the maximum number of 413 was reached in F10 in the I crop of 2004 - 05. One particular plant needed special mention. It was semi-tall (122 cm), had 6 tillers: main tiller carried 413 spikelets and 370, 345, 337, 174 and 158 in second to sixth respectively, of spikelets totaling 1797 grains per plant in the first crop. However, the progeny of the same plant showed maximum of 216 in the II crop (Table, 4). The culture emanating from the progeny of this line recorded maximum of 6.375 mt/ha in the second crop of 2004-2005, the maximum under the short-duration category (Table 5), with 110 days’ duration. Another distinct group of plants in this cross was shorter (107 cm), with 5 productive tillers and 435 spikelets in I crop of 2004-05; in the II crop, the height was reduced to 80 cm and spikelets to 181. However, the culture that emanated from this plant - progeny proved to be shortest in duration of 100 days and the grain yield recorded from the yield trial was 5.579 mt/ha. Higher yielding 110 days’ duration, PC 3 , was named “Sivam” and the shortest duration of 100 days, PC 6, “Sundaram”. TKTM X matta Thriveni In this cross, both the cross and their reciprocals were successful; seven F1’s were identified in the former and two in the latter (Table 2). Subsequently, the aim was to select all progenies showing higher fertility, more productive tillers and number of grains, reduction in height of the plant and in the process the progenies of Matta Thriveni X TKTM got eliminated. Here also plant panicle length of 32 cm. Higher tillers which are productive were also observed in all these varieties.114 mt/ha. produces only 2 mt/ha and Kerala is a deficit State producing only one fifth of its requirement. This culture recorded the lowest yield of 4.083 mt/ha in II crop (Table 5). In the yield trial conducted in the first crop of 2005-06. one with 110 days and another of 100 days in the second crop.3 %. chromatid ends of chromosomes generally take part in chiasma formation (Elliott. It is a dwarf capable of producing more tillers (upto 17) in II crop and maximum of 266 spikelets (Table 4).5 g for 1000 grains (Table 6). A Palakkad Rice Farmer at present gets maximum of 4 mt/ha and these varieties would be a welcome addition to him. The best one. The highest grain yielder that ushered in the green revolution in Rice. recorded 5. This was numbered PC 4 named “Sathyam”. Darlington and Mather. it yielded 6. The variety is PC 5 and named “Santham”. Currently. this is the first report of transfer of genes responsible for 430 grains from a tall Indica like TKTM to two shorter duration (100 to 110 days) varieties in F10.3). Maximum spikelet number of 299 was achieved in F9. more productive tillers and spikelet number (Tables 2. but also due to need for straw for cattle that a small farmer will maintain in his farm. Kollam and Kottayam in addition to making avil (beaten rice). IR 8 of International . A number of progenies of this plant figured in subsequent generations and in the tenth (F10) it was decided to make a culture of seeds of all the plants and conduct yield trial in the II crop of 2004-05. 6 tillers. derived from crossing IR 8. it would mean that duration determining loci constitute a complex unit of a few genes which can give rise to shorter duration varieties under certain conditions. PC 2. “Sundaram”. it is Jyothi. TKTM X IR 8 Since this cross with 14 F1 hybrids with maximum spikelet fertility of 26. however. with more rains received. In the trial in the I crop of 200506. with a 7 days’ more duration. the increased grain yield in these two varieties is not solely due to high grain number but also due to higher productive tillers. where Athira takes 125 days for maturity. In the first crop. This culture had largest sized seeds and highest weight of 30. while both parents had duration of 125 to 135 days. excepting PC 6. selection from second generation onwards was based on higher fertility. 1958. a value added product fetching a premium price for the farmer. it was found that Santham produced grain yield of 0.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era parameters got reduced in the II crop compared to the I. That Palakkad district. If the above assumption is correct. another existing variety. 1950). As far as I am aware. This is the only cross where 109 genes responsible for high grain member exceeding 400 grains from TKTM have been transferred in full. enjoying 35 % of its land under irrigation from river valley projects. F3 plant 24 proved to be the better in the I and II crop. that is used for making avil. Athira had given rise to two short duration varieties.85 mt/ha more than Jyothi. the difference being the minimum. It is interesting to note that a medium duration variety like TKTM (Tavalakkannan from Thiruvilvamala) and a near medium duration variety. The larger sized grain of this variety is preferred for consumption in Thrissur. calls for more short duration very high yielding rices suited to varying agroclimatic Zones and it is this need that varieties like the above (PC 3 to PC 6) would fulfil. Chenkazhama (secondcoming) and PC 3 “Sivam” are two semi-tall varieties selected not only for grain-yield. of 110 days’ duration. This can only be explained by ‘gene -transfer’ as a result of chiasma formation in meiosis between homologous regions of genes (chromatids) responsible for determining duration of these two varieties. the plant had height of 105 cm. PC 3. “Sivam” had 413 and PC 6 “Sundaram” 435 grains.963 mt/ha. Since linked genes near the centromere are difficult to be broken. PTB 8. Although the diploid of the species O. had preferred longer panicled rice plants with more grains per panicle for improvement in grain yield. on an average. By 2020 it is feared that the growth of population would outstrip grain production in India and Kerala can face the future. This area was the centre of origin for rice.officinalis occurs naturally in Assam. more frequently. TKTM which possessed 430 grains is an exceptionally superior variety. All these would suggest that the superiority of TKTM among rice genotypes of the region and a secondary centre of origin for the cultivated varieties of rice. Therefore the variety. very high grain yielders like the PC 3 “Sivam”.mlampuzhaensis from 110 Malampuzha of Palakkad. PTB 9. IRRI is trying to bring 200 grains per panicle and in this project IR 72 has been made use of. Borneo. Sterile glumes of PTB 8 as well as the tip of glumes show extended violet colour. Almost all varieties cultivated here are grown through out Kerala. This situation can be changed only when more short duration. The fact that a variety like Thavalakkannan has many varied known forms (matta TK . Significance of Thavalakkannan from Thiruvilvamala. Gradual introduction of Varieties like these short duration varieties depending on their suitability. South east Asia was considered the second main centre of origin involving Hindustan (including Burma and Siam). leaf margin and leaf . sugarcane.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Rice Research Institute. there is no difference between the two. Of these. Krishnaswamy and Chandrasekharan (1957) reported a naturally occurring tetraploid species of Oryza. Both Thavalakkannan and Chenkazhama have violet (reddish-purple) coloured leaf sheath. the Malay Archipelago.junction. Sumatra.30 cm indicating that our forefathers. with confidence. O.1950 In Elliott. Grain size and weight of 1000 grains of these varieties are given in Table 6. in different climatic zones in the State would bring about self sufficiency in rice production in the State. This region includes India and Palakkad district is considered the ‘Rice-Bowl’ of Kerala. The maximum grain number in PTB 8. Philippines produces. 150 grains per main panicle and as part of upgrading rice production. 1958) designated eight main ancient and independent world centres of diversity for . Another important aspect is the tendency of TKTM to form more productive tillers in the II crop which it passes on to its progenies (genetic). TK and Chenkazhma have originated from TKTM. Palakkad farmers prefer grains like Thavalkkannan and Chenkazhama while Kottayam and Kollam farmers prefer a little more longer and wider grains that Jyothi or Santham (PC 5) provide. PC 4 “Sathyam”. as practical breeders. tall Indica rice Variety Vavilov (1926 and 1949 . It is a reasonable hypothesis to suggest that both Thavalakkannan and Chenkazhama have evolved from a common ancestor with high grain number or that the varieties now known as land races.our major crop plants. . numerous legumes and many tropical fruits. Another important point to note is that while IRRI varieties show panicle length of about 24 cm. Java. its tetraploid species occurred here. the present TKTM studied now) and its close phenotypic similarity to Chenkazhama (PTB 26) and currently studied Chenkazhama (OTP) which are all genetically different show great diversity. Excepting that Chenkazhama is a week earlier in duration to TK. The climatic conditions of Palakkad are different from those of Philippines and would account for low yields especially the water deficit. varieties like Thavalakkannan and Chenkazhama show panicles of 28 . PTB 26 (Chenkazhama) and Chenkazhama (OTP) does not exceed 250. tip of glumes and when exposed to continued sunshine the upper surface of the flag-leaf also assumed violet colour. white rice TK-PTB 9. the Philippines and Indo-china. PC 5 “Santham” and PC 6 “Sundaram” with 100 to 115 days in duration are introduced. getting pure seeds from progressive farmers associated with this work. they wanted straw for their cattle and liked PC 2 also. Rajakrishnan of Alampallam. Kottayam. The observation of different farmers of Kerala in different parts of the state are: Palakkad region Many farmers have reported that 6.5 mt/ha can be obtained by varying cultural practices. 6. PC2. George Joseph of Alappuzha who has sown both PC 1 and PC 2 feel that a very good crop of paddy.K.4 mt/ha. McGraw Hill Book . PC 1 and PC 2 were released for general cultivation in February 2003 and has grown in cultivation through the effort of individual farmers and Seed procuring Agencies to the extent of 600 and 500 acres respectively.4000 every season. Cool region.75 mt/ ha.M. has informed me that the performance of the crop is excellent in the area.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era PC 1 to PC 5 clearly showed this trait (Table 4). Thrissur Lvla Ravindranath of Kanattukara found that PC 1 can multiply 47 times by volume and PC 2. L. which form the dwarf parents in crosses. Since Kuttanad is a region below the sea level. Mr. All the above facts clearly bring about the fact that TKTM is an ancient and most successful variety of Palakkad. Joseph tested PC 1 and found they could obtain 6.. and K. Mather. Plant Breeding and Cytogenetics. Rajiv Gandhi Paddy Procurement and Marketing Society has obtained 10. The elements of Genetics. 1950. More Productive tillers would certainly increase the grain yield as indeed the experience of other farmers of Kollam.72 mt/ha. Her neighbouring farmers who inspected the crop in the I crop season said that even though PC 2 yielded grains less. New York. Kole cultivation. studies done by the IRRI scientists (Peng et al 2004) have shown that rise of one degree Celsius in night temperature decreases rice grain yields by 10 per cent. being cultivated by our fore-fathers for hundreds of years in all the varied conditions of Kerala and should have accumulated necessary genetic changes in its genome and developed ‘built .8 metric tones of pure seeds for sowing and planting large area. Shri. Some details are given below. On the other hand. Wvanad Mr. of IRRI varieties. Kumarakom 111 obtained 28 quintals per acre despite the crop drowning in water twice (7 mt/ha). Palakkad who supplied pure seeds of the variety to others have shown that upto 7. Kottayam and Thrissur where PC 1 and PC 2 have been tried and tested for grain yield.Robinson and A. 40 times. REFERENCES Darlington. C. CD. I believe these short duration varieties would aiso perform similarly and help increase the average yield of rice which remains static around 2 mt/ ha in Kerala State. is now grown where his farm of 3 acres was running at a loss of Rs.6 mt/ha. a farmer of the region. I have discovered it accidentally and transferred its yielding ability to the currently grown dwarfs resulting in very high yielding dwarfs (Table 5) which are also Matta (Table 6) preferred in the State. Alexander Chako. Elliott Fred. 1958. they frequently get water level rising rapidly remaining for some time and draining. The farmer then tried PC2 for ‘puncha third crop’ and obtained a bumper yield of 8.in tolerance’ for varied adverse conditions which occur in the State. semi-tall variety yields 5. C.G. Highest grain number found in the variety is proof that it can tolerate higher temperature prevalent in the district. Kumarakom region Here too much water is their problem. Managing Director.Das. The Macillan Company.0 mt/ha can be obtained from PC 1 for both I and II crop. S. Romeo. N. and P. C. Sheehy. Khush. G.. Rice yields decline with higher night temperature from global warming. 112 .. 23: 307-310.Chandrasekharan. Visperas. 27 : 9971 . Grace. M. Sci.. (1957) Note on a naturally occurring tetraploid species of Oryza. Xuhuazhong. and Kenneth. 2004.. PNAS 101. Centeno. London.. John. Grudev. E.. Rebecca. Cassman. S.9975. and Cult. Jianliang Huang. Laza. Krishnaswamy.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Company. Peng Shaobing. of Spikelets 430 Duration (Days) 135 .5 159 120 97 5 24.2 160 — I Crop II Crop I Crop II Crop I Crop II Crop 96 5 26.7 169 125 71 13 22.5 23 24.5 70 — 105 100 184 107 214 130 27.4 213 128 109 76 II Crop I Crop II Crop I Crop Matta Thriveni IR 8 Athira IR 36 Second National Plant Breeding Congress 2006 Thavalakkannan Thiruvilvamala (TKTM) II Crop 161 12 24. Some important parameters of varieties used in crosses Chenkazhama (OTP) I Crop 193 81 7 20.5 211 125 70 5 23 134 120 Plant Breeding in Post Genomics Era Height (cm) 182 113 Tillers 3 Length of Panicle cm) 31 No.5 5 5 5 4 23 135 125 90 73 3 28.Table 1. 4. Seed fertility among F1 hybrids of TKTM. 10.1-50. 7. Female parent No fertility in F1 hybrids Male parent Number of Percent seed hybrids 1.Table 2.1-27.No Female parent Male parent Number Percent seed fertility in of hybrids F1 hybrids 1 29.8 9 IR8 IR72 Chenkazhama (OTP) 2 10 10 7 42.6-26.3 66-95 70-95 90-99 114 3. Chenkzhama (OTP) with dwarf varieties of Rice SI. TKTM Athira TKTM matta Thriveni 6.3 8 IR8 Chenkazhama (OTP) 2. 1 3 11 7 2 3 13 26. Matta Thriveni TKTM Chenkazhama (OTP) 8 55-95 .8-30 12 matta Thriveni Chenkazhama(OTP) Athira 62-69 49-69 10 11 41.6 62-68 17. ThavalakkannanIR8 14 Thiruvilvamala (TKTM) IR8 PTB8 (TK matta) IR36 TKTM TKTM IR36 Chenkazhama (OTP) -doIR36 5.6 SI. Name of Variety Second coming Thavalakkannan (3) 226-322 (23) 180 (2) 246 (17) 252 (7) 272 Varieties inCross F1(Range) N F3 F4 F5 F6 F7 F8 F9 F 10 PC1 IR36xTKTM PC2 PC3 AthiraxChenkazhama (OTP) TKTMxAthira Second coming Chekazhama Sivam (8) 113-139 (3) 127-184 (13) 216 (18) 241 (8) 388 (4) 369 (59) 289 (10) 208 (4) 211 (16) 203 (62) 379 (2) 313 (74) 266 (7) 172 (66) 496 * (8) 273 (5) 294 (2) 413 115 PC4 266 TKTM x matta Thriveni Sathyam (7) 61-206 (20) 295 (25) 240 (9) 217 (10) 233 (5) PC5 Sundaram (18) 241 TKTMxlR8 Santham PC6 TKTM x Athira (14) 73-190 (3) 127-184 (33) 335 (4) 369 (4) 200 (10) 208 (6) 256 (2) 313 (5) 202 (4) 157 (0) 239 (7) 172 (88) 417 (13) 346 (7) 223 (8) 210 (8) 265 (2) 175 (13) 346 (2) 211 (8) 273 (7) 223 (4) 301 (2) 270 (2) 299 (5) 294 (2) 435 Figures with in ( ) indicate number of selection involved Figures underlined indicate study in second crop * Symptoms of disease affecting panicle with maximum spikelets .Table 3. Maximum grain number (Spikelets) in F1 and subsequent generations of varieties evolved Variety No. of Spikelets Duration (Days) 101 6 25 211 135 Table 5.8440 6375 5963 PC2 Chenkazhama (Seond coming) PC3 Sivam Plant Breeding in Post Genomics Era PC4 Sathyam PC5 Santham PC6 Sundaram .5 237 115 105 6 32 299 115 84 17 25.5 266 110 82 15 23 230 110 107 5 27.5 11.Table 4.6114 5579 TKTM x matta TKTMxAthira Athirax Chenka5600 .5 75 10 23 216 110 I Crop II Crop I Crop II Crop I Crop Second National Plant Breeding Congress 2006 Height (cm) Tillers Length of Panicle cm) No.4 22 18. Grain yield of varieties evolved Duration (days) Parentage Metric Tonnes per 116 No.5 413 117 98 17 26. of variety Name of the variety hect-are PC1 Thavalakkannan 135 IR36xTKTM 6000 -7000 (Seond coming) 120 zhama OTP 110 110 Thriveni 115 100 TKTMxlR8 TKTMxAthira 4083 .5 30. Some parameters of varieties now evolved P C 3 Sivam TKTM x Athira P C4 Sathyam TKTM x matta Thiriveni I Crop 88 7 25.5 435 107 II Crop I Crop II Crop I Crop II Crop 80.1 100 — PC5 Santham TKTM x IR 8 PC 1 IR36xTKTM PC2 Ahira x Chenkazhama P C6 Sundaram TKTM x Athira II Crop 90 17 28 272 128 120 8 29 401 120 22 6 30. 4 Range 3.70 8.5-9.4 3.5 7.5-9.40 3.0 117 .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 6.5 27.0 25.2 3.5 3.70 7.0-3.5-8.0-8.7 27.5 8.5 Width (mm) Mean 3.08 9.5 3.0 8.0-3.0-3.0 8.0-3.10 8.2 26.0-9. Gain size and weight of short duration varieties GRAIN SIZE Thavalakkannan Thirvilvamala (TKTM) Chenkazhama (OTP) Aiswarya Jyothi P C3 Sivam P C4 Sathyam PC5Santham P C6 Sundaram Length (mm) Mean 7.5 24.10 7.02 3.0 25.0-10.0 3.77 Range 7.30 8.55 3.0 7.0 8.04.0 3.0-8.0-3.0-8.15 3.5 3.0 30.0 8.5 3.0-3.80 9.5 3.5 Weight of 1000 grains (g) 27.1 3.0-3. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TECHNICAL SESSION II QUANTITATIVE GENETICS AND ANALYSIS OF GENOTYPE X ENVIRONMENT INTERACTION . parental choice for hybridization designs and selective breeding. V ABSTRACT The evolution of Quantitative Genetics concurrently with Population Genetics. with designs of field experiments. In general. At this point. to name a few. sooner than later. Taramani Institutional Area. whose strong foundation were laid by Fisher. This paper addresses issues central and peripheral to them. research priorities got shifted to the new avenue at the cost of time-tested Mendeiian breeding. In India. from the time Charles Darwin discovered ‘variation’ and provided a logical frame. Oscar Kempthome. For instance.S.one as an appetizing theory and its development that need a theoretical bent of mind including good knowledge of Statistics and elements of Mathematics. The monumental work of the greats . Ralph . the reverse is true with weak or absence of strong foundation of Mathematics and Statistics but unlimited diversity of crops and growing environments.S. Harold F. This imbalance defies any innovative correction in India. strides made in molecular biology from around 1980s. any theory initiates under restricted and often indefensible assumptions and developed relaxing the assumptions in stages. with a good funding back-up. like diversity evaluation.S. to misplaced doubts of the practical relevance of the subject of Quantitative Genetics. Beagle. were set to provide the new avenue. but diversity of test crops and of growing environments is not always available for practical testing of biological and quantitative genetic concepts. playing an important role. In the context of the former.E. in other countries good foundation of Mathematics and Statistics is laid at the school and undergraduate level. Jinks. However. The genetic basis of variation became clear after the first ‘Classical experiments on Plant hybridisation’ by Gregor Johann Mendel that helped in the formulation of the famous Laws of Heredity. 3rd Cross Road.M. John L. Swaminathan Research Foundation.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era QUANTITATIVE GENETICS . Haldane that shaped Quantitative Genetics. How far Quantitative Genetics guides a breeder for targeted improvement is an open question. has been taken to greater heights by a number of well-known geneticists including Kenneth Mather. But the gaps between practical plant breeding and the prompts to it through quantitative genetics theory continue to remain wide.WHERE ARE WE TODAY? Arunachalam. Good conceptual strides have been made in targeted plant breeding. Charles Darwin first discovered ‘variation’ after his voyage on H. and the other as a beacon for targeted plant breeding. Comstock. Further work by various researchers on variation and evolution. Chennai 600113 . Until we address them. P = G + E or its extensions have untenable built-in assumptions. including Francis Galton 118 M. Capacities to identify markers of QTs using molecular tools started increasing. the popular model. at times.Sir Ronald Fisher. has been documented extensively. leading. the scope for realizing more than additive benefits from integrating Mendeiian and Molecular approaches would be elusive. Sewall Green Wright and John B. What pathways are explored to integrate the best of Mendelian and Molecular breeding (a relatively new subject)? What is the role of Quantitative Genetics here? Such questions are intriguing and annoying. There are two avenues of utilizing a vast subject like Quantitative Genetics . there are accepted lines of practices to breed for improvement of quantitative traits (QTs). Robinson. Haldane reestablished that natural selection was the premier mechanism of evolution. variation. Harold F. Further work by another peer geneticist. Through this theory. Fisher. Again by simplifying assumptions that G and E are independent which is not so anyway.A. Analysis of genetic phenomena underlying QT expression. This are a is within the reach of plant breeders and applied geneticists and we shall deal with this area therefore in this paper. to name a few. Any basic conceptualization initiates under restricted and often indefensible assumptions. a random effect caused by random sampling of genotypes. Ralph . the theory starts with the simplest additive model.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era led to two differing schools of thought . Fisher circumvented this problem using the strategy of growing the phenotypes in the field using an appropriate design and estimating environmental variance (= error mean square).B.S. in the above equation only phenotypic value (dependent variable) can be measured and the independent variables. A number of theoretical results obtained this way have to be understood in their proper perspective and great caution is needed before applying them to a practical problem. Fisher who synthesized the two schools and established the principle of natural selection. P = G + E Known Unknown As indicated.(1) Darwin’s school of continuous evolution (with those professing this school being called Biometricians) and (2) Galton’s school of discontinuous evolution (with those professing this school being called Mendelians). An example is given here to illustrate this point. Jinks. ‘The Causes of Evolution’ (1932). Thus Fisher. Robinson. he could explain how evolution occurred. Oscar Kempthorne. Haldane and Wright whose monumental work shaped Quantitative Genetics are known as the founders of Quantitative Genetics. 1930). another great geneticist and contemporary of Fisher and Haldane. He explained it in terms of mathematical consequences of Mendeiian genetics. To deal with this area without adequate knowledge of statistics and probability theory would be profoundly difficult. John L. However.Variance . in this process genotype interacts with environment in a very complex way and in general. It was R. Comstock. But it was a lingering question whether the two schools were consistent with Darwin’s theory of evolution by natural selection. His book. Optimization of methods of plant breeding using the leads given by Quantitative Genetics concepts that would provide firm (with a probability) responses leading to more hits than misses. The subject of Quantitative Genetics has two important utilities: 1. Their work was taken to greater heights by a number of well-known geneticists including Kenneth Mather. and evolution using advances in theory [has specific congruence 119 with Population Genetics]. 2. he showed that variance of G can be estimated as Variance of G = Variance of P . founded the theory of genetic drift (that later came to be known as the Sewall Wright effect). it is not possible to model phenotype (P) in terms of genotype (G) and environment (E). as the cause of evolutionary change using a mathematical theory developed on the basis of extant genetic research (cf. Wright further drew a pathway to visualise the relationship between genotype and phenotype. G and E are unknown.E. more rigorously than Darwin. Sewall Wright. It is known that a genotype needs an environment to express and manifests itself as phenotype. came to be known as the “modern evolutionary synthesis”. This was hugely influential in the evolution of evolution theory itself. J. and symbolically. f: frequency. . The same argument holds for other traits defined by colour. In the context of treatises on Quantitative Genetics being naive and inexplicit on this point. Genetic values partitioned into additive (A) and dominance (D) components GY TT Tt tt f P2 2pq Att A D GV Remark A TT -2q2h G T T where h is the ATt +2pqh GTt phenotypic Gtt value of the -2p2h heterozygote.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era of E. Table 1. genotypes. Arunachalam and Owen. D: dominance effect. see Table 1) in general. we recognize that a fit of a best possible straight line to the 3 phenotypic values of a population governed by a single diallelic gene leads to the value of A (fuller details in Li. Without going to details. the following assumptions are implicit: 1. For example. TT. Tt and tt. GV: Genetic value Hence in utilizing various test expressions. for example flower colour. Tt. the above explanation becomes crucial (see also Arunachalam. it is crucial to be aware of the limitations before extrapolating decisions for further breeding in practical situations. the genetic value G in P = G + E is partitioned into two orthogonal components. However. as for example. it is now possible to measure traits in continuous scale and therefore argue that only QTs exist and qualitative trait is not defensible. Vz and % (implying p. the expression for A seemingly does not contain p (but actually it contains p with the numerical value. A is a function of not only the value (phenotypic) but also the gene frequency of T (equivalently the frequencies of genotypes. like 1. 3pale green can now be quantitatively measured as colour intensity in a continuous scale. it is assumed that an F2 population is generated from the cross. leaf colour that is defined using discrete scores. A: additive effect. Tt and tt are V*. the gene frequency of T = V2).for this. noting that it is hard to ensure selection of parental phenotypes to be completely homozygous to be of 120 However the theory is further developed after relaxing the assumptions in stages. TT and tt. TT x tt .green. We thus note that in partitioning G into A and D. At times. breeders differentiate between qualitative (with defined discrete classes) and quantitative (continuous variation preventing to define discrete classes) traits. with scientific advances. Population governed by a single diallelic gene 2. though it is difficult to develop it to exactly match any practical situation. In the particular case of a population where the frequencies of TT. 1955. measured as the deviation F2G = F2F . Other traits that are common are seedling vigour (that can now be measured as dry weight of young seedlings) and disease incidence (that can be measured as leaf area affected and similar other measurements). 1971) and the deviations from the fitted straight line leads to D (Table 1). A (Additive Effect) and D (Dominance Effect). 1976). 2. heterosis.F2E Likewise. 1993). p= 1/4 !).dark green. GY: genotype. the added simplification by confining oneself to a single diallelicpopulation with frequency of dominant gene = Vz . Fit of a straight line or additive model to the 3 phenotypic values 3. It can be shown that A is also equivalent to Breeding Value and gca effect (Arunachalam. heritability (both narrow and broad sense) and the like. What often times is not recognized is the fact that the estimate of A involves the frequency of genotypes in the population and in fact. From the days of Mendel. In contrast. This would involve multiple stages of hybridization. each of which is measurable. Advances in molecular biology have 121 Additive x Additive Ai x A2 1 Additive DominanceAi x D2 1 Dominance x Additive Dominance x Dominance D2 x A^ 1 Di x D2 1 But. often with linkage between them. Seed Science and the like. Soil Science. the component QTs are also be controlled by genes some or most of which could be linked (Fig 1).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Mendel provided the foundation for associating control of a gene with a QT. QTs are governed by a number of genes. Microbiology. Plant breeding aims to use QTs in this backdrop. it is essential in this context to understand the limitations of generalizing results based on single diallelic gene to QTs under multigenic control. The total genetic variation with 2 degrees of freedom (d. and dominance variance with 1 d. molecular breeding. that is of recent origin. However. aims to modify/ incorporate genes (targeting specific ones being an arduous and comparatively expensive process) and thereby QTs.Genetic and phenotypic perception Breeding for improved performance gets highly complicated as it demands improvement of QTs defined by various areas like Biochemistry. A natural extension to the two gene . seedling vigour. QT .f. based on its phenotypic expression. Dominance (gene 1)D^ Dominance (gene 2)D2 Fig 1. But he dealt elaborately with single gene diallelic phenotypes.f.f.f. in other words. between the 9 genotypes (noting that we do not consider linked genes here) as follows: Component symbol d. Entomology. in reality. As we observed earlier. Agronomy. For example. the number and frequency of various phenotypes. Fisher provided the base to explain the variation between the 3 genotypes of a single gene diallelic population. In turn. as would be clear later. Additive(gene 1) Additive(gene 2) Ai A2 1 1 1 1 area etc. days to flower. with the present knowledge. Pathology.) between the 3 genotypes can be partitioned as Additive genetic variance with 1 d. Quantitative Genetics develops appropriate theories and ways of efficient breeding.f. Expression of QTs is also subject to genotype x environment interaction. photosynthetic . more specifically. Naturally this process would take time. number of generations and selection cycles. Further QTs also admit of component QTs.diallelic case will partition the 8 d. it is known that QTs are under polygenic and possibly multiallelic control. it is developed based on phenotype and environment. though he extended his laws to QTs under two gene control also. Pyramiding those QTs to high performance demands co-adapted function of various genes governing QTs. days to maturity has imbedded component QTs like date of sowing. Physiology. a large variety) that can be closely linked. such situations are infrequent. F1 itself can display variation in height measurements that could be 122 pronounced in F2 (Fig 2). contrasting reality) to group individuals (‘genotyping’) using pnenotypic (expressed QT) values. a real recombinant could be classified as a parent. flower colour. But it is known that few generations of inbreeding cannot bring homozygosis. it is possible that a parental segregant with a value deviating from its original value could be classified as a recombinant and likewise. In that case. classical breeding characterizes and selects individuals on a set of key traits that are dependent and controlled by many genes (not ruling out linkage). plant height shows continuous variation and hence grouping them in discrete genetic classes is impossible. 3:1). in principle. In that case. Let us consider the simple breeding process in which QTs are controlled by single diallelic genes (Fig 2). particularly when several genes control plant height. The segregation pattern of a QT like flower colour is clear from Mendelian and Molecular standpoint. misidentification of .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Fig 2. to QTs of interest. 2005). Projected and Unprojected information on Mendelian and molecular principles of breeding provided ways of finding molecular markers (now. though the process involved could be cost and time-extensive. This is a special advantage of using molecular marker to identify genotypes. Molecular methods use one or more single gene markers (that are always independent. in principle. in practice. While dominance does not help to identify heterozygotes inFi or F2 based on colour phenotypes. If we extend the above logic to a QT like plant height. molecular marker. F2 segregation would always be in the ratio 1:2:1 (codomiance) compared to Mendelian segregation (dominance. the mandatory condition being that the marker should be tightly linked to the QT. The differences between Mendelian gene and molecular marker have earlier been made clear (Arunachalam. can identify them. though. As is evident then. quantitative variation can then be found in F-i that would manifest into greater variation in F2 generation. One may argue that breeders use inbred lines as parents and therefore the above contingency usually do not arise. In contrast. We choose. The Unweighted Pairwise Group Method on Arithmetic Averages (UPGMA) is the mostpopular for grouping. A practical example illustrates the differences of grouping based on Tocher’s method and UPGMA (Fig 3). for example. to verify the effectiveness of such grouping. When a researcher is interested in a number of traits defining an individual.based on multivariate distance B. in which case one could be confronted with conflicting group configurations given by various markers. based on similarity index Genetic divergence measured by D Unweighted Pair wise Group Method Tocher’s method (cf. however weak it may be.In sharp contrast. as an example. There are several planes of variance between the molecular and Mendelian methods of grouping that is beyond the purview of this paper. Further molecular grouping done essentially in a laboratory has obfuscated the essential need of examining the material in the field. Rao. Hybridization is basic to crop improvement. one is left with several grouping configuration. therefore there is no provision. The example of little millet (Panicum 123 . Fig 3. Such a process of iterative decisions. Rarely this is an aim of molecular grouping. morphometric grouping uses a multivariate divergence measure taking into account several traits simultaneously avoiding such conflicts. 1952) on Arithmetic Averages [UPGMA] Note the groups obtained by Methods A and B are quite different. a specific but popular use of Quantitative Genetics both in Mendelian and Molecular breeding. clouding clarity in decision making defeating the very purpose of the exercise.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era parents and recombinants is evaluated in the next generation. Several methods of such grouping have been developed by various workers. Two contrasting methods of grouping based on genetic divergence A. The current status of Quantitative Genetics can be scanned in relation to various facets of improvement. One of them uses multivariate distance (D ) as a measure of genetic divergence and the process of estimating genetic divergence between individuals uses phenotypic variation corrected for environmental variation. Parental choice is crucial in hybridization. based. More importantly. though time consuming enhances the probability of correct selection and success. Nowadays it has become common to classify germplasm using a variety of molecular markers. The basic requirement that the markers chosen have to be completely associated with the trait of interest does not receive the attention it deserves. A simple but efficient method is that of Tocher described in Rao (1952). One major aim of grouping on divergence is to select divergent parents to make a cross for initiating the process of breeding. Further work on this area has now made available a number of computer software. The method uses a simple logic — an optimal grouping is one where intra-group divergence is far smaller than the inter-group divergence. Grouping using similarity indices based essentially on band homology of two individuals based on a molecular marker is done following the logic set up by Sokal and Sneath (1953) initially. on various types of markers. grouping on similarity index has to be on several markers. This needs assessing parental divergence and grouping together those parents that show comparatively low divergence or high similarity. QTs (mostly D2?) Repeats of divergence analysis across many crops [QTs/markers] Reality . Quantitative Genetics does set in right perspective what we could target using genetic variation. evidence is not strong yet to observe that gene-articulated marker-based grouping holds an advantage over time-tested morphometric (multivariate) grouping. A close look at the trend in some areas relevant to plant breeding where Quantitative Genetics had made rich contributions (Table 4) highlights overdependence on turnkey software with insufficient understanding of principles and in many cases. In this context. The basics behind Mendelian and Molecular perception of genetic variation and its characterization differ in many ways (Table 2). G X E. 1995).) where 6 different groups from seven landraces were rightly detected by morphometries while no variation was found using RAPD or AFLP markers (Arunachalam et al. Little proof exists to counter this statement even now. accounts for expressed variation including G and G X E Table 3. the targets are not given the same due importance as routine methodologies (Table 3). Molecular biology research tempted / driven by turnkey instrument packages that include solution (Peccoud. What then can we do to resurrect the 124 Table 2. inability to comprehend issues as knowledge and training continue to remain far from adequate. There should be conscientious efforts on the part of researchers to mend the trend sooner than later. Molecular biology research tempted / driven by turnkey instrument packages that include hardware and software. Little proof exists to counter this statement even now. In general. however. 2005) substantiates this observation.. 1995). multiple gene base of QT taken into account Genetic divergence and grouping Measured by multivariate distance.The Target and Reality Target Morphometric variation Diagnose the nature and magnitude of variation Comprehend pattern of genetic grouping across crops Genetic grouping on morpho. Differences between Mendelian and Molecular approaches to genetic variation Basics Mendelian Molecular Sophisticated means of identifying markers Variation deemed to be genetic based on single gene theory Additive model invoked for more genes Epistasis hence ruled out Relative distinctness of two individuals (marker genotypes) measured by similarity index based on RM (band homology) Simple distance measures (additive over loci?) Estimate genetic QTs variation governed by interacting multiple genes Quantitative models enabling estimation Genetic characterisation Defining an individual (genotype) on QTs Environment.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era sumantrense L. in reality. Rare attempts to define very specific needs and engineer original solution (Peccoud. it seems that the basics of and developments in Quantitative Genetics are yet to make a visible impact on elementary but critical steps of breeding process. Genetic variation . hence there was scope for understanding problems Fully softwaredependent Large data base on genetic clustering? But restricted by commercial software (and perception?) now only UPGMA. relevant for ransfer of coadapted gene complexes Environment-specific.Concrete] Pyramiding has examples available problems. * Elements of Quantitative Genetics be taught at B. phenotypic traits independent markers on similarity index (based on Relative Mobility) Further used in Not easily visible practical breeding Grouping on easy UPGMA logic (Tocher’s method) Complicated pedigree Can use only to pyramid a number backcross.Sc level along with Mendelian laws and it should be elevated considerably at M. LOD score etc. Hence poor understanding of linkage estimation between markers. Interval mapping. * Molecular applications especially Markerassisted selection and Molecular Breeding require high level of knowledge on linkage and its estimation by various methods including maximum likelihood method. * Basic Statistics. and a few variants Curricula do not focus on such topics They are referred to the realm of Mathematical Statistics. Software is the key triggering experiments and not necessarily the experimental objective or need Initial days around 1960s software dependence was low. Environment has no hence relevant for relevance select environments or zones situation? I suggest that. be introduced at the level of undergraduate classes. * There should be full terminal question papers in all the above subjects with a high level of practical examinations.Sc level. and over-dependence on routine results from software. unaware of the logical bugs Table 4.. F2 or RILs of traits . Probability and Elements of Mathematics must at least. but not now Linkage estimation etc used to be in the curriculum in schools like IARI.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Target Molecular variation Set paths of [QT] improvement based on the diagnosis Measure realised genetic advance Correct course or set new avenues of improvement Reality 2. Genetic Divergence D2 software dependent NT-Sys software dependent Replete with Univariate distance numerous studies using multivariate distance Based on expressed single-gene specific. for eg. and * Those subjects must be made core courses and no exemption should be given even to students from pure Agricultural stream. Some areas relevant to plant breeding Mendelian Molecular 1. 125 . B. A. 2005. V.. Genetic Resources and Crop Evolution. such human resources could be utilized on a covenant of 6-7 years. This will compensate for existing intra-institutional deficiency. Plant Breeding: Translation. London.A. and Owen.A. Rangalakshmi. 1993. 675 pp. Oxford.C.. Automating molecular . 52: 15-19. 1930. between students and teachers. M.. J. A genetic basis behind combining ability and breeding values in monogenic and digenic systems. effectively and decisively with reason. Li. V. Tamilnadu Agricultural Univesity. An indirect force imposing quality is to stop routine field experiments. S. Ramanathan and M. We must be strong to utilize the existing ICAR. It would be innovative to introduce open valuation system of students’ performance so that scores do not become blocks in proper learning. through practical examples. The causes of Evolution. Population Genetics. Ecological stability of genetic diversity among landraces of little millet (Panicum sumatrense) in South India. Evaluation of diailel crosses by graphical and combining ability methods.S. 1932. Honourable President’s suggestion of adopting ‘Singapore Biopolis’ model (Hindu. and New York: Harper Brothers. to just-sufficient theory to avoid overload. 2005. Dhakshinamoorthy. Until new good teachers become available. 182-196. Ramasamy. through innovative placements within the Institution. Transgression or Transformation? Chapter 13. 23 Feb 2006) in which Organisations/Universities engaged in agricultural research could get their promising human resources trained in a known global Institution.R. CSIR. It is equally important to encourage good teachers to move across institutions to teach and learn. Chicago. C.V. analysis by routine software and unappetizing thesis containing routine results/discussion. U.G. 36: 358-366. There should then be a separate compulsory course that should lead. Fisher. we could enlist known teachers [junior/senior] in a virtual knowledge forum (as suggested by President of India) to teach and interact with students across institutions. Such an open evaluation would remove bad practices like high score cards given to students without justification in return for high rating of teachers.S. Indian Journal of Genetics and Plant Breeding. Finally. schemes for such human resource upgradation 126 and should ask for more. 2: 217-228. R. we should Identify bright students and encourage them to remain in research and teaching. good teachers of Quantitative Genetics have become a vanishing breed. C. J. Green & Co. R.S. To sustain efficiency. it is prudent to introduce evaluation of teachers by students on open discussion. Coimbatore. Purposive funding is needed for this activity. Biometrical Journal. and Kubera Raj. UGC etc. 1971 Polymorphisms with Linked Loci. Confidence need to be nurtured to encourage free and frank discussion among students and.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era principles of Analysis of Variance etc. London: Longmans. Haldane. Chapman & Hall. 1955. Peccoud. meeting their expenses fully. We need to help ourselves before looking for lucrative help from elsewhere!! REFERENCES Arunachalam. V. Oxford University Press. The University of Chicago Press. India. pp. Arunachalam. 1995. Arunachalam . 1976. In: Perspectives of Agricultural Research and Development’s). Arunachalam. Arunachalam. The Genetical Theory of Natural Selection. V. On return. Unfortunately. Biotechnology. Advanced Statistical Methods in Biometric Research.R.R. R. 1952.A (1963) Principles of Numerical Taxonomy. 127 . 13: 741-745. New York.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era biology: A question of communication. USA. San Francisco: Freeman. and Sneath.H. Sokal. C. Rao. P. John Wiley. The production and distribution of quality planting material has gained importance for high production and productivity as the crop is highly heterozygous and the yield vary greatly if suitable mother palms are not selected for seed production. The association among the inflorescence traits and pollen yields is also discussed. Arunachalam and P. V. Central Plantation Crops Research Institute. Since. V. Niral. The number of spikelets. Kerala 128 . B. Kasaragod.) is an important plantation crop of India. length of spikelets and male flowers have positive and significant correlation with the pollen yield.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era VARIABILITY AND ASSOCIATION ANALYSIS FOR FLORAL TRAITS OF COCONUT GENOTYPES Augustine Jerard. M. The variability in the pollen yield greatly affects the hybrid nut production and may affect the yield in the subsequent progeny also. The pollen yield correlated positively with the number of female flowers. the selection of mother palms gained more importance in the hybridization programmes for the production of quality planting material. hybrids have been released involving selected cultivars as parents. Selection of mother palms based on the desirable inflorescence traits would help to increase the hybrid recovery and reduce the cost of hybrid seed production besides quality hybrid output. The present investigation involving seven distinct coconut cultivars showed that there is significant difference in the floral traits and the pollen yield among the cultivars.. The tall genotypes Andaman Ordinary (ADOT) and Benaulim tall (BENT) recorded high pollen yield whereas the dwarf cultivars Gangabondam (GBGD) and Chowghat Orange Dwarf (COD) recorded low pollen yields. Kumaran ABSTRACT Coconut (Cocos nucifera L. KBG 98005. N2 ABSTRACT Five cross combinations considered in the study of the inheritance pattern of Mungbean Yellow Mosaic Virus (MYMV) disease revealed different gene actions. P1. F1. E1 and Nadarajan. In contrast. The above said materials were raised on ridges of two meter length spaced at 30 cm between ridges and 10 cm between plants in two replications. The putative gene symbols assigned for the five genotypes viz. the segregation was found to be governed by digenic complementary interaction. P2. TNAU. The mean disease scale of parents and F1 was calculated as follows (Singh.) HEPPER) Murugan.6 per cent decrease in grain yield under field condition in mungbean. Co5 X VBG 66. In the crosses Co5 X VBN (Bg) 4 and Co5 X VBG 66.. VBG 73 and VBG 66) are highly resistant for MYMV. 1980). Mean scale ¦ = å (Infection rate x 1. 2004. in Co5 X VBG 73 the MYMV inheritance was governed by digenic duplicate interaction. The classification was made into scales 1 – 9 as follows based on the scale adopted by Singh et al. The mean disease scale of parents and F1 was calculated as follows (Singh. KBG 98005 X VBN (Bg) 4 and KBG 98005 X VBG 73 were chosen. During Kharif.2 to 78. Department of Pulses. R1R1R2R2ii. six generations of the five selected cross combinations were raised at National Pulses Research Centre. For every 10th row and as border rows of the experimental plot the check Co5 (highly susceptible to MYMV) was raised as infector row so as to effectively spread the inoculum.. Coimbatore – 3 129 . R1R1R2R2 and R3R3R4R4ii respectively. However. Hence. Madurai – 625104 2. The virus is transmitted by whitefly. Agricultural College & Research Institute. blackgram and soybean throughout India mainly in the Kharif season. which is a hot spot area for Yellow Mosaic Virus disease (MYMV). (1988). The yield losses up to 100 per cent have been reported by Nair (1971) in blackgram. Materials and Methods To study the inheritance pattern of Yellow Mosaic Virus (MYMV). Bemisia tabaci. Six generations viz. Co5 X VBN (Bg) 4. the present investigation was taken up to study the inheritance pattern of MYMV in blackgram as the prerequisite to evolve high yielding blackgram varieties combined with resistance to MYMV. Vamban. (2000) reported 32.. The ‘lines’ (Co5 and KBG 98005) are highly susceptible and three ‘testers’ (VBN (Bg) 4. Introduction Mungbean Yellow Mosaic Virus is one of the most destructive diseases and is prevalent on mungbean. in the crosses KBG 98005 X VBN (Bg) 4 and KBG 98005 X VBG 73. 1980). VBN (Bg) 4. Co5 X VBG 73. Department of Plant Breeding and Genetics. Khattak et al. Co5. B1 and B2 for each of the five crosses were generated to understand the inheritance pattern of MYMV. The Yellow Mosaic Virus Disease (MYMV) incidence was recorded on all the plants based on the visual scores on 50th day. r1r1r2r2r3r3r4r4II.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era BREEDING FOR IMPROVED YIELD AND YELLOW MOSAIC VIRUS DISEASE RESISTANCE IN BLACKGRAM (VIGNA MUNGO (L. Professor and Head. TNAU. the following five cross combinations viz. VBG 66 and VBG 73 are r1r1r2r2r3r3r4r4. F2. the incidence of MYMV was governed by trigenic inhibitory interaction. The plants in the F 2 and back cross generations were classified as resistant (1-3) and susceptible (5-9) following Reddy and Singh (1990). Mottling and yellow discoloration of 25. in crosses Co5 X VBN (Bg) 4 and Co5 X VBG 66 the chisquare test for the expected ratio of 9:7 (resistant: susceptible) in F2 and 1:3 (resistant: susceptible) in B1 was not significant.. The goodness of fit to Mendelian segregation ratio for MYMV (resistance: susceptible) in the segregating population was tested by Chi square test.1 to 5. the chi-square test revealed that the F2 generation showed a expected ratio of 15:1 for resistance: susceptible and B1 showed a ratio of 3:1 (resistant: susceptible).0 per cent of the leaf area.1 to 10. Co5 X VBN (Bg) 4). while it was susceptible in the crosses KBG 98005 X VBN (Bg) 4 and KBG 98005 X VBG 73.0 per cent of the leaf area. Results and Discussion For the study of inheritance of MYMV disease resistance. In blackgram. In B2 generation. (1977) and Verma and Singh (1980) and in greengram Reddy and Singh (1993) and Selvi (2002) reported that the resistance was dominant over susceptibility. the chisquare test was non-significant showing fitness of the expected ratios of 15:49 (resistant: susceptible) and 1:1 (resistant: susceptible) in F2 and B2 generations respectively. resistance is dominant over susceptibility. (Co5 X VBG 73) and (Co5 X VBG 66) were found to be resistant to MYMV in F1. In the case of Co5 X VBG 73 cross.0 per cent of the leaf area. Mottling and yellow discoloration of 10.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Scales Percentage of plant foliage affected Mottling of leaves covering 0. Severe yellow mottling on more than 50. all plants were resistant. The segregation of MYMV resistance in the present study appeared to be governed by digenic complementary interaction as seen from the ratio of 9:7 (resistant: susceptible) in F2 of Co5 X VBN (Bg) 4 and Co5 X VBG 66. Reaction Resistant 1 3 Moderately resistant Moderately susceptible 5 Susceptible 7 Highly susceptible 9 The F1 of the crosses viz. Among these five crosses. B1 and B2 of five crosses was made and the results are . F2. The pattern of segregation in B1 (1 resistant: 3 susceptible) and B2 (all resistant) of these two crosses (Co5 X VBN (Bg) 4 and Co5 X VBG 66) also confirmed the result of complementary 130 Frequency) / Total number of plants scored. three crosses viz.. the Chi-square test for the deviation from the expected genetic ratios of the segregating generations viz. where the female parent was Co5. Dahiya et al. (Co5 X VBN (Bg) 4). presented in Table 1.1to 25. Mottling of leaves covering 5. In B2. In the crosses KBG 98005 X VBN (Bg) 4 and KBG 98005 X VBG 73.. In the segregating generations. all plants were resistant.0 per cent of the leaf area. (Co5 X VBG 73) and (Co5 X VBG 66) were resistant to MYMV.0 per cent and up to 100 per cent of the leaf area. All the plants in B1 were susceptible to MYMV. Therefore.1to 50. in the cross Co5 X VBG 73 the MYMV was governed by interaction of two duplicate genes (duplicate dominant genes). which act in complementation. The segregation ratio in B1 (3 resistance: 1 susceptible) and B2 (all resistant) also confirmed the ratio observed in F2. This revealed that. Hence. (1982). where the female parent was KBG 98005. The reason for the difference in gene action may be attributed to the presence of two different sets of genes in male parents of the crosses. . may have recessive alleles for an inhibitory gene (ii) apart from two sets of alleles already indicated. The allelic tests may be conducted by intercrossing Sl. 5. the segregation of F 2 showed a ratio of 15:1 (resistant: susc eptible). From the present investigation it was concluded that the MYMV was controlled by two and three genes with various types of interaction. REFERENCES Dahiya. A similar type of duplicate recessive genes for MYMV resistance in blackgram was reported by Verma and Singh (1980). Brar. (1985) and Shukla and Pandiya (1985) and in greengram by Selvi (2002).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era interaction (duplicate recessive genes) (Table 1). in the cross (Co5 X VBG 73).No. and J. inhibitory gene action was reported by various authors like Solanki et al.S. the gene symbols are allotted subject to confirmation by allelic tests. In the crosses KBG 98005 X VBN (Bg) 4 and KBG 98005 X VBG 73. 2. Kuldip. From the above discussion it was found that. recombination breeding with two or three cycles of recurrent selection is required to obtain desirable segregants of high yielding ability coupled with MYMV resistance. Parent Reaction to Gene symbol for MYMV MYMV resistance 1. it could be concluded that the male parents of these two crosses namely VBN (Bg) 4 and VBG 73 respectively. the following putative gene symbols are proposed for the parents involved in the five crosses: However. Shukla et al. In blackgram. Verma (1985).. Verma and Singh (1986) and Reddy and Singh (1990) and in greengram by Mishra and Asthana (1996) and Khattak et al. 3. (1978) and Singh (1980) reported the presence of duplicate dominant genes for MYMV in blackgram. 4. Sandhu et al. may have same alleles (R1R1R2R2). The male parents of the crosses (Co5 X VBN (Bg) 4 and Co5 X VBG 66) namely VBN(Bg) 4 and VBG 66. The female parent KBG 98005 of these two crosses may have a set of dominant inhibitory alleles (II) at a locus apart from recessive alleles for susceptibility to MYMV at four loci. 1977. From the above results. two different types of gene action of complimentary interaction in Co5 X VBN (Bg) 4 and Co5 X VBG 66 and duplicate interaction in Co5 X VBG 73 were noticed. Singh. Therefore. (2000). the F1 was found to be susceptible. However. The segregation 131 in B1 (all susceptible) and B2 (1 resistant:1 susceptible) also confirmed the trigenic inhibitory interaction. B.S. though the three crosses had same female parent (Co5). may have another set of non-allelic genes (R3R3R4R4). the male parent of the cross Co5 X VBG 73 namely VBG 73. However. The common female parent of all these three crosses. Co5 KBG 98005 VBN(Bg) 4 VBG 66 VBG 73 Susceptible Susceptible Resistant Resistant Resistant r 1r 1r 2 r 2 r 3 r 3 r 4 r 4 r1r1r2r2r3r3r4r4II R1R1R2R2ii R 1R 1 R 2 R 2 R3R3R4R4ii all the three male parents and studying the resistant pattern for MYMV resistance. namely Co5. which act in a duplicate manner. The segregation of F2 was observed to be 15:49 (resistant: susceptible). may have recessive alleles for all these four loci (r1r1r2r2r3r3r4r4). It showed that the reaction to MYMV was governed by trigenic inhibitory interaction. Sandhu and M. New Botanist. Tamil Nadu Agric. 1996. B.. Waldia. S. 22: 607-611. Univ. Appl. Verma.M.S. Univ. Pantnagar. Theor. Genet. p 290-296. Shukla.P. Inheritance of resistance to yellow mosaic in mungbean. Singh.Appl. 1978. PAU. G.G. Singh.Thesis. Ph. G. 1985. M. R. G.R. Reddy.S. T. Pandya.) Wilczek).U. D. 43: 240-242. Recent advances in mungbean research. and T..Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Incorporation of resistance to mungbean yellow mosaic virus in blackgram (Vigna mungo L.).. 2000..Univ. Mishra.S. and D. of Agric. 1985. J.S. Asthana. 1990. Theor. Plant Breed. Solanki. Research to yellow mosaic in greengram.P..P. 9: 28-32. India. Inheritance of resistance to mung bean yellow mosaic virus in greengram. Muhammad Ashraf. & Tech . 54: 237-243. I.P. 1982. K. In: International Symposium on Mungbean.S. 57: 233-235. R. Inheritance of resistance to mungbean yellow mosaic virus in the interspecific and intervarietal crosses of greengram and blackgram.D thesis. SABRAO J.. 1971. Nair. Verma.. Genet. Thesis. Pantnagar.S.N.S. Genet. Inheritance of yellow mosaic virus in blackgram (Vigna mungo(L. Agric. J.) Hepper). 72: 737 . Tropical grain legume bulletin. Plant Breed.P. Shukla. Indian J. Theor. 17: 165-171. Singh. R. Pandya.P. Brar. Res.. 17 : 99102.P. Thailand. J. 1993. and D.. 1988. Inheritance of resistance to mungbean yellow mosaic virus in blackgram. Elahi.. Inheritance of resistance to MYMV in blackgram.) Wilczek). Verma.S.P. India. The allelic relationship of genes giving resistance to mungbean yellow mosaic virus in blackgram.D.S. 80: 199-201. 1985. G. and D. Singh. 38: 357-360. 2002. Genet. Appl.. and D. Coimbatore. Genet. Dahiya and R. Breed. 132 .. and B. Kapoor and K. J.P.N. Singh. Verma. Genetics and molecular studies on mungbean yellow mosaic virus resistance as related to economic attributes in greengram (Vigna radiata (L) Wilczek). Sandhu.P.S. Inheritance of yellow mosaic virus resistance in mung bean (Vigna radiata (L. 55: 233-235. 1980.. S.. Indian J. B.. R.P.A. Selvi.Pant.P. 1986.P.. Reddy. G. K. Bangkok. and D. Resistance to mungbean yellow mosaic virus in blackgram. p 214-219..738. Inheritance of resistance to mungbean yellow mosaic virus. 2nd Nov 16-20. Genetics of Mungbean Yellow Mosaic Virus (MYMV) in mungbean (Vigna radiata (L. Singh. Madras agric.80 p. S. Khattak. 1980. Singh. and A. Genet.R.P.S.B.P.D. Haq.Studies on the yellow mosaic of urdbean caused by mungbean yellow mosaic virus Ph. Ph. Singh. Multiple disease resistance in mungbean with special emphasis on mungbean yellow mosaic virus. 44 0.30 – 0.30 0.50 – 0. Chi.15 0.20 – 0.21 1.45 0.50 – 0.20 – 0.70 – 0.31 0.30 0.59 0.50 0.50 9:7 1:3 0.70 – 0.square test for inheritance of Yellow Mosaic Virus disease resistance in Blackgram Observed values Generation Resistant Co5 X VBN(Bg) 4F1 Resistant 151 F2 31 B1 121 B2 Co5 X VBG 73 Resistant F1 254 F2 80 B1 120 B2 Co5 X VBG 66F1 F2 B1 B2 KBG 98005 X VBN(Bg) 4F1 F2 B1 B2 KBG 98005 X VBG 73 F1 F2 B1 B2 Resistant 172 35 115 Susceptible 111 71 20 30 146 80 Expected ratio F2 values Probability between 9:7 1:3 0.20 15:1 3:1 0.8 0.52 0.70 57 57 Susceptible 218 115 50 15:49 1:1 1.6 1.20 – 0.30 0.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1.30 0.50 133 .10 54 52 Susceptible 212 112 56 15:49 1:1 1.13 0. AP 3. Systematic germplasm evaluation has led to the identification of important sources of resistance like Eswarakorra. Rajendranagar.Ram Mohan Rao3 ABSTRACT Inheritance of gall midge resistance in rice variety MR1523 was studied by generating F3 families from individual F2 plants of various crosses and evaluating them against four biotypes in three greenhouse and two field tests at three locations. Abhaya (Gm4). Warangal 506 007. Central and East India causing significant yield loss mainly during kharif season. Directorate of Rice Research. W1263 (with Gm1). Gm1. Leuang 152 etc. ecologically acceptable approach for the management of the gall midge. resistance to gall midge has been found to be conferred by a single dominant or (as in case of gm3) a recessive gene (Kumar et al. Srikakulam Dist. so far. ARC 5984 (Gm5).. 10 major genes conferring resistance (Kumar et al. 2003) which have been extensively used in breeding resistant varieties. J. Material and Methods The rice variety CR94-MR1523 (Ptb18/ Ptb21//IR8). Breeding rice varieties with pest resistance has been a viable. Gm2 and unidentified gene (s) in Ptb21 conferring immune level of resistance. F1 seeds (direct and reciprocal crosses) 1. Hyderanad 500 030. developed at CRRI.. P.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era COMPLEX INHERITANCE IN RICE VARIETY MR1523 OF RESISTANCE TO GALL MIDGE BIOTYPES Suneetha. sources deriving resistance from Ptb18 and Ptb21 have displayed complex pattern (Kalode and Bentur 1989). 2005). K.. C.. and with other resistance sources with unknown gene(s) like Bhumansan. Introduction The Asian rice gall midge Orseolia oryzae (Wood-Manson) is a serious pest of rice in certain regions of South. 2005). K1. derivative from Ptb21. in order to understand this complexity. Cuttack involving Ptb 21 with unknown resistance gene(s) was crossed with the susceptible check TN1 as well as with the varieties with known resistance genes viz. Results suggested involvement of two genes conferring resistance against biotypes 1 and 3. ANGRAU. Seven distinct gall midge biotypes have been characterized so far (Vijaya Lakshmi et al. However. (see Bentur et al. 134 . P. Ptb18. Phalguna (Gm2). Vijaya Lakshmi1.. Agricultural Research Station. While reciprocal crosses did not confirm to the ratio observed with straight cross. AP 2.S. Cheeralu2. Ptb21. 2005).. RP2068 (gm3). Bentur1. rapid development of virulent biotypes capable of overcoming the host plant resistance has been posing problem in recent years. Banglei. In most of the studies. Ragolu 532 484. NHTA8. Hima Bindu1. Siam 29. one dominant gene against biotype 4 and none against the new biotype 4M. Agricultural Research Station.. We are attempting to identify these genes with closely linked known SSR markers. Interactions of the two genes were different against the two biotypes used in greenhouse tests. allelic tests with varieties having known resistance genes were also inconclusive. Genetic studies have identified. ANGRAU. Exceptionally. These crosses were made in kharif 2000. Most of the 60 plus gall midge resistant rice varieties developed to date contain one of the three major genes viz. Aganni and ARC 6605. some of them being selected as direct consequence of extensive cultivation of these varieties. We studied the genetics of resistance in the rice variety MR1523. Since allelic tests through crosses involving MR1523 with known gene sources did not reveal identity of the possible 2-3 genes in MR 1523. This type of reaction showing resistant for biotype 3 and susceptibility for biotype 1 has not been observed earlier in any of the cultures. The single gene conferring resistance in MR1523 against biotype 4 has been overcome by the newly reported biotype 4M (Vijaya Lakshmi et al. we propose to investigate using gene linked markers. Of these. Preliminary reports showed non-allelic amplification when Gm1 linked SSR markers RM444 and RM219. Four of the cultures. Gm2 linked marker RM241 were used for amplifying genomic DNA from MR1523. Interestingly.. Few of the cultures identified in the present studies are being tested under AICRIP trails.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era were grown in rabi 2000. 2005). reciprocal crosses between TN1 and MR1523 did not show similar ratios. only one gene was effective against biotype 4. For biotype 4 single dominant gene segregation ratio was observed. These two genes interacted differently against biotypes 1 and 3. 1-44 percent damage as heterozygous and zero damage was considered as resistant.3 and 4 (DRR. Results and Discussion Results revealed a complex segregating pattern of resistance depending upon the biotype used for evaluation (Table 1). respectively. 2005). derived from crosses MR1523 x RP2068 and MR1523 x Abhaya. 3 and 4 during kharif 2002. Individual families were scored for resistance reaction. Chi-square test was carried out to test the goodness of fit for various segregation ratios. For biotype 1 the interaction appeared as one dominant and one recessive gene while for 135 biotype 3 two dominant gene interaction was evident. Crosses between MR1523 and rice varieties with known and unknown gall midge resistance genes did not show any distinct segregation pattern suggesting higher order of interaction and possible involvement of cytoplasmic inheritance. RP 4516-3-8 and three selections of RP4518. Families derived from the cross MR1523 x TN1 showed segregation ratio of 13 resistant: 3 susceptible families when evaluated against Biotype 1. F3 families consisting of progeny from individual F2 plants were evaluated in field at Ragolu and Warangal and in greenhouse at DRR against gall midge biotypes 1. While two genes contributed resistance against biotype 1 and 3. Progenies showing plant damage of 45 per cent and above were considered to be susceptible. 2005). Thus it is apparent that genes controlling gall midge resistance in MR1523 interact differently against different biotypes tested. Individual F2 plants were raised in kharif 2001. identified in the present studies were nominated for multi location testing under AICRIP trials and showed a wide spectrum of resistance against gall midge biotypes across the locations (DRR. unknown genes that are suspected to be present in MR1523 have been segregated and fixed in different lines which would serve as prebreeding material for breeding and genetic studies. RP4510-175 and RP4510-177 recorded resistance against biotype 3 while being susceptible to biotype 1 while RP4510. However. Nil damaged families across the locations/tests were identified and these were advanced to F 4 and F 5 generations and then tested in All India Coordinated Rice Improvement Programme (AICRIP) for two years (2004 & 2005). Thus. Hyderabad. REFERENCES . 15:1 ratio against Biotype 3 and 3:1 ratio against Biotype 4 in greenhouse test at DRR.260 showed resistance against the biotypes 1. variations noted in reciprocal crosses need further investigation for a better understanding. Other gene specific markers are being studied. . S. C. Hyderabad. p-54-55..3 and 4 in greenhouse at DRR. 10 : 219-224. Sarma.2005..Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Bentur. Bentur.. P. Mohan. 45: 1631-1635. K. Table 1. R. Applic. 2. U. Vijaya Lakshmi. Reaction of F3 families derived from the cross between MR1523 and TN1 against rice gall midge biotypes 1. 20pp.01) 158 188 139 39 6 48 13:3 15:1 3:1 0. Orseolia oryzae (Wood-Manson) (Diptera: Cecidomyiidae). Punjab Agricultural University.Insect Sci. Directorate of Rice Research. India. A. Sahu. M. B. M. Jain.S.30 0. DRR Research paper Series 01/2003.14 3. A. A new gall midge biotype characterized from Warangal population in Andhra Pradesh..05). S: susceptible 136 . Crop Sci... J. Kumar. DRR (Directorate of Rice Research) 2005. Ludhiana.63(0. Hyderabad.1989. Characterization of Indian biotypes of the rice gall midge. Pasalu. J. P. 2005. Hyderabad and in field at Ragolu (Biotype 4) Cross Biotype Number of F3 families Tested Resistant Susceptible MR1523 x 1 197 TN1 MR1523 x 3 194 TN1 MR1523 x 4 187 TN1 F2 (tab) value: 3. Amudhan.84(0.. I. M. Progress Report for 2004. N.. B. Nair. Genetic analysis of resistance genes for the rice gall midge in two rice genotypes.. 2. S. Bentur. Mishra. S. 2003.. Kalode. 6.14p.. Shrisvastava. Gall midge resistance in rice. Vol. N. Prasada Rao.Indian society for the advancement of insect science. In: Proceedings of 1 st Congress on insect science 15-17 December. 2005.04 Ratio(R:S) F 2 value (calculated) R: resistant including heterozygous.S. Directorate of Rice Research. J. among which jassids cause considerable yield reduction. aims in assessing the relationship between trichome density and the 1 2 jassid resistance in a group of genotypes with a view to develop basic breeding material for evolving jassid resistant varieties. Among the BC1 (KC 2 × MCU 12) × KC 2 recorded highest mean trichome density of 24. when compared to 14. Coimbatore. CPBG. R. it plays a prominent role in economy through foreign exchange earnings.88 per microscopic field of observation in MCU 5 and MCU 12 respectively.com) 3 Associate Professor (PB&G).42. In F3. three F1’s. Kumar ABSTRACT A study was taken up to evaluate the number of trichomes present in the leaf as related to jassid resistance. (1949) indicated that the hair length is most important and if length is maintained increased hair density confers more resistance. KC 2 x MCU 12 and MCU 15 x MCU 12). Among the traits related to jassid tolerance trichome density is the primary indicator.20.85 of (KC 2 × MCU 5) × KC 2 and (MCU 5 × MCU 12) × MCU 5 respectively. The materials were grown in Randomized Block Design (RBD) with three replications at the Department of cotton. MCU 5] and three B2’s [(KC 2 x MCU 5) x MCU 5.81 of (KC 2 × MCU 5) × MCU 5 and (MCU 5 × MCU 12) × MCU 12 respectively.11 and 17. F2' s and F3’s (KC 2 x MCU 5. TNAU Associate Professor (Cotton). MATERIALS AND METHODS The experimental materials comprised three parents (KC 2. S. Three cultivars KC 2. In F2 population the mean trichome density ranged from 15. (KC2 x MCU 12) x KC 2. CPBG. (KC 2 x MCU 12) x MCU 12. Tamil Nadu Agricultural University. and (MCU 5 x MCU 12). TNAU.16 when compared to 19.33 to 21. CPBG * Corresponding Author (chithuragul@gmail. INTRODUCTION Cotton. MCU 5 and MCU 12). Data on ten randomly PG Scholar. This positive relationship between trichome density and jassid tolerance was also confirmed through artificial screening. For managing the jassids farmers spend lot of money through chemical sprays. the trichome density ranged from 14. In BC2 the (KC 2 × MCU 12) × MCU 12 recorded highest trichome density of 21. Parnell et al. Coimbatore – 3 137 . For reducing the use of chemical insecticides and in turn the input cost evolving jassid resistant genotypes is the need of the hour. Among the parents KC 2 recorded highest trichome density of 26.38 and 14.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era LEAF TRICHOME DENSITY – AN INDICATOR OF JASSID TOLERANCE IN COTTON Kannan. In India. the “White Gold” is an important commercial and industrial crop of many countries. The present investigation.33).17 and 17..02.15 when compared to 20.48 than KC 2 × MCU 5 (15. This crop is affected by number of insect pests. The lowest value was observed in MCU5 × MCU 12 and highest value had been observed in KC 2 × MCU 12. and (MCU 5 x MCU 12) x MCU 12]. The lowest value was observed in MCU 5 × MCU 12 and the highest value in KC 2 × MCU 12. The F1 KC 2 × MCU 12 registered more trichome density of 21. The parent KC 2 when used as female has contributed more trichome density in the F1 as well as in the segregating populations. their F1 and segregating populations F2 and F3 and backcrosses BC1 F1 were screened.47) and MCU 5 × MCU12 (14. MCU 5 and MCU 12. three B1’s [(KC 2 x MCU 5) x KC2. therefore. The materials were sown in two rows of each replication with 6m length and spacing 75 x 30 cm. Ravikesavan and M.53 to 20. Among the parents KC2 recorded highest trichome density of 26. The ‘m’ component was significant in all the crosses and the values ranged from 0.52 and 2. Stomatal number: The scales A and B . For this character also KC 2 and the combination of KC 2 x MCU 12 recorded the lower number of stomata.02 mm in KC 2 x MCU 5 to 0. The leaf thickness was found to be positively related to jassid tolerance and the genotype KC 2 and the cross combination of KC 2 x MCU 12 recorded more leaf thickness compared to other combinations. (2002) have studied the trichome density and reported that trichome density had a positive correlation with jassid resistance and on the other hand glabarous trait gives tolerance to the boll worms.9) had low grade index compared to KC 2 x MCU 5 (2. when compared to 14. which is significant in all the crosses. In F1.65.84 grade index respectively.Ravikesavan et al.04 mm in KC 2 x MCU 12. RESULTS AND DISCUSSION The observations on three morphological characters which are found to confer jassid tolerance were recorded and the mean and range presented in Table 1.55 of KC 2 x MCU 5 and MCU 5 x MCU 12 respectively. The results of joint scaling test presented in table 3 also indicated the inadequacy of the data to fit simple additivedominance model for all crosses. The parents MCU 5 and MCU 12 registered 2. the grade index of KC 2 x MCU 12 was 1. Similarly Tidke and Sane (1962) reported that thicker leaves 138 conferred resistance to leaf hopper.16 and 2. The scales B and C were significant in all the crosses. This character is found to be negatively correlated with jassid resistance. The leaf thickness was measured using screw gauge. the grade index of KC 2 x MCU 12 was 1. In artificial screening the lowest grade index was recorded by parent KC 2 (1. This is conformed by chi-square test values.11 and 17. B1 and B2 generations the cross of KC 2 x MCU 12 was found to have more trichome density than other crosses. stomatal counts (per mm2 leaf) and leaf thickness (mm)was assessed. Jassid resistance index was also calculated as proposed by Nageswara Rao (1973).78 whereas 2. F2.01 mm in MCU 5 x MCU 12. The [d] and [h] components were significant in KC 2 x MCU 12.88 of MCU 5 and MCU 12 respectively.26) and MCU 5 x MCU 12 (2. Among the F1 KC 2 x MCU 12 (1. Joint Scaling Test and Genetic Effects Leaf thickness: Scale A was significant in KC 2 x MCU 5. Artificial screening was done for parents and the segregating population and the jassid injury index of different genotypes is tabulated (Table 2).05 mm in KC 2 x MCU 12 and KC 2 x MCU 5. The [i] component was significant in KC 2 x MCU 5 and KC 2 x MCU 12 and the values ranged from 0. Sivasubramanian et al. However Shima Bhaskaran (2004) reported that there is no relationship between stomatal count and jassid resistance. The hopper burn injury was assessed as per the Indian Central Cotton Committee (ICCC. when compared to 2. Stomatal counts were recorded per mm2 leaf area under microscope. The [j] component was significant in KC 2 x MCU 5 and MCU 5 x MCU 12 and the values ranged from -0.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era selected plants in each genotype/population were collected and trichome density (per microscopic field).04 mm in MCU 5 x MCU 12 and 0. 1960) methods and based on resultant symptoms of infestation. In F3 population.02.63).48 and 1.7 of KC 2 x MCU 5 and MCU 5 x MCU 12 respectively.0). In F2 population. The [l] component was non significant in all the crosses (Table 4).01 mm in MCU 5 x MCU 12 to 0. (1991) reported that the number and weight of hairs were higher in resistant than susceptible cul tivars. When KC 2 was used as female parent in the crosses. [i]. S. The results of joint scaling test are presented in table 6 which indicated the inadequacy of the data to fit simple additivedominance model for all crosses. The [h] component was significant in all the crosses and the values ranged from -10. R. S. Artificial screening also indicated similar results.87 in KC 2 x MCU 12.13 in KC 2 x MCU 12 to 17.33 in MCU 5 x MCU 12 to 19.. The values ranged from 47. This is conformed by Chi-square test values that were significant for all the crosses. The results of joint scaling test presented in table 3 indicated the inadequacy of the data to fit simple additivedominance model for all crosses.46 in KC 2 x MCU 12 in [h] component. The [j] component was positively significant in KC 5 x MCU 12 (Table 5).Mohan and .16 in KC 5 x MCU 12 to -84. Madras Agric. The [d] component was significant in KC 2 x MCU 12. Ravikesavan. An index for jassid resistance in cotton. C.80 in MCU 5 x MCU 12 to 172. H. F. In the present study both additive and dominance components were significant for the crosses and hence reciprocal recurrent selection or multiple crossing can be used for further improvement of the traits under study in the respective crosses. The values of [i] component ranged from 34.64 in KC 2 x MCU 12 to 95. Res..07 in MCU 5 x MCU 12 to 11. The [h].22 in KC 2 x MCU 12. 1973.00 in MCU 5 x MCU 12.97 in MCU 5 x MCU 12 to 161.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era were significant in all the crosses. toughness of leaf veins. The values ranged in [l] component from -312. This study revealed that the trichome density is the primary indicator for jassid resistance. Parnell.Parame shwari. The [d] component was significant in KC 2 x MCU 12. The trichome density and leaf thickness were positively correlated with jassid resistance. The scale B was significant in KC 2 x MCU 12 where as scale C was significant in MCU 5 x MCU 12. the parent KC 2 was resistant to jassid. and angle of leaf insertion are positively related to leaf hopper resistance. MCU 12 moderately resistant and MCU 5 susceptible to jassids.Raveendran. The ‘m’ component was significant in all the crosses and the values ranged from 66. The [j] component was significant in KC 2 x MCU 5. Trichome density: The scale A was significant in KC 2 x MCU 5 and KC 2 x MCU 12. Jassid resistance and hairiness of the cotton plant. This is also conformed by chi-square test values that are significant in all the crosses. length of hair. Ent. while the scale C was significant in KC 2 x MCU 12. Screening of segregating generation will result in high yielding plants having better resistance to leaf hopper.R.73 in MCU 5 x MCU 12 to 8. thickness of leaf lamina. J. Ruston. Among the genotypes. The stomatal number had negative correlation with jassid resistance. Further. The overall scenario indicated that parent KC 2 had high trichome density and leaf thickness which makes it tolerant to jassid. Bull.73 in MCU 5 x MCU 12. 39: 539-575.47 in KC 2 x MCU 12. leaf hairiness. REFERENCES Nageswara Rao. The [l] component was significant in 139 KC 2 x MCU 5 and KC 2 x MCU 12 and the values ranged from -20. studies in isolating jassid resistant progenies are in progress. King and D. T.Suganthi. The ‘m’ component was significant in all the crosses and the values ranged from 17.80 in KC 2 x MCU 12. 1949. the trichome density was more when compared to the other crosses.E.F. P.S. and [l] components were significant in all the crosses. The [i] component was significant in all the crosses and the values ranged from -9. 60: 264-266.51 in KC 2 x MCU 5 (Table 7). Uthamasamy (1994) also reported that the morphological traits such as leaf thickness. ) Thesis. Jassid resistance and morphology of cotton leaf. physiological and biochemical futures associated were biotic and abiotic stresses in cotton cultured derived through introgressive breeding.). Genetic and anatomical studies on jassid resistance in cotton (Gossypium spp. 1994. TNAU. Paper presented in the 2nd meeting of the Asian cotton research and development network “New Genetical Approaches to Cotton Improvement’’ held on November 14-16. Sivasubramaniyan. Amrasca devastans (Dist. India. XVI (6): 324-327. Grow.Surendran. S.). 1962. Madras Agric. Gossypium spp. to the leafhopper Amrasca devastans (Dist. Uthamasamy. J. Uzbekistan. Gossypium spp. Resistance in cotton. 2002. 1991. Morphological. Indian Cott. 14-17.. Proceedings of the World Cotton Research conference.M. (Ag. Coimbatore. K. Australia pp. P.2002. M. 140 . Shimna Bhaskaran. 2004.sc. Host resistance to the leafhopper. Tidke. P. and Parvathy. 78 (1-4): 80-81.) in cotton. and Sane.. P.V. Uthamasamy. Rev.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era C. S. Tashkent. 05-0.07 0.33 95.51 0.04-0.03-0.05 0.05-0.67 119.04-0.05 MEAN 0.04-0.06 0.04 0.61 18-22 18-24 12-16 19.05 0.04-0.06 0.05 0.33 99.05 0. Mean of Morphological characters related to jassid resistance in cotton Characters Leaf Thickness (mm) Stomatal Counts mm2 Trichome Density / / leaf microscopic field Genotypes RANGE 0.05-0.05 0.91 20.79 16.049 0.67 124 108.04 0.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1.84 141 .04-0.47 21.04 0.33 127.88 15.06 0.32 14.33 112.26 19.04 0.05 0.15 17.33 105 110.85 Parents KC 2 MCU 5 MCU 12 F1’s KC 2 X MCU 5 KC 2 X MCU 12 MCU 5 X MCU 12 F2’s KC 2 X MCU 5 KC 2 X MCU 12 MCU 5 X MCU 12 F3’s KC 2 X MCU 5 KC 2 X MCU 12 MCU 5 X MCU 12 B1’s (KC 2 X MCU 5) X KC 2 (KC 2 X MCU 12) X KC 2 (MCU 5 X MCU 12) X MCU 5 B2’s (KC 2 X MCU 5) X MCU 5 (KC 2 X MCU 12) X MCU 12 (MCU 5 X MCU 12) X MCU 12 Overall mean Standard Error (SE) 0.04 0.74 3.03 0.05 0.02 14.05 0.33 110.33 17.05 0.09 0.05 0.04 0.04-0.03-0.38 21.33 92.48 14.33 139.06 0.92 20.05 0.05 0.003 99-108 89-96 104-116 103 92.05 0.16 14.06 0.03-0.67 121.04-0.13 17.05 0.33 109.04-0.17 24.08 0.67 23-28 9-15 10-19 11-18 18-22 13-15 14-20 14-24 14-20 12-18 16-22 12-17 16-22 18-26 14-20 26.05 0.06 0.67 139 107.81 18.05 RANGE 82-91 106-117 98-112 106-114 114-127 116-126 121-135 90-105 135-144 104-112 88-96 135-143 92-105 114-132 104-116 MEAN RANGE MEAN 86.06-0.04-0.05 0.05-0.06 0.07-0.11 17.06 0. 00 2. 2.26 Injury index: 0.1 – 2.1 – 3. 1.48 1.63 2.52 1.55 1.70 2.0 : Resistant.16 1. Jassid injury index Injury index Parents KC 2 MCU 5 MCU 12 F1’s KC 2 X MCU 5 KC 2 X MCU 12 MCU 5 X MCU 12 F2’s KC 2 X MCU 5 KC 2 X MCU 12 MCU 5 X MCU 12 F3’s KC 2 X MCU 5 KC 2 X MCU 12 MCU 5 X MCU 12 1.84 2.0 : Moderately resistant. 3.1 – 4.1 – 1.90 2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 2.0 : Highly susceptible 142 .78 2.0 : Susceptible.65 2. 00 r 0.00 0.96 172.32 47.00 KC 2 x MCU 12 -0.63** KC 2 x MCU 5 -0.01** r 0.00 r 0.00 0.00 0.01 r 0.02* r 0.22** r 5.77 34.01* r 0.01 -0.60 r 2.58** r 1.06** r 0.86 89.00 MCU 5 x MCU 0.02 r 0.Table 3.04** r 0.22 [h] 61.00 12 -32.01 -0. Genetic effects for leaf thickness (mm) m 0.87 19.74 141.01 0.37** r 2.00 r 0.07 r 3.12** -0.16** r 10.02** r 0.00 0.42 15.05** r 0.44 161.64** r 0.00 r 0.01 r 0.29** r 8.85 [i] 53.01 -0.01 r 0.00 0.38 66.00 r 0.44** 996.79 Crosses KC 2 x MCU 5 KC 2 x MCU 12 MCU 5 x MCU 12 M 83.03* r 0.97** r 8.62** 24.02* r 0.28 45.00 89.73 r 3.01 KC 2 x MCU 12 MCU 5 x MCU 12 Table 5.60** r 3.00 0.78 r 7. Scaling and Joint scaling test for leaf thickness (mm) and stomatal counts (Leaf area / mm2) Scaling test for leaf thickness (mm) B C Joint scaling test J2 value A Crosses A Scaling test for stomatal counts (Leaf area / mm2) Joint scaling B C test J2 value 0.29** r 6.02** r 0.47** r 4.40 37.53 [l] -119.01 -0.00** r 1.69 -0.28** 51.00 [l] Second National Plant Breeding Congress 2006 29.36** 115.01 0.94 -312.00 0.81 -84.33** r 4.33** r 6.01 0.73** r 14.00 13.01 0.80* r 8.96 Plant Breeding in Post Genomics Era * Significant at 5 % level ** Significant at 1 % level .88 36.95 95.82** r 13.02** r 0.46** r 6.05** r 0.67 25.01 -0.56 24.01 [d] [h] [i] [j] -0.02 **r 7.00 0.01 r 0.17 -4. Genetic effects for stomatal counts (Leaf area / mm2) [d] -8.03** r 0.01 -0.01** r 0.02 r 0.33** r 5.63 r 3.32 Table 4.01* r 0.60** r 3.00 -0.53 [j] -4.73** r 2.13 r 7.04** r 0.96 Crosses 143 KC 2 x MCU 5 -0. 98*r 2.49 -10.53** r 1.35 9.80** r 1.22 8.73 r 1.47* r 2.20 r 0.39 -9.35 19.07** 4.42 4.20 r 1.67 r 0.35 17.73 -20.53* r 0.73 r 3.40** r 1.Table 6.80 r 1.13** Table 7.90 0.99 51.91* r 2.07* r 1.73** r 2.04** r 0.99 [j] -3.77 [h] -7. Genetic effects for trichome density / microscopic field [d] 2.56 r 1.79 4.94 25.02 1.63 144 Crosses KC 2 x MCU 5 KC 2 x MCU 12 MCU 5 x MCU 12 m 19.51** r 3.38 -2.13* r 4. Scaling and Joint scaling test for trichome density / microscopic field Crosses Second National Plant Breeding Congress 2006 KC 2 x MCU 5 KC 2 x MCU 12 MCU 5 x MCU 12 Scaling test for trichome density / microscopic field Joint scaling A B C test J 2 value -8.91 30.34 8.87* r 2.11 11.53 -3.27 r 0.33 r 1.97 0.13* r 1.31 * Significant at 5 % level ** Significant at 1 % level Plant Breeding in Post Genomics Era .33** r 0.24 -1.69 -2.80** r 0.00 r 1.13** 1.11 [i] -6.86 [l] 17.53* r 0. officinarum group had high heritability coupled with moderate genetic advance for brix and sucrose.The higher estimates of heritability coupled with higher genetic advance for number of millable canes and moderate sucrose indicated that the heritability of the traits is mainly due to additive effects and selection would be effective for these traits.officinarum x S. spontaneum and 342 S.officinarum group over S.officinarum x S.. cane height.robustum x Commercials / S.cane weight.barberi and S.8%) for cane height to high (73.82% for cane diameter to 62. Price (1965)..Roach (1968).High heritability combined with low genetic advance for single cane weight indicates the role of non additive effect.officinarum x S.robustum x commercial /S. which have been evolved from a small programme of generationwise polycrossing and selection for yield and quality within this species.robustum x commercials /S. Heritability was moderate for sucrose in both the groups.Shanthi ABSTRACT Evaluation of 781 (439 S. Coimbatore. Walker (1987) reported that a range of improved nobles is available for utilisation.officinarum ) hybrid progenies for cane yield and quality traits revealed differences between the groups for number of millable canes.officinarum x S.com 145 . Dunckelman and Breaux (1971) and Roach (1977)]. R.spontaneum for cane thickness.In this connection the statement of Hawkes ( 1977) that in most crops the need for a wider genetic base is strongly apparent and this can be generally provided from wild species and primitive cultivars is quite relevant. as the genetic gain in recent years has declined for many yield and quality attributes. S.spontaneum group. cane weight and juice quality characters.The wider genetic base is essential to have a better genetic gain for longer term and in sugarcane this is all the more needed.641 007.officinarum group.robustum x Commercials / S. Introduction Genetic variability is essential for any successful crop improvement and use of wild germplasm in broadening the gene base need no emphasis.87% for brix in S. India nagarajan_sbi@rediffmail. Heritability was 38.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era VARIABILITY FOR YIELD AND QUALITY ATTRIBUTES IN INTERSPECIFIC PROGENIES OF SACCHARUM SP Nagarajan.M.Initial involvement of a few clones from the cultivated S. Mean performance of the traits under study revealed the superiority of the S.spontaneum group can be exploited in producing elite hybrids after back crossing and nobilization. Heritability was moderate (33.officinarum . brix. Apart from base broadening.sinense and wild S. interspecific hybridisation programme is important considering the increase in sugarcane area under adverse environments and many diverse use sugarcane is put into besides conventional sugar production. S.S. Narrowing of genetic base with slow rate of genetic improvement warranted the need for widening the genetic base by exploiting unutilised clones of cultivated and wild species of Saccharum in breeding programmes [Arceneaux (1965) . sucrose and yield in F1 for further use.Alarmelu and R.18%) for single cane weight in S. S. sugarcane breeding have been a sort of closed one though not strictly inbreeding. He also indicated that these improved nobles must form Sugarcane Breeding Institute.Over the decades.spontaneum in the beginning of the century provided the genetic base and needed variation for the varietal improvement in sugarcane for many decades. Observations on NMC. 7 S.The progenies were selected at seedling stage based on economic traits and the hybridity of the progenies was confirmed by distinct features of the species. This resulted in a number of improved clones of S. The population had low genotypic variance. S.officinarum and S.The developed improved clones of the three species were utilised in crossing and the progenies from two different nobilized groups involving improved S.The data were tabulated and statistically analysed to derive heritability. Cane diameter The mean values were low with a range of 1.cane length.spontaneum confer vigour .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era a better base for sugarcane improvement. R Brix were recorded. GCV and genetic advance was observed high for the trait.officinarum.82.heritability and GA. 12 S. cane diameter. There were many individual clones in this group possessing high NMC.47-2.spontaneum progenies Number of millable canes The mean value was high (99. cane height. Results and Discussion The mean. Materials and methods Improved clones of S. cane diameter. Similarly selected clones of S. sucrose.single cane weight and sucrose were recorded. heritability .spontaneum and S. Heritability and genetic advance were low indicating the .spontaneum.high tillering. which need further improvement through backcrossing.PCV.genotypic and phenotypic variance.spontaneum and S.spontaneum and S. Cane height For cane height. S. genetic advance. Cane yield/ plot was estimated as a product of number of canes /plot and single cane weight. heritability and genetic advance for further exploitation. As expected the canes were thin due to high stalk populationwhich is probably due to predominant influence of S. spontaneum and 342 S. officinarum followed by intercrossing among themselves and the progenies were subjected to selection for economic attributes through seedling and clonal stages.spontanuem.The improved clones developed were utilised in crossing and evaluated to study the genetic parameters in F1 population and exploit them for sugarcane improvement.The results are discussed below. data on number of canes /plot (NMC).officinarum.28 nmc) combined with a wide range of 27-170. the population had high mean (200.67 cm). a) S.single cane weight and H.GCV and PCV(Singh and Chaudary.The selected progenies along with checks were evaluated in 1R with 3m plot size in randomized block design with two replications.clones of S.Data on ten quantitative charcaters were recorded using standard procedures. The experimental material comprised seven hundred and eighty one (439 S. PCV. phenotypic variance.officinarum clones are known to impart sucrose genes.The crop was given normal package of practices and monitored.robustum x Commercials /S. GCV and coefficient of variation for various cane yield attributes and juice quality parameters for the two groups under study are presented in Tables 1 and 2 ..officinarum x S. wide range (135-260) and low genotypic and phenotypic variance. range.spontaneum utilised in the present investigation were developed by selecting clones of S. In general.robustum and 5 commercials clones. officinarum.robustum were assessed for genetic variability.1985). At the age 146 of 12 months. resistance to biotic and abiotic stresses and wider adaptability and S.robustum were also used in a crossing and selection cycle to produce improved clones of S. brix.robustum for biomass and fibre.officinarum x S. The other genetic parameters viz.robustum.officinarum) hybrid progenies from 30 crosses involving 9 S. officinarum x S.0 % were identified. Walker (1971) also reported low ranges for total sugars in such hybrid populations of S. In general.12%) with a moderate range of 9. Quality parameters Brix The mean value was generally low for brix (13.spontaneum.8 to 1. Cane yield High mean (53. This might be attributed due to the 2n+n chromosometransmission in S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era role of nonadditive genes for cane height. Improvement in single cane weight is essential along with good cane population to boost the cane yield.01).Variation was also very substantial for this important attribute which is neccessary for effective selection.spontaneum and n+n transmission in commercial clones x S.spontaneum crosses had slightly higher values when compared with hybrid x S. The hybrid progenies involving . moderate to high GA was observed indicating the role of nonadditive effects in control of the character. Cane population in general was lower in crosses involving S.58. This improvement is possible through improved cane diameter in backcross generation without reduction in F1 vigour.0 kg. 1968. coupled with high heritability and GA for two important components NMC and single cane weight can be exploited to improve cane yield in this group.officinarum clone or a good commercial clone is required to improve cane thickness. The presence of wide variation. Moderate to high genotypic and phenotypic variances was observed for the trait. and sucrose (9.spontaneum compared to commercial variety x S. officinarum parental stocks indicating the higher potentiality of their interspecific hybrid population for cane yield.spontaneum.47 kg/row) and range (27. Sucrose The mean value was generally low for sucrose (9. although individual clones from families recorded single cane weight of around 0.spontaneum (Pers.65. Mean single cane weight was in general low.officinarum x S.40 .officinarum x S.75 to 103.1977).74%) with a moderate range of 5. Variation for this character was found to be moderate.14.74%). high genotypic and phenotypic variances. Though the population mean in general was low from commercial point of view. Selection of parents for backcross and subsequent selection in backcross generation are very important to harness the benefit of improved S.Similar results were also reported in F1 progenies of S. high heritability (0. Single Cane weight Low mean values (0.spontaneum. Heterosis for cane yield was observed by Roach. Moderate to high genotypic and phenotypic variances was observed for the trait. The studies clearly showed the superiority of this group for cane population. 1968. But in respect to cane diameter and single cane weight. Though high cane population/plot was observed. a number of types with brix above 17.The group recorded higher cane yield in comparision to commercial varieties and S. S.spontaneum clones.2-17.comm). GA % mean was high due to moderate heritability and high variability for sucrose.officinarum and S.27-1.29) with low heritability.officinarum clones and wild S.officinarum x S.average cane diameter showed considerable reduction . canes were thin which is normally expected and certainly back crossing either to a different S.1977.7318) and GA as% mean was observed for single cane weight.56 kg) with wide range (0.spontaneum 147 (Roach. The presence of high PCV and GCV indicates the dominance of additive gene effect for the expresssion of the trait.. 67.officinarum x S.00% with a wide range between 11. High magnitude of phenotypic variance with moderate genotypic variance and low heritability (37.5 was observed for the trait. Genotypic variance. Cane yield For cane yield the overall mean was low (30. Single cane weight Single cane weight had higher magnitude of GCV and PCV and moderately high genotypic variance and phenotypic variance.46 kg / row) and ranged from 12. PCV.Though the heritability was high (63. High mean (16.57) combined with narrow range (1.genotypic variance . Juice quality parameters particularly sucrose showed moderate heritability and high GA as % mean indicating that selection will be effective for sucrose % and it will be moderate for brix %. b) S.robustum progenies with a wide range of expression. Brix The group had a high mean of 19. phenotypic variance. GCV and PCV were high.00 -262. The higher estimates of heritability (65. The other genetic parameters viz.5).0%).robustum The mean values for all the characters except number of millable canes were higher in S.2-23. heritability and GA was very low . High heritability combined with low genetic advance and high GAas % mean for single cane weight indicate higher role of additive gene in governing the trait. Higher magnitude of GCV and PCV with moderate heritability was observed in the population.officinarum x S. Cane height Cane height registered a high mean value of 216.12 -21.74. Moderate GCV and PCV with moderate GA though GA % as mean was low was observed for the triat. Number of millable canes Cane diameter High mean (2. phenotypic variance .75 -57. genotypic variance and phenotypic variancewas moderate.spontaneum as suggested by Walker (1971) could be utilised for identifying genetic stocks with increased sugar content and better adaptability.0%) coupled with higher genetic advance for nmc indicated that heritability of the trait is mainly due to additive effects and selection is effective for such trait.. GCV and PCV.48-1. Earlier studies (James. phenotypic variance .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era S.32 %) with wide range (8.963 kg) with a narrow range of 0.High heritability coupled with moderate GA as % of mean suggest that selection will be effective for sucrose.42cm with a wide range (180. The group mean was high (0.3 %.20) was observed in this group.. Sucrose The GCV. 1971) emphasized the importance of number of stalks as the most reliable character on which selection has to be based High heritability coupled with moderate genetic advance was observed for single cane weight and cane diameter which needs further improvement through nobilization.GA % mean was low indiacting low variation for the trait in this population.officinarum x S.61%) was observed in the population.33%) was observed for the trait. Heritability and genetic advance was maximum for nmc indicating the reliability of this trait in selection of parents for hybridization.67-3. The trait had low magnitude for genotypic variance.75-50. . Genetic advance as % of mean was high which may be due to high variation in the population and enough variability for the trait. The superior mean performance for the quality and yield attributes may be due to better 148 A wide range of 13. GCV in progenies involving improved S. 149 .spontaneum progenies had moderate brix and low sucrose low which suggests the need of back crossing to improve the trait.robustum progenies had substantial increase for juice quality parameters and compared well with progenies of crosses involving Co varieties.robustum was higher for nmc and single cane weight..Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era exploitation of both additive and non additive gene effects present in the population. In general while the F1 clones combining high NMC. Quality parameters S. single cane weight would be higher in S.This suggests that there is scope for selecting better segregants in this group based on NMC.spontaneum progenies had high NMC and cane yieldwhich can be further improved through nobilization.officinarum /S..robustum combination than in S.06%) and quality parameters (62.5%).officinarum x S. brix and cane yield had higher magnitude of GCV and PCV except cane height. number of millable canes (65.officinarum x S.officinarum x S.The occurrence of superior recombinants among the progenies of S.the promising first generation hybrids of S. Single cane weight (60. good vigour and medium thin to thick canes identified from both the groups in this study needs further exploitation.spontaneum / S. moderate brix. The breeding material developed from nobilization for various component traits of yield and quality could be utilized as genetic stocks in further breeding programmes.robustum progenies can be directly inducted into general breeding programme for further evaluation and commercial use. cane height. h2 and genetic advance for most of the characters in this group indicated greater variance in the progenies. The characters with wider range viz.robustum indicates the possibility of realizing new types with desired character.S.spontaneum progenies. Comparison Yield components S. In S. single cane weight and sucrose.This suggests that gain from selection based on nmc.8%) showed high genetic advance.The estimates of variability. Ramana Rao (1972) also reported that a large amount of variability for most of the characters and emphasized the importance of both additive and non additive variances for the characters. single cane weight. number of millable canes. sucrose.robustum progenies the improvement of yield components viz. diameter and single cane weight offers scope for realization of more genetic gains for yield. 28 2.33 6.39 11.99 0.75 21.68 3.03 0.23 27.66 19.42 Number of 99.73 28.69 8.officinarum x S.56 weight (kg) Brix (%) 13.61 30.26 0.74 262.69 21.88 325.42 6.70 29.67 Cane diameter 2.75 0.62 84.58 51. Genetic parameters in F1 progenies from S.51 23.50 26.47-2.64 21.56 740.44 0.22 Second National Plant Breeding Congress 2006 millable canes Cane height (cm) 200.56 14.Table 1.04 0.47 Plant Breeding in Post Genomics Era Kg/row .54 13.07 3.48 0.28 35.03 12.41 12.12 Sucrose (%) 9.46 7.37 4.32 13.40 18.06 0.74 Purity (%) 72.82 0.65 0.25 8.12 0.68 718.48 0.12-17.40-14.19 0.80 0.75-103.08 0.08 150 (cm) Single cane 0.87 33.56 459.99 Cane yield 53.12 50.72 33.65 5.56 3.27-1.spontaneum Characters Mean/ Range V 2g h2 GCV PCV GA V2p GA as % of mean row 27-170 135-260 1.29 97.78 37.53 23.53-85.31 172.48 6.86 3.01 9. 75-57.51 0.56 20.33 0.00 16.58 7.72 Second National Plant Breeding Congress 2006 Characters row Number of millable canes 32.63 22.robustum Mean/ 13.62 634.67 29.87 0.33 9.46 Cane height(cm) 151 Cane diameter (cm) Single cane weight (kg) Brix (%) Sucrose (%) Purity (%) Cane yieldKg/row Plant Breeding in Post Genomics Era .37 22.Table 2.54 Range V2g h2 GCV PCV GA V2p GA as % of mean 39. Genetic parameters in F1 progenies of S.11 0.86 0.13 11.64 237.67 -3.13 3.31 0.73 198.12 -21.18 23.54 216.38 8.51 21.32 85.37 7.57 0.01 10.60 19.11 0.42 2.60 0.5 180.96 19.40 6.11 0.00-262.05 3.40 0.12 4.65 35.07 5.32 28.50 4.34 3.30 13.52 32.57 0.21 395.75 16.65 23.35 30.64-91.69 0.67 11.33 66.22 -23.34 25.officinarum x S.04 0.27 0.64 12.48-1.3 8.74 16.62 238.52 33.62 13.30 10.75-50.20 0.5 1.54 12.39 364.49 5.57 5.74 12. Proc. I.ISSCT.The importance of wild germplasm in plant breeding. Interspecific hybridization in sugarcane breeding. I. Proc. Breaux . 1977. Proc. Walker. Manipulating the genetic base of sugarcane. Roach.T.D.D. 1972.T.J . Roach.spontaneum germplasm in the West Indies Proc. Proc. T. 1965.spontaneum in sugarcane breeding. H. Crop Sci .16: 4357.T.ISSCT. B.K and Chaudhary.1965.G.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era REFERENCES Arceneaux.14: 224-232. Dunckelman. Euphytica 26: 615-621. I.officinarum x S. N. Breeding of sugarcane varieties for Louisiana with new germplasm. Cultivated sugarcanes of the world and their botanical derivation . Utilization of S. 12:10211026. 1977. 152 . R.1971. Yield component in random and selected sugarcane population.spontaneum crosses. D .ISSCT. James. Ramaa Rao. ISSCT.T. Quantitative effects of hybridization in S. D. Utilization of noble and S.1971. Walker. Copersucar Technology Center. S. and R. 321-334. Biometrical Methods in quantitative genetic analysis.B.14: 233-239.C. Hawkes.13: 939-954. pp.1985. ISSCT. Breeding value of sugarcane genetic stocks with special reference to Saccharum robustum. 11: 906-908. 1971. Proc. Price.1968. 1987.T. B. ISSCT 12:844-854. Brazil. Copersucar International Sugarcane Breeding Workshop. Singh.3. additive effect (d). Dominance effect (h) was found to be significant in the cross Ib.62 x Ib. all the gene effects (d. generation mean analysis was performed in 3 different crosses and the results are summarized below.128 x Ib. Under rainfed conditions. M. Singh ABSTRACT In order to study the gene effects for various morpho-physiological characters related to drought tolerance in maize. For wilt ratings under irrigated conditions. The type epistasis was found to be complementary in one cross while it was duplicate in nature in other two crosses studied.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era GENETIC STUDIES ON PLANT.62 x Ib. For ear height under rainfed conditions.37. 37.62 x Ib. Both additive effect (d) and additive x dominant effect (j) were found significant for cross Ib. The type of epistasis was duplicate in all the three crosses under rainfed and irrigated conditions. Under irrigated conditions. Nearly 65 per cent of maize is grown under rainfed condition. Introduction Maize is one of the most important cereal crops in India grown for grain as well as fodder 153 purpose. Additive effect (d) and dominance x dominance (l) were found for the cross Ib. Epistasis was duplicate in nature.h. The type of epistasis was duplicate. Moisture stress is a major limiting factor for maize production under Division of Genetics.62 x Ib. 145. The type of epistasis was both duplicate and complimentary in different crosses studied.37.37 for the character plant height.j and l) were highly significant in the cross Ib. New Delhi . and R. MATURITY AND PHYSIOLOGICAL CHARACTERS OF MAIZE (ZEA MAYS L.62 x Ib.145 under irrigated condition for number of leaves per plant while under rainfed condition dominance effect (h) and additive x additive effect (i) were significant in cross Ib. 62 x Ib. Dominance effect (h) was found significant in cross Ib. Dominance effect (h) and dominance x dominance interaction (j) were significant in cross Ib.i. A perusal of the gene effects revealed that the estimates vary for each cross in different degrees.37. all the types of gene effects were found to be significant in different crosses studied.128 x Ib.145. Results indicated that mean values (m) were highly significant for all characters studied under rainfed as well as irrigated conditions. dominance effect (h) and epistatic effects additive x additive (i) and dominance x dominance effect (l) were significant for the cross Ib.128 x Ib. The type of epistasis was found to be complementary in one cross and it was duplicate in two other crosses studied. dominance and epistatic components necessitates a breeding methodology like reciprocal recurrent selection or biparental mating or diallele selective mating which would be more useful to improve morpho-physiological characters related to drought tolerance.D. Significant occurrence of additive.63 x Ib. the interaction additive x additive was only found significant for days to 50% tasseling in cross Ib. The epistasis was of duplicate nature.128 while additive effect (d) was found significant for cross Ib. 128. Indian Agricultural Research Institute. The type of epistasis was both complementary and duplicate. Under rainfed condition the gene effects were non-significant for wilt ratings and canopy air temperature difference.) UNDER RAINFED AND IRRIGATED CONDITIONS Subba Rao. Dominance effect (h) and epistatic effect additive x additive (i) and dominance x dominance (l) were found significant for days to 50% silking under rainfed conditions. Estimates of gene effects under irrigated and rainfed conditions are discussed below. The type of epistasis was duplicate .128.62 x Ib.37. Under rainfed condition. maturity and physiological traits. wilt ratings at seedling stage (1-5 scale) and canopy air temperature difference (CATD). Recommended cultural practices were followed during crop growth. Keeping this in view. Ib. F2 and two parental back crosses (BC1 and BC2).62 x Ib.62 x Ib. Hence. days to 50 per cent tasseling. Days to 50 % per cent tasseling The interaction additive x additive (i) was found to be significant under irrigated condition in the cross Ib. Material and Methods The material for the study consisted of three crosses viz.j and l were calculated as per the generation mean analysis described by Hayman (1958). respective inbred lines. dominance effect (h) and interaction dominance x dominance (l) were found significant in the cross Ib.62 x Ib. Results and Discussion The results obtained from generation mean analysis for different characters studied are presented in table 1.128 x Ib. The type of epistasis was complimentary in this cross while this was duplicate in nature in other two crosses. The type of epistasis was complimentary in Ib. Genetic analysis was performed as per the six-parameter model described by Hayman (1958). Global estimate indicates that there is a loss of about 15 per cent due to drought. Guo et al.37 while it was duplicate in nature in other two crosses.number of leaves/ plant. New Delhi. Observations were recorded on plant height. dominance (h) and non-allelic effects i.145 along with respective parental lines and the two respective back crosses (BC1 and BC2) with male and female parents.The estimates of h and l along with their sign were 154 utilized to understand the nature of epistasis. Additive gene effects were found important for days to 50 per cent tasseling by Gousenard et al. anthesis silking interval (ASI). (1986) reported predominance of dominance effects. The results of these studies are described in this paper.37 and Ib. dominance effect (h) and epistatic effects additive x additive (i) and dominance x dominance effect (l) were found significant. Ib.. it is essential to generate information on genetics of these traits. ear height. The irrigated crop was grown with recommended number (5 irrigations during crop season) while rainfed crop was grown under purely rainfed conditions without any supplementary irrigation. (1989) and Hemalatha and Sarkar (1990). The experimental material was grown in a randomized block design with 3 replications at Indian Agricultural Research Institute. Under rainfed condition.62 x Ib. days to 50 silking. Estimates of gene effects indicated predominance of non-additive gene effects for this trait. Maturity and plant characters Results indicated that mean values (m) were highly significant for the characters studied for all the three crosses under rainfed as well as irrigated conditions (Table 1). additive effect (d). Additive (d). Drought is a complex phenomenon and depends on several characters like plants. Data were recorded on 5 plants for parents and hybrids and on 20 plants for F2 and back crosses. an experiment was conducted involving three crosses. Days to 50 % silking None of the gene effects were found significant under irrigated condition and type of epistasis was duplicate for all the crosses.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era rainfed conditions. Both additive and non additive effects were reported to be important by Ramesha (1988). it is essential for enhancing the breeding effort for drought tolerance in maize. Therefore. specific leaf weight.128. 62 x Ib. Bonaparte (1977) found the importance of additive and dominance gene effects for this character. (1983).62 x Ib. The type of epistasis was duplicate in two crosses while it was complementary in .145 under irrigated condition. Singh et al (1975). dominance effect (h) and epistatic effect (i) were found significant in cross Ib. Anthesis. The type of epistasis was duplicate in Ib. 155 Ear height Under irrigated condition additive effect (d) was found significant in cross Ib.145 while dominance x dominance epistatic effect (l) was found significant for cross Ib.37.37.37 and complimentary in Ib.62 x Ib.62 x Ib. In cross Ib.62 x Ib.128 x Ib. Ib. Number of leaves per plant Dominance effect (h) was found significant in cross Ib.128 x Ib.62 x Ib. dominance effect (h) and dominance x dominance effect (l) were found significant in cross Ib. (1987).145 under irrigated conditions. the magnitude of dominance effects being more important.37under irrigated condition. additive effect (d) was found significant while both additive effect (d) and additive x dominant effect (j) were found significant for cross Ib.62 x Ib. (1987) reported that both additive and dominance gene effects were important. Dominance effects were found important for this trait by Singh et al. The type of epistasis was of duplicate nature. (1986) and Debnath and Sarkar.62 x Ib.37. The type of epistasis was of duplicate nature. Plant height Under irrigated condition.128 x Ib. Under rainfed condition. (1979). dominance effect (h) and additive x additive epistatic effect (i) were found significant in cross Ib.62 x Ib. none of the gene effects were found significant. Pal et al (1986).128 while additive effect (d) and additive x dominance effect (j) were found significant in the cross Ib.37.37 and complementary in other two crosses.37. Under rainfed condition. Sharma.128. Estimates of gene effects for four physiological characters under two growing conditions are presented in table 2.128 x Ib.128 x Ib. while epistatic effects were found important by Saha (1981) and Ahuja et al. Khalidi (1982) reported the importance of non-additive gene action for plant height while Hauller and Mirinda (1988) and Crossa et al (1990) reported the significance of additive gene action. Debnath and Sarkar. Under rainfed condition. silking interval Dominance effect was found to be significant for the cross Ib. 128. Marker and Joshi.145 while only additive x dominance effect (j) were found significant in the cross Ib. (2005) indicated the importance of dominance variance for this trait though additive genetic variance was also found significant under rainfed condition. The importance of both additive and non-additive gene effects were found important by Pal et al.62 x Ib. The type of epistasis was of duplicate nature in all the three crosses. dominance effect (d) and epistatic effects additive x additive (i)and dominance x dominance (l) effects were found significant for the cross Ib. (1987) and Brar and Labana (1991) reported the significance of additive gene effects for leaf number per plant. Under rainfed condition.128 x Ib.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era in Ib.145. Specific leaf weight Dominance effect (h) and additive x additive epistatic effect (i) were found significant for cross Ib.62 x Ib. Physiological Traits Mean effects (m) were highly significant for physiological characters for most of the crosses in both the moisture regimes. The type of epistasis was found to be duplicate in nature for all the three crosses under irrigated and rainfed conditions.145 cross. 37. Gardner.P. REFERENCES Ahuja.S.).K and Agarwal.62 x Ib. Principles and methodology of selecting for dourght resistance in sorghum.). J. 19: 251-258. Genet.145. S. G.P. Ames. E. 4: 205215 Bonaparte. A. 1987. S.. Hallauer. Genet. A. J. Debnath. Combining ability estimates of CIMMYT’s tropical late yellow maize germplasm.12 x Ib. Vasal. Estimation of various gene effects for different plant. Hayman. and Beck. Can.K. Indian J. B.L. additive effect (d) and dominance x dominance effect (l) were found to be highly significant in cross Ib.S and Labana.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Ib.i. Wilt rating at seedling stage All the gene effects (d. Genetika 15: 1-8 Ashok Kumar and Sharma. K.62 x Ib. the gene effects were found to be non significant for this trait.N. Thei. 1986. 12-15. Agronomie 9: 867-876. dominant and all the three digenic epistatic effects in various crosses studied. Hence.h. Under rainfed condition. 1991. M. S. 2: 385 Crossa. Monografic de Genetica Agrano. P. 65: 281283 Blum. Guo.128 dominance x dominance interaction (l) was found significant while additive effect (d) additive x additive effect (i) were found significant in cross Ib. Maydica. Cytol. Quantitative Genetics in Maize Breeding.62 x Ib.O and Obaidi.R and Miranda.128 x Ib. V.C.).I.A. B.1988. The type of epistasis was duplicate in the three crosses. Canopy air temperature difference (CATD) The gene effects were non significant for this character under rainfed and irrigated condition. Mukharjee. The separation of epistasis from additive and dominance variation in . Brar. 267294. Genetic variation and gene effects controlling prolificacy and other traits in maize (Zea mays L.j and l) were found significant in cross Ib. Feb.R.J. Press.. Acta. Partitioning of quantitative variability for grain yield and its components in maize. In: Abstracts of Golden Jubilee Symposium on Genetic Research and Education: Currents trends and Next Fifty Years. Sci.Z. 1990.C and Sarkar. New Delhi. 20: 263-276 Gouesnard. 1989. D. J. Iowa State Univ. 1983. breeding procedures like reciprocal recurrent selection or biparental crosses or diallele selective mating would be useful tools to improve the characters related to drought tolerance. 1979. B. Diallel analysis of leaf number and duration of mid silk in maize. C.N. Blum (1979). Gallas. Agric. K. 1977. In the cross Ib.1991. maturity and physiological characters indicated the presence of additive. 13 : 35-42.145.137. The type of epistasis was duplicate. Sin. Epistasis and its contribution to the expression of yield and other metric traits in maize (Zea mays L. Genetic analysis of grain yield and some of its attributes in maize (Zea mays L. 35: 273-278. P. K. A and Lefort-Buson. M.2005 Gene action and heterosis for some quantitative 156 characters in bread wheat (Triticum aestivum L). Intra and inter population genetic variability in two forage maize populations. 1958.B. Martinello (1983) and Ashok Kumar and Sharma (2005) earlier reported such breeding procedures . Under rainfed condition. Hemalatha and Sarkar (1990) reported greater importance of dominance variance for wilt ratings due to water stress.Genet. Singh. Singh.D. Ph.). Studies on elite Indian maize composites. B.K. K.).) composite under stress and non-stress conditions. Saha. P. Martinello. Palampur. 2005.E. Phytobreedon. thesis..107-108.P. N. Study of Genetics of some morphological. physiological and biochemical characters associated with drought resistance in maize (Zea mays L. 1987.B. Genetic study of some rare quantitative characters in maize (Zea mays L. Genetical studies on some parameters of drought tolerance in maize. Thesis abstracts. S.L and Mukharjee. Genetic analysis of maize (Zea mays L. Indian J. Indian J.C. Krishi Viswavidyalaya. 7 : 26-268.S and Dhillon. Genet.S. M. New Delhi. A.D. 1981. IARI. Joshi. 1986.K. S and Joshi. Ramesha. Genetic analysis of grain yield and other agronomic traits. J.N. Abst. W. Outlines of major components of maize breeding progrmmes for semi-arid regions (Capitanata plain). Thesis. Genetic analysis of and selection advance in maize populations. 1982. Thesis. H. G. B46: 2135B 157 . 37: 361-390. 1979. 1986. A. R.S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era generation means.G. Agric. Moisture stress response in maize. A.Sc.A.V and Sarkar.S. Spangole. B. Genet. 31: 153162.R. 13: 27-30. Genetika.). Combining ability analysis for yield and its attributes in maize (Zea mays L. 1975. Genetic analysis of yield and other quantitative characters in heterozygous populations of maize (Zea mays L. P.. IARI. 1983. Nature of inheritance and heterosis manifestation in physiological and agronomic attributes in hybrids of maize (Zea mays L. Agr. Marker. Dharwad. Khalidi. Maydica.). I. Dhawan. 1990. 1988. Sharma. Res.Sc . B.K.) M. Diss. New Delhi. Hemalatha. 65: 211-212 Pal. Internat. UAS. Heredity 12: 371-390. Khera. H. V. Dixit. M. R. G.K and Singh. 67 -19.83 -6. Anthesis silking Interval a) Irrigated b) Rainfed 4.00 -20.33 -0.67 Duplicate 16.33* 2.33 Duplicate 1.00* 2.33** 138.33 -0.00* 3.33 Duplicate 24.33 8.67 Duplicate -102.33 2.33 -2.00 -4.99 24. Ib 1.67** 40.67 -2.00 -12. Ib 2.67 -0.33 4. Ib 1.33 Duplicate 8.33** 50.67 127.99** Duplicate -7.97** -25.33 17.00 Duplicate 32.5 -5. Ib 2. Ib 2.50* 120.67 3.83* -9.33 Duplicate 24.33** 9.33 1. Ib 2.00 1.00** -2. Ib 2. Ib 54.67 44.83 2. respectively 158 .00 Duplicate 11.67 -1.33 Complementary -12. Ib 2.67* 21.33 -2. Ib 3.50* 26.17 -10. Ib 1.00** 64.00 13.00 Duplicate 44. Ib 3. Ib 3.00 Duplicate -4. Ib 1.17 78.33** 61. Plant height (cm) a) Irrigated b) Rainfed a) Irrigated 5.67* 0. Character Environment Cross Gene Effects m d -1.33** 56.33 -16.50 60.67** 61.17 -0.33 -0. Ib 2.17 -9.00 11.99 9.00 -4.00 8.67* Duplicate -17.00* 3. Ib 1.33 40. Ib 3.33** 55.33 0. Ib 2.33 Complementary -82.83 29.Days to 50% Tasseling a) Irrigated b) Rainfed 2.17 -8.67 Duplicate 13.33 38.00 -3.17 2.67 0.67 -3.99 59.17 -5.83 -19.17** -7. Estimates of gene effects for maturity and plant characters in maize under irrigated and rainfed conditions.00 -0.33 -4.67 12.33 2.67** 56.33* -4.00** 6.00** 137.33* 0.67 -10.00** 45.33 -2.33** 65.67 Duplicate -40.67 -10. Ib 3. Ib 3.00 -10.33 -0.33** 160.00 -3.67** 7.67* 3.99** 2.5 -5.67 3.67 Duplicate -189.00 Duplicate 0.33* 3.33 h I j l Type of epistasis 1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1.00 -1. Ib 1.00** 74.00 -4.33 5.99 137.67 5.33 Duplicate -40.00 -2.67 12.67 -2.00 Duplicate -63.00 7. Ib 3.67 2.33 Duplicate 9.33 -4.67 Duplicate 15. ** : Significant at 5% and 1% level.50 -2.33 -47.00 Complementary 2. Ib 2.99 -6.67 -4.33 Duplicate -5.67** 72. Days to 50 % silking a) Irrigated b) Rainfed 3.83* -18.33 -8. Ib 1.83 24.33** 149.67 Duplicate 71.00* 10.67** Duplicate 8.33 -1.67** 49.33 48.33** 7. Ib 3. Ear height (cm) b) Rainfed 1.67 -2.33 -9.33** 58.33** 107.00 -7. Ib 1. Ib 3.67 -20.67 -0. Ib 3.00 -28.83 -6.33* Complementary -44.00 14.00* Duplicate *.00 -7.67 4.67** 7.99 -7.00 11.33 -8.33** 6.17 25.67 13.67 2.00 -11.67** 65.33 15.00** 72.33 -36.83** 67.00 Complementary -14.00 Duplicate -89.00 7.67 3.67 1. Ib 2.67** 65. Ib 1. 60 -0.02 Duplicate 6.22 13.83 3.67 1.73 1.75 -1.67 -0.80 -2.83 0. Ib 62 x Ib 37 3.31 -6.51** -5. Ib 62x Ib 128 2.42 -1.27 4.53 Duplicate -0.53** 0.07** 0. Gene Effects Type of Character Environment Cross m d h I j l epistasis 1.23 -10.93 Duplicate 12.70 2.53** -0.00 3. Ib 62 x Ib 128 2.63 3. Ib 62 x Ib 128 2.00** 0.33 0.00** 0.23 1.00** -0.21 -0.84** 0.93 -0.93 Duplicate b) Rainfed 1.66 Duplicate 5.06 -0.37 3.20** -0.40 -0.12 Duplicate 3.72 1.00** Duplicate 1.58 0. Ib 128 x Ib 145 -2.80 Duplicate -1. Ib 128 x Ib 145 6.46 2.87 0.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 2.03 13.33** 1.00** -2.17 -5.50 0. Ib 62 x Ib 128 2.20 2.00 -6.00 2.00 -3.35 -0. Ib 128 x Ib 145 2.08** 3.23 -0.30 -2.07 -2.27 Duplicate 13.27 -0. Ib 128 x Ib 145 1.20 5.85 -10. Ib 128 x Ib 145 11.51 -3.67** -1.83** 5. Ib 62 x Ib 37 3.83** 2.43 5. of leaves per plant a) Irrigated 1.39** 0.00 -2.33 -0.33** 0.87 Duplicate -1.33 3.17** -2.47 -0.85 1.06* -0.47 -1.10 0.50 -2.50* -3. Ib 128 x Ib 145 7.33 2.46* 0. Ib 128 x Ib 145 1.53 Complementary *.00 Duplicate 7.17 -8.00 -0. respectively 159 .67 1.33* 3. Ib 62 x Ib 128 2. Ib 62 x Ib 128 2.27 -2. Ib 62 x Ib 37 3.30 Duplicate 10.53 0.Canopy air a) Irrigated temperature difference ( 0 C) b) Rainfed 1.12 -3.00 Duplicate 4.67 1.33 -0. Specific a) Irrigated leaf weight (g) 1.61** 0.00 -1. Ib 62 x Ib 37 3.33** 0.33** 0.99 3.20 0. Estimates of gene effects for physiological characters in maize under irrigated and rainfed conditions. Ib 62 x Ib 37 3. No.47 -0.33 Duplicate 3.00 2.37 -1.00 -2.26** 1.55 8.67** Duplicate b) Rainfed 1.00 0. Ib 62 x Ib 37 3.26 -1.33 Duplicate 2.97 -1. Ib 62 x Ib 128 2.37 Duplicate -1. ** : Significant at 5% and 1% level.00** -1.67 Complementary 3.67* 0.44 0.87 2.74 -0.68 4.33 0.17 Complementary 2.17 Duplicate -2.83 -1.69 Complementary 11.33 4.00 -5.27** 0. Ib 128 x Ib 145 10.05 -1. Wilt rating at seedling stage a) Irrigated 1.49** 2.49* Duplicate 6.47* -1. Ib 62 x Ib 37 3.45 0.00** -0.83 -1.05 -5.73 2.73 -3.67 Complementary b) Rainfed 1.78** 3.53 11.37 -6. Ib 62 x Ib 128 2. Ib 62 x Ib 37 3. Centre for Plant Breeding and Genetics. The mean values of these anatomical and morphological features were used for combining ability analysis. 1994).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era GENETIC ANALYSIS OF LEAF ANATOMICAL CHARACTERS ASSOCIATED WITH JASSID RESISTANCE IN COTTON (GOSSYPIUM SPP. phloem distance . KC-2. In India. A total of nine characters viz. (1980). R..S. These parents were crossed in a 6x6 diallel mating design during September 2004 at Cotton Breeding Station. Histological studies of leaves were carried out following the method described by Johannsen (1940) and trichome density was estimated following the procedure of Maite et al. Therefore.. It is also important to examine the mechanism of resistance in any breeding programme focussed to exploit host plant resistance.30 Million bales.75M ha with a production of 15.. the present investigation was undertaken to study combining ability of resistant genotypes. spongy parenchyma height. MCU-5. Coimbatore 160 . arboreum species and inducing polyploidy by treating colchicine. tissue ratio. palisade cell height. serious and most important sucking pests of cotton.Raveendran ABSTRACT In a 6 x 6 diallel analysis three Gossypium hirsutum genotypes and three introgressed lines obtained by crossing Gossypium hirsutum and Gossypium arboreum were assessed for their combining ability and nature of gene action for nine anatomical characters. IS 30/68 and 376/4/3 obtained by crossing G. which plays major role in India’s industrial and agrarian economy. The parents KC 2. cotton is grown in 8. The choice of an appropriate breeding procedure for the development of pest resistant varieties depends on the nature and magnitude of genetic variation for factors governing resistance present in base population.) Shimna Bhaskaran. trichome density. Bollworms and sucking pests are the two important groups of pests in cotton which cause considerable damage to cotton crop in terms of yield and quality. Use of resistant variety is a vital tool of integrated pest management (IPM). phloem thickness. Parents and crosses showed significant differences for all characters. which contribute resistance to jassids. The crosses MCU 5 x MCU 12. stomatal density and leaf thickness were studied. Tamil Nadu Agricultural University. KC 2 x MCU 5. INTRODUCTION Cotton (Gossypium spp. hirsutum and G. Jassids are regular. Materials and methods The experimental material consisted of six genotypes: three G hirsutum genotypes viz. 376/4/3 x IS 14/21. Thirty hybrids along with their parents were raised in RBD with two replications.) is one of the most important commercial crops of India. MCU-12 and three introgressed lines IS 14/21. IS 30/68 and 376/4/3 were good general combiners.Ravikesavan and T. Coimbatore. Tamil Nadu Agricultural University. number of palisade cells. Department of Cotton. MCU 12 x MCU 5 were identified as good specific combiners for resistance contributing characters. The nymphs and adults of jassids suck the sap from the leaves and cause phytotoxic symptoms known as hopper burn which result in complete desiccation of plants (Narayanan and Singh. Biotic constraints particularly insect pests are known to affect the stability in production. 376/4/3 and IS 14/21 were selected as best. parents KC 2. In the present study. considering gca effects and per se performance together. But if a parent possessed significant gca effects for as many traits as possible it is ideal to consider it for hybridization rather than parents with low gca effects or based on mean performance. Further. Parent 376/4/3 was the best performer for tissue ratio and trichome density. indicating the presence of both additive and non additive gene action controlling these characters. sca effects and hybrid vigour of the crosses are considered frequently in cases where nonadditive component of genetic variance predominates the inheritance. The parent KC 2 was considered as best general combiner for characters phloem 161 thickness and leaf thickness (plate 2). MCU 12 had higher gca effect for spongy parenchyma height and tissue ratio. Singh and Gupta (1970) also reported results similar to the present findings. The gca effects depend on the relative value rather than absolute value. None of the parents was found to be good general combiner for all the traits. For all the traits some of the parents possessed favorable genes and some did not. The magnitude of GCA variance (Table 2) was higher than that of SCA for all characters except spongy parenchyma height indicating preponderance of additive gene action which could be exploited for improvement of these traits by following simple selection. Simmonds (1979) stated that the gca values relatively depend on the mean of the chosen material. The analysis of combining ability revealed that the variance due to GCA and SCA were highly significant for all the characters studied. The hybrid MCU 12 × KC-2 recorded high mean performance for phloem distance and leaf thickness (plate 4) and the hybrid IS 30/68 × IS . The GCA/SCA variance ratio was narrow for all the characters studied revealing the importance of both additive and non-additive gene action controlling these characters. The combining ability analysis provides useful information regarding selection of parents in terms of the performance of their hybrid. it would be desirable to have multiple crosses involving the parents and subject them to selection in segregating generations to detect superior genotypes with resistant characters. The parent KC 2 recorded highest mean performance for phloem distance and leaf thickness. Hence. Results and discussion The analysis of variance for anatomical and morphological characters revealed highly significant difference among genotypes qualifying them for further study (Table 1). IS 30/68-recorded superior performance for number of palisade cells and palisade cell height. the analysis elucidates the nature and magnitude of various types of gene action involved in expression of quantitative traits (Dhillion. The superior hybrids were selected on the basis of high per se performance and sca effects (Table 3) for each of the trait in the present investigation. 1998). The other parent chosen for hybridization should possess favorable gca effects for other complementary traits. Identification of parents based on either per se performance or gca effect alone was misleading in selection programme (Arumugam Pillai and Amirthadevarathinam. mass selection and pedigree selection. Information on the per se performance and nature of general combining ability of characters is necessary for selection of suitable parents for developing hybrids. The parent MCU 5 was best combiner for phloem distance and stomatal density. so that favorable recombinants for all traits could be obtained.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Combining ability analysis was done by the procedure outlined by Griffing (1956) for method I in model I. 1975). S. R. It is concluded that the parents. Maite. Out of thirty hybrids seventeen recorded positive significant sca effect for phloem distance and sixteen hybrids recorded positive sca effect for palisade cell height. and Davies. New York. K. Genet. J. and Amirthadevarathinam.S. pp.A Review. tuc.B. Narayanan. Sorghum Physiology-3.. Agric Sci. N. phloem distance and tissue ratio (plate 3). 20-23.P. Indian J. Pp. 30(3): 608-618. 121-154. Nature of occurence of trichomes in sorghum lines with resistance to sorghum shootfly. Improv.W.1975. Patancheru. B.408p Singh. The hybrid MCU 5 × MCU 12 recorded highest positive significant sca effects for. Hybrid. had significant positive sca effect for that trait. 1956. Longman Group Ltd. 1970. . sorghum entomology-3.. K. Principles of crop improvement.. R... and Phundan Singh. The crosses MCU 5 x MCU 12. Cott. 376/4/3 X IS 14/21. Plant micro techniques. and Gupta. 376/4/3 x IS 14/21. Resistance to Heliothis and other serious insect pest in Gossypium spp. Combining ability for economic traits using CMS system in cotton. Combining ability for yield characters in upland cotton. 1998. N.Digest 18: 54-58 Dhillion. Indian Soc. 162 .V. Sci. REFERENCE Arumugam Pillai. Biol. 1940. 9: 463-493. Bidinger. 19: 10-24. A review. F. Londan . India. The hybrid MCU 5 × MCU 12 recorded positive significant sca effect for all the resistant characters studied.. Application of partial diallel crosses in plant breeding. S.. Johannsen. B. ICRISAT. Australian J. Crop Improvement. a combination resistant to jassid. 1994.P. A. Joint Progress report.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 14/21 had high mean performance for trichome density and low mean performance for tissue ratio.S. Concept of general and specific combining ability in relation to diallel crossing systems. The hybrid MCU 12 x MCU 5 recorded positive significant sca effects for phloem thickness and spongy parenchyma height. A.R. 2:1-7.A. Griffing. M. Reddy. McGrew Hill Bock co. MCU 12 x MCU 5 were identified as good specific combiners. D. IS 30/ 68 and 376/4/3 are good general combiners for resistant characters. KC 2 x MCU 5. Simmonds. 1979. KC 2.. 1980.C. Hybrid 376/4/3 x MCU 5 showed high per se performance for thickness of phloem. 55 xx 328.31 xx Hybrids 29 604.15 xx Second National Plant Breeding Congress 2006 Hybrids 1831.33 xx 14930.74 xx 0.76 xx 31.541 xx 209.20 0.89 xx 10.40 xx 1427.65 0.35 xx 1.00021 xx 0.00019 xx F1’s 14 1035.94 xx 163 11.00005 x Trichome Stomatal Leaf thickness density / (P) microscopic density/ mm2 P field Genotypes 35 558.41 xx 429.37 xx 1032.31 xx 49. Analysis of variance for combining ability Source df Phloem P thickness (P) Tissue ratio 0.15 xx xx Error 11.Table 1.08 xx 0.09 xx 154.003 xx xx 6.46 xx F1’s Vs 1 588.93 70.71 xx 182.66 xx Reciprocals 14 174.75 xx 5.00 xx 771.38 11.87 xx 224.566 xx 79.033 xx 15.48 117.18 xx 2474.05 xx Plant Breeding in Post Genomics Era *Significant at 5 per cent level.00098 xx 0.29 xx 4134.25 SCA 15 184.87 xx 279.88 xx 0. ** significant at 1 per cent level .48 xx 10.00017 xx 0.46 x 328.074 xx 21.00017 xx 0.497 xx 7.44 xx reciprocals 17.24 Parents 5 343.56 2807.197 xx 0.99 xx 2705.114 xx 0.39 0.64 xx 127.00001 0.00029 xx GCA 5 347.02 x 2059.64 1226.37 xx Phloem P distance (P) Palisade height (P) P Number of Spongy palisade parenchyma P cells height (P) 0.561 xx 0.802 xx 29.27 xx 2191.76 xx 2687.17 xx 256.26 119.160 xx 5.42 xx 0.90 xx 319.67 1882.00011 xx RCA 15 351.38 xx 446.99 xx 9.48 xx 0.52 xx 1013.72 xx 2369.238 7.10 xx 6505.83 xx 0.69 xx 19.30 xx 35 236.31 xx 369.03 xx 9.118 xx 0.48 xx 400.88 xx 12.06 xx 2844.00025 xx 0.18 xx 242.00032 xx 0.25 xx 0.27 xx 114858 xx 3676.47 xx 2.72 xx Parents Vs 1 285.89 xx 9.033 46.10 xx 375.37 x 37. 619 -1.667** -7.542** -3.245* 0.964** -4.953** -2.939** -0.278** -0.374* -0.033** IS30/68 -0.342** Plant Breeding in Post Genomics Era * Significant at 5 per cent level.539** 24.Table 2.146 MCU5 7.642** 2. ** significant at 1 per cent level .497** -2.002** 376/4/3 4.685** -0.026** -2.328 -7.189** -4.086** 0.563** -8.733** 164 IS14/21 -7. gca effects of parents for nine characters Second National Plant Breeding Congress 2006 Parents -7.139** 9.002** 0.449** 0.182** 0.010** -0.704** 1.083** -2.335** -0.537 KC-2 -0.113** 0.114** 02.076** -0.975 -2.543** 1.292 1.003* -0.213 2.031** 0.001* -0.535** 0.697** Phloem distance (P) P Palisade cell Phloem Spongy Number of height thickness parenchyma palisade cells P heightv (P) (P) (P) P P Trichome Stomatal leaf thickness density / Tissue ratio microscopic density/ mm2 (P) P field -15.325** MCU12 -4.919** -0.458** -3.539** -9.490** -5.002** 0.542* -3.292 2.999** 26.073** 1. 375* 4.890 -3.000* -5.167** -0.375** -11.338 -8.166** -0.911** -6.010 -0.127** -0.000 0.025** -8.342 -0.877 -0.058** 2.500** -2.548 -1.091** -0.493** 2.667** -1.225 27.625** -18.472 4.510 0.550** -55.809** 7.085** -11.100** -1.750 -1.102** -0.006** -0.475** 6.500** 0.500 -1.549** -5.908 0.607 -0.125 5.075** 3.158** 0.890** 8.060** 5.518** -15.000 0.600** 18.625** 14.125 -12.972 31.004** -0.935* 1.125 -5.850 6.002* 0.008 0.950* 51.148 -4.603** -7.300** 5.050 -2.808 2.060 -3.001 0.175** -5.162** -11.292 0.500** -18.600* -0.481** 0.979** 18.002* 0.108** 0.425** 0.262 2.212** -0.251** 5.019** 6.947** 3.012 -0.300** 23.515** 13.000** 5.750 10.500* -1.500 -3.208 1.700** 5.750 -1.629 11.125** 14.470 26.898** 3.425** -0.092** -2.420 -5.787** -15.232** 12.002* -0.013** 0.000 -0.850** 5.700** 18.95* -9. Hybrids Phloem distance (P) P Number of palisade cells Palisade cell height (P) P Phloem thickness (P) P Trichome Spongy density / Stomatal leaf thickness parenchyma Tissue ratio (P) microscopic density/ mm2 P heightv (P) P field 165 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 376/4/3 x IS14/21 376/4/3 x IS30/68 376/4/3 x KC2 376/4/3 x MCU5 376/4/3 x MCU12 IS14/21 x 376/4/3 IS14/21 x IS30/68 IS14/21 x KC2 IS14/21 x MCU5 IS14/21 xMCU12 IS30/68 x 376/4/3 IS30/68 x IS14/21 IS30/68 x KC-2 IS30/68 x MCU5 IS30/68 xMCU12 KC2 x 376/4/3 KC2 x IS14/21 KC2 x IS30/68 KC2 x MCU5 KC2 x MCU12 MCU5 x 376/4/3 MCU5 x IS14/21 MCU5 x IS30/68 MCU5 x MCU5 MCU5 x MCU12 MCU12 x 376/4/3 MCU12 x S14/21 MCU12 xIS30/58 MCU12 x KC-2 MCU12 x MCU5 5.011 -0.500** 12.331 -0. sca effects of hybrids for nine characters Second National Plant Breeding Congress 2006 S.232** 12.500 1.575** -28.199** 4.008** 0.001 0.520 -3.008** -0.000 2.328** -7.250 3.432* -0.140** -0.022** -0.929 -4.058* -2.325 3.710 -0.180** 0.125 -1.00** 6.976 3.357** -7.125 -8.076** -0.092** 0.099** -0.553 -12.125 0.950 -54.650** 14.475 -16.023 -4.033 -0.695 -1.002* -0.005 -0.750** 19.879* 27.000** -0.500** 1.199 1.750** 0.749 1.768 -13.875** 18.007** -0.00** -3.292 -1.963 8.363 -8.004** 0.772 1.320 -4.750** 1.650** -5.00** -3. ** significant at 1 per cent level .065* 0.358 -1.750 8.064** -5.004** -0.425** -8.139** -14.978 -10.340 -4.750 -0.625** 0.192** 0.125 -1.005 0.Table 3.033* 1.004** 0.375** -2.500** 10.000 0.140** 8.149** -0.00** -3.300** 7.500 -3.024** 22.157* 0.375 -0.008 -12.045* -0.470 -32.042 -0.067** 10.010 -0.004** 0.487 -0.325 -21.No.081** -0.564** -4.431** -34.375 28.002* -0.000** 0.482** 8.079** 4.612** -1.375** -1.988* -1.625* 47.453* -2.750** 2.060 -0.065** 0.600* 0.50 -9.250** 25.004** -0.074** -9.437* 5.247** 4.128** 0.500** 4.001 0.125** -4.581** 31.083** -2.967 0.775** -16.125** 5.375** 0.050 -0.789* 17.003* -0.625** -0.775 9.467** 7.967 -2.928 5.072** -1.786** -8.125** 1.000 -0.528** -4.781** -3.375** -5.015** 1.317** 11.500 0.128 -2.048 0.375** 42.944** 1.183** -0.226** -10.500** 2.900 -10.250 0.004** -0.068* -32.500 -1.057** -0.032** 3.000 -2.853* 1.582 1.056** 8.006** Plant Breeding in Post Genomics Era * Significant at 5 per cent level.225** 13. Leaf anatomy of parent KC-2 LE – Lower epidermis P – Phloem elements UP – Upper palisade Plate No.3. 2. Leaf anatomy of hybrid MCU 12 x KC-2 LE – Lower epidermis P – Phloem elements UP – Upper palisade 166 . 4. 1. Leaf anatomy of parent IS 14/21 Plate No.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Plate No.Leaf anatomy of hybrid MCU 5 x MCU 12 Plate No. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TECHNICAL SESSION III UTILIZATION OF PLOIDY BREEDING IN CROP IMPROVEMENT . plant types and other desirable agronomic characteristics and continue to serve as sources of cytoplasm in case of hybrid crops. structural heterozygosity need to be overcome. Altering the ploidy levels of either the parental species or the interspecific hybrid itself through colchiploidy or in vitro techniques is necessary. Wellington. concerted efforts are required to incorporate additional variability from these reliable sources so as to develop varieties/hybrids with desired characteristics. Regional Station. genetic distance. the introgression of traits of interest from the species from secondary and tertiary gene pools requires several manipulations both at chromosome and genome levels using recent techniques since the interspecific/ intergeneric hybrids showed sterility caused by ploidy differences. genomic incompatibility. Wild relatives of the cultivar species are rich sources of novel genetic variability in terms of resistance to biotic and abiotic factors. increased or decreased number. cytogenetic. The various approaches to transfer alien genetic variability into cultivars combining conventional methods with recent advancements in cytogenetics and crop breeding are discussed with a few representative crops. A wide gap exists between making initial hybrids and releasing cultivars with good agronomic performance and yield. Prabhakaran ABSTRACT Plant breeding efforts to develop varieties/hybrids with desired economic characteristics are constrained by the narrow genetic base of the cultivated species. The Nilgiris 167 . Indian Agricultural Research Institute. cytoplasmic imbalances or other factors. Hence. and molecular investigations will immensely help to plan the strategies to over come many of the problems. quality parameters. While alien genes from primary gene pool could be easily transferred through conventional breeding.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era PRE-BREEDING THROUGH PLOIDY MANIPULATION TO EXPLOIT ALIEN GENETIC VARIABILITY Amala J. Successful introgression of desirable genes from the distantly related wild into cultivated species requires a clear understanding about the genomes and many severe problems like incompatibility. Extensive genetic. speltoides (2n=14=7II) and F1 hybrid got amphidiploid (AABB= 2n=28). It is suggested that first a wild diploid wheat (AA. a diploid. A mutation for ph gene took place in the F1 hybrid resulting the hybrid to have regular chromosome pairing (forming 14II at Indian Agricultural Research Institute. Polyploids can be classified mainly into four different classes. aestivum. then the monosomic line was grouped into A genome and B genome. one of the tetraploid got crossed with another diploid species with DD genome and gave rise to wild hexaploid wheat species with genome constitution of AABBDD (2n=42). i. sharonensis Eig.P.) and TT (Ae. brassica as poliploid can not ignored. Sears for his monumental work. Nn (Ae. B and D each genome comprises 7 chromosomes. it evolved from low chromosome organism (like bacteria and virus) to organism with high chromosomes (plant and animals). mutica Boiss). CC ( Ae. comosa Sibth et Sm).K. Several tetraploid wheat species originated from the amphidiploid. Identification of chromosomes belonging to different genomes in T. On the contrary. Subsequently. dicoccum (AABB) Meiosis of all 21 F1’s was studied. New Delhi-110012 meiosis). speltoides. one chromosome of each kind will form a set of chromosomes known as genome so that in a diploid two similar genomes will be present. Tabacum. It evolved by nature to suit environment conditions. where A. Before we learn about the details of aneuploids.e. All these plants complied of diploids and polyploids. a monoploid will have 2n = 7 chromosomes. Obviously. Plants serve majority of requirements of not only of human being but also animals which are used by human being directly or indirectly.) MM (Ae. Oat. lilium. turnip. a tetraploid wheat has 2n = 4x = AABB = 28 and hexaploid wheat has 2n = 6x = AABBDD = 42. caudate Linn. BB (Ae.).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era WHEAT POLYPLOIDS AS A MODEL SYSTEM FOR CROP IMPROVEMENT Dalmir Singh and P. Sugarbeet. For example. Today hexaploid wheat is the only polyploid system where a maximum number of aneuploids are available. DD (Ae. for developing and providing such a huge cytogenetical stocks to to the wheat scientists. Meena ABSTRACT Evaluation of polyploidy is younger than evaluation of life. In situation when there were 14II+ 6I. a triploid 2n = 21 chromosomes and a tetraploid 2n = 28 chromosomes. Sugarcane. SS (Ae.e. the monosomic line was grouped into D genome. In nature polyploids are very common. In a diploid. In an allopolyploid more than one genomes. Monosomics belonging to A and B genomes 168 . unicaritata Vis. searsii Feldman et Kisl. 2n=14=7II) got crossed with Ae.. alloploiploids. cotton. 2n = 14 chromosomes. T.monococcum Linn. Range of chromosome number varied from 2n=4. segmental allopolyploids and autoallopolyploids. Crosses were made between different mono’s (2n-1) and T. squarossa Linn. Evaluation of wheat from common ancestor There are several diploid species of wheat which have been classified into genomes like AA ( T. AA.). AAA and AAAA. when there were 13II+ 8I.). If A is equal to 7 chromosomes. autoplolyploids. we must be aware of the detailed architect of wheats. boeoticum Boiss.). each having same or different chromosome numbers may be involved. Thanks to Dr. The contribution of wheat. T. An autotriploid and an autotetraploid will have three doses and four doses of the same genome i. n=2 (Haplopaphus gtracillic and 2n > 1200 in some petridophytes. Cells with 3III were common. Therefore. Sears and Okamoto (1958) Failure of homoeologous chromosome pairing appeared to be due to suppression of pairing by chromosome 5B. At the same time – Riley and Chapman (1958) working with nullihaploid of Holdfast. aegilopoides (AA) and Ae. then the mono was classified to A genome. 5. it seems 5BS increase synapsis.Monosomic 5 B x T. Mono’s for D genome were established and identified by Matsumura (1952). squarrosa (DD) withy monotelos of A and B genomes i. aegilopoides x T. 0. 3. In the F1 he observed a maximum of 6 univalents per cell against the expected 14 II + 7 I. when there were normal bivalents. In one cell. He proposed that chromosome 5B. 2. When monosomic 5B. 29% of cells had 5 II to 7 II . Feldman (1966) Increased dosage of 5 BL (absence of 5BS) reduces Chiasma frequency. The F1 hybrid lacking 169 . aestivum was crossed with amphidiploid ( as above). T. 27 chromosomes were involved in pairing. showed 3II to 7II a mean of 5II per cell.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era were assigned numbers arbitrarily from 1 to 14 and from 15 to 21 for D genome. squarrosa. in the F1 hybrid having 5B gene. In case of presence of heteromorphic bivalent. Separation of A and B genome chromosomes was done by crossing the amphidiploid of T. Important conclusions drawn about Ph gene 1. Riley and Chapman (1964) Reported that the gene suppress homoeologous pairing may be located on long arm of chromosome 5B. They observed 4. while F1 hybrid lacking 5B showed 5II to 13II average 10 II per cell. 6. a classification and designation of the chromosomes of T. T. Riley (1960).8III per cell. induces asynapsis. (1966) In tetrasomiccondition. aestivum x Amphidiploid (T. n=20. aestivum was proposed. Riley et al. Sears and Okamoto (1958) concluded failure of homoeologous chromosomes pairing appeared to be due to suppression of pairing by chromosome 5B. Squarrosa (DD) Amphidiploid of F1 (AADD) Amphidiploid (AADD) x Monotelo (A & B genome) F1 Meiosis was studied. GENOME A New Old B D Old chromosome 5B had a maximum of 15II in a cell with a mean of 12II per cell. the mono’s were classified into B genome category.2II. meiosis is normal. They postulated that the chromosome deficient in nullihaploid carried a gene which reduced pairing. aegilopoides (AA). Riley and Chapman (1958) Chromosome 5B carried a gene which reduced pairing. univalents and one telocentric. Okamoto (1957) First to indicate that chromosome 5B involved in the regulation of chromosome pairing. Thus. 4. It was a cross between T. DD).e. Homoeologous Groups 1 1A 2 3 4 5 6 7 New Old New 1 2B 1D XVII XIV 1B 2A 3A 4A 5A 6A 7A II XIII 2D III 3D XX XVI XV XVIII XIX XXI XIII 3B IV IX VI XI 4B 5B 6B 7B VIII 4D V X VII 5D 6D 7D A study carried out by Okamoto (1957) indicated the involvement of chromosome 5B in the regulation of chromosome pairing. aegilopoides (AA) x Ae. True picture emerged after the work of Sears and Okamoto (1958). 11. (1966) It is possible to induce mutations which suppress the effect of 5 B. this particular line is referred to as a critical line. Cross the identified monosomic plants (2n=41) as female with the variety in question (2n=42) as male. Riley et al. All the monosomic (2n=41) and disomic (2n=42) hybrids will show dominant traits like the parent in question. a large number of aneuploid lines have been added which are listed below. The gene is operative in somatic cells also. Monosomics (2n – 1) 2. all the monosomic and disomic F1 hybrids will show dominant trait except one monosomic F1 hybrid.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 7. monosomic (2n=41) F1 hybrids are identified. Location of recessive gene To locate recessive gene. Addition lines (alien chromosome) 170 Mono addition (2n + 1) Diaddition (2n + 2) 9. 12. but it has to confirmed . Telocentrics (2n – 1 chromosome arm) Monotelosomics (2n – 2 + 1 arm) Monotelo disomic (2n-1+1 arm) Double monotelosomics (2n – 2 + 1 arm1 + 1 arm2) Ditelosomics (2n – 2 + 1 arm1 + 1 arm1) Double ditelosomics (2n – 2 + 2 arm1 + 2 arm2) 8. 1963) Riley (1966. except one monosomic F2. after the development of monosomic nullisomuics by Sears (1954). Aneuploidy in polyploids 1. Double trisomics (2n + 1 + 1) 7. Double monosomics (2n – 1 . Tetrasomics (2n + 2) 5. Feldman (1966). Identify all the monosomic F 1 hybrids cytologically. (1971) Reported the location of gene on the long arm of chromosome 5B. In this case. where all the F2 plants will show dominant trait. Riley (1966) It is recessive in nature. Substitution line (2n) varietal hromosome 10. Wall et al.1) 3. 8. 9. 10. Evaluate all the F2 progenies derived from monosomic and disomic F1 hybrids. Riley and Chapman (1958. Riley (1960) None of the putative progenitors possess this gene. Nullitetra [2n – 2 (1A) + 2 (1B)] Uses of aneuploids of wheat Location of dominant gene To locate dominant gene. 1967) Sears (1967). Therefore the in question is located on this particular chromosome. which will show recessive trait. Nullisomics (2n – 2) 4. it is better to take a monosomic series possessing the trait in dominant condition. Nullipolyhaploid (n – 1) 11. Self all the monosomic F1 hybrids and one or two disomic F1 hybrids. All the F2 progenies will segregate in a expected ratio of 3 dominant: 1 recessive. Identified monosomic (2n=41) plants are crossed as female with the variety in question as male parent. In hexaploid wheat. Trisomics (2n + 1) 6. Raise the F1 hybrids. identify all the monosomic plants from the (2n=41) from the monosomic lines possessing the trait in recessive form. 13. it might have arose by mutation. Joshi and Singh (1979) and Singh (1992) Reported the practical applications of 5B system in wheat improvement. Grow the seed obtained from monosomic and disomic F1 hybrids in the field. From F1 hybrids.Riley (1966) The homoeologous chromosomes 5A and 5D also excise a regulatory influence over meiotic pairing. The critical monosomic line can be determined on the basis of monosomic F1 hybrids. Procedure Identify all the monosomic plants cytologically at first meiotic metaphase (20II+ 1I). all of which would be disomic. root length. grain weight. aneuploid lines provided by Sears. The gene in question is therefore. drought tolerance and maturity etc. The critical family can however. The particular monosomic F1 hybrid will produced plants with recessive trait while rest of the monosomic and disomic F2’s will segregate in a expected ratio of 3 dominant: 1 recessive. spikelet number. disease resistance. Location of dominant gene on specific chromosome arm Once the dominant gene is located on a chromosome.. The aneuploid lines thus developed have made it possible to locate genes like. monotelo disomic and ditelosomic nature show dominant feature. In other families. spike colour. only about 25% of the recessive would be disomic. . several monosomic lines in different wheat background have been developed. root 171 number. Transfer of monosomic series into a known variety The variety in question should be free from any meiotic abnormality.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era through the F 2 data. grain number. The recessive gene s (sphaerococcum) was located in this manner by Sears (1947). Follow the schemewith dominant male A A Identify monotelo disomic F1 hybrids cytologically (mts) selfed for F2 a A A Discarded A Phenotype like male A Phenotype like female Study all the F2 plants cytologically The gene is located on the long arm (in monotelo long arm is missing) In case the cytologically identified F2 plants with disomic. Since in wheat. the disomics appears at a frequency of Cross mono telo (S) disomic (Recessive) (mts) a about 25%. closer study of the F2 segregation is required. Utilizing. the gene in question is located on the short (S) arm of the chromosome. Locating hemizygous in effective gene The hemizygous ineffective gene can not be located simply by observing F2 ratios. be identified by cytological examination of the recessive segregates. located on the chromosome of that monosomic line which did not show any segregation. in other words there should be normal or regular chromosome pairing at meiosis. plant height. it is practically a huge list to review. protein content. it needs to be located on specific arm of the chromosome. the critical F2 also segregates in 3 dominant : 1 recessive. tiller number. spike length. Identify 42 and 41 hybrids.C591. the line is correct. Repeat the procedure upto 6th backcross. Chinese spring. A total of 9 different substitution lines (Chromosome 4B. produced substitution lines of var. Swaminathan et al. Chinese spring. After 6 th . Substitution lines were produced earlier using varieties Kenya Farmer. 1. Like this. Critical analysis of these substitution lines can revealed the location of gene (s) on individual chromosomes in the variety of interest. 6A. it was thought that addition or substitution of individual whole alien chromosome might build desired results. 2B and 2D from Red Egyptian and 6B from Timstein) were found to be resistant to stem rust. Monosomics 1A of Chinese spring x Pollen from disomic selfed hybridIdentify mono somic F1 hybrid and self it. resistant to stem rust were used to produce substitution lines (Sears et al. 3B and 6B from Thatcher. identify the monosomic plants showing 20II+ 1I at first meiotic metaphase. For this cross all the monosomic lines with their respective monotelosomic lines. Chinese spring (2n=41) x Variety in question (2n=42). backcross identify a monosomic plant in which most of nuclear part will be of var. Method of substituting a specific chromosome Using monosomics in hexaploid wheats Methodology Identify all the monosomic lines cytologically at first meiotic metaphase (2n=41.. Monosomic of Chinese spring x Pollen from disomic selfed hybrid. a heteromorphic bivalent is present along with 20II regulator bivalents. Using monosomics of var. monosomics of all the 21 chromosomes are developed. Transfer of individual whole chromosome The addition of whole genome did not show much improvement except in few cases. with a exception that it will have one chromosome from the variety in question. 2. Identify 42 and 41 hybrids. If at meiosis. If this situation is not observed. Mida and Marquis utilizing monoteloentric method. 1957). This way all the 21 chromosomes of a variety of interest can be substituted in the genetic background of var. 20II+ 1I). IInd backcross 41 hybrid x Variety 3. Cross all the monosomics of Var. Thatcher. A last step –test the monosomic lines for their trueness. Chinese spring x Variety in question (2n= 42. 3. Pb. Red Egyptian and Timstein. The substitution lines were compared for stem rust resistance with Chinese spring and the donor resistant varieties. Chinese spring by crossing all the monosomic lines of var. After six backcrosses.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Cross all the mono’s of Var. Correctness of the line can be determined on the basis of meiosis of F1 hybrids. Wheat varieties. Disomic substitution lines can be obtained by selfing the monosomic plants. backcross 41 hybrid x Variety. such as Hope. A. The line has to be developed again. 2. 3rd backcross 41 hybrid x Variety. Chinese spring with the variety of interest. 1D from Hope. 21II). Identify monosomic plant from F1 and self it. line is not correct and univalent shift has taken place. 2B. Alien addition lines Rye chromosome additions An amphidiploid (2n=56) involving 172 Continue the backcross till BC6. Identify 42 and 41 hybrids. 1. 132 were resistant of which 40 had translocations. Another example is transfer of rye segment to wheat. alien substitution lines have been developed from Secale cereale. The amphiploid is backcrossed to hexaploid wheat giving rise to a heptabloid with 2n = 49. translocations were induced between chromosomes of var. Interchanges using irradiation The first useful transfer by irradiation involved a segment from Ae. In hexaploid wheat. Driscoll and Jensen (1964) produced 4A-2R translocation carrying resistance to wheat leaf rust and powdery mildew. Hordeum vulgare. either by irradiation or by using homoeologous recombination. Individual addition lines can be identified morphologically. umbellulata chromosome 6U. Recently. Addition lines from Aegilops. comosa. Agropyron and Haynaldia to Wheat Barley chromosome additions to Wheat The wheat-barley crosses were made by Kruse (1973) and Islam et al. In N. aestivum and after two more backcrosses with variety Chinese spring and selecting for leaf rust resistance. umbellulata. Islam et al. plant breeders are interested in transferring the minimum chromatin material 173 carrying the desirable traits. umbellulata carried the gene for leaf rust resistance. In the process. Plant with intercalary translocation was designated as ‘Transfer’. H. Alien substitution lines Like. glutinosa (2n=24) and N. (1978) were able to produce six of the seven possible disomic additions of barley chromosomes to wheat.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era hexaploid wheat and diploid rye is produced. Among 6091 off spring. Along with this resistance it was also carrying some undesirable characters. to long arm of chromosome 6B of wheat (Sears. (1975) utilizing several approaches. an amphidiploid (T. including heptabloids. tabacum. In Avena. a segment carrying leaf rust resistance was transferred to bread wheat variety ‘Thatcher’. The addition lines thus produced can be used as source of desirable traits and can be transferred into wheat background through homoeologous recombination or translocation. Giving irradiation of seeds and plants of an alien substitution line carrying Agropyron elongatum chromosome. Pollen from this irradiated plant was used for pollinating var. possessing rust resistance from rye. In this plant the extra chromosome was from Ae. Chinese spring. The plants are selfed and monosomic (21 + 1 rye) and disomic (21 + 1 rye) addition lines are isolated. 21 + 7. Interchanges (through irradiation or homoeologous recombination) In case. tabacum (2n=48) to N. The plant was given a high dose of X-rays before meiosis. . lead to a plant with 2n=43. Chinense etc. New Delhi. was developed by backcrossing the amphiploid (2n=72) involving N. useful alien substitution lines have also been produced. Agropyron elongatum. a variety ‘Samsoun’ resistant to mosaic virus. dicoccoides x Ae. in which bivalents belong to wheat and univalents are of rye genome. addition lines. It was possible to transfer a portion of Agropyron elongatum chromosome 6 el carrying stem rust resistance gene Sr26 to chromosome arm 6Aâ. C306 and rye at IARI. carrying resistance to wheat leaf rust (Lr9). Ae. umbellulata) was crossed with T. it was possible to transfer mildew resistance from A. by crossing hexaploid wheat and diploid rye followed by doubling of the chromosome number in F1 hybrid. barbata to Avena sativa. tabacum. then efforts to be been made to produce translocations. 1956). Wheat-rye addition lines have been produced using different varieties of wheat and rye. only one of them was intercalary. Ae. In case of wheat the process of chromosome pairing is regulated by Ph. where homoeologous pairing might have taken place due to suppression of 5B activity. sativa. He was able to transfer segment from 3 Ag. speltoides to get plants with 2n=29. to hexaploid wheat. Backcrossing the F 1 hybrid deficient for chromosome 5B (Fig. removal of 5B chromosome (i. Aegilotricum Homoeologous recombination can also be achieved by using certain strains of Aegilops 174 Aegilotricum (2n = 56 = AABBDDNN) is the name given to an amphiploid derived from the cross Aegilops ventricosa (2n = 28 = . 1 Wheat h X Rye Fig. Nullisomy for 5B was used by Riley (1966) for transfer of a segment from Ae. It was transferred to 2D chromosome of wheat.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Recombination through chromosome pairing Besides irradiation.barbata to A. Joshi and Singh (1978). In Oats. Utilizing this species. a genotype of Avena longiglumis (CW 57) has been reported to carry genes suppressing chromosome pairing in the hybrids with Avena sativa. B. Finally.2) from Russia. Gene which is located on the long arm of chromosome 5B. There are three distinct ways to isolate homoeologous recombinations. monosomic addition line isolated from the derivatives of the original cross (Wheat x A. comosa carrying yellow rust resistance. bicornis. Mutants at Ph1 locus on 5BL chromosome arm of wheat have been successfully utilized for homoeologous recombination among wheatAgropyron and Wheat-rye chromosomes. Pb. comosa to wheat. suppression of 5B effect by the genome of Ae. 2 Meiotic Metap e pahse I – F1 hybrid 5B x Rye h (deficie chromosome 5B) ent showing hig chromosome pairing gh g speltoides and Ae.C591 (Fig.2). similar to that of Aegilops speltoides in wheat. This method was used by Riley et al. it gave a stock called “Compair” which had segment from chromosome 2M from Ae. C. In this process. mutica.nullisomic condition). speltoides or Ae. mutica which suppress the effect of Ph1. Other approaches for wheat improvement.1) was crossed with a strain of rye (Fig. It was backcrossed to wheat using selection for resistance at each stage. (carrying Lr24 gene) and 7Ag (carrying Lr19) to chromosomes 3D and 7D respectively. Sears (1972) used nulli-5B-tetra 5D line and Agropyron. In this process monosomic 5B of var. Singh (1992) were able to transfer rust resistance genes from Secale cereale to hexaploid wheat through homoeologous recombination. transfers of genetic mutational can also be achieved through recombination. mildew resistance was transferred from A. utilizing a recessive mutant of the Ph1 locus on 5B. Fig. A.e. (1968) for transfer of stripe rust (yellow rust) resistance from Ae. comosa) was crossed to Ae. Further selfing and selection lead to the isolation of plants possessing rust resistance from Secale cereale. REFERENCES Driscoll. Genome construction within the Triticinae I. Crossing primary triticales with either octoploid triticales or with hexaploid wheat to get ‘secondary triticales’. Induce mutations in primary triticale strains. However. was obtained which had 2n = 56 AABBDDXX (where X is a new reconstructed genome having chromosomes from E). 1964. Jansen. Different approaches have been used to improve the triticales. Their vigor and fertility were however low. Characteristics of leaf rust resistance transferred from rye to wheat. On selfing these hybrids.Triticale ‘Armadillo’ was a good success in 1970’s. oats and many more. In this approach. The synthesis of . This partial amphiploid was later used for getting alien addition lines for A. locate and transfer desirable genes not only from land races but also from alien sources for increasing the quantity and quality of wheat. intermedium chromosomes to wheat. 3.J. could not be produced. The wheat aneuploids is therefore a model system to follow in other crop plants like cotton. probably had AABB genomes intact and a constituted third genome having chromosomes from D and E genome. Late. will be desirable to reconstruct a genome from two diploid species. by backcrossing the F-1 hybrid with 6x wheat. New Delhi. the plants with 21II. L. selected in the progeny.F. Crossing of hexaploid triticales with rye and selecting superior types from segregating generation. It has been possible to make use of these lines to identify. C. All chromosomes in a genome may not be carrying useful genes. Genome reconstitution in Triticinae It is observed that the transfer of entire genome may not be desirable. Triticales The raw amphidiploid triticales are often designated as primary triticales. a partial amphiploid. As such raw triticales were not successful. Evans. Crossing primary hexaploid triticales among themselves to get recominnant triticales. ABDR (6x wheat x 2x rye) 6. involving hexaploid wheat in the initial cross. Crossing of hexaploid triticale with tetraploid wheat. Crossing hexaploid triticales with F1 hybrid. Aegilotricum (2n = 70 = AABBDDDDNN). Crop science 4: 372-374. Agrotricum Agrotricum was obtained as an amphiploid from a cross Agropyron intermedium (2n = 42 = E1E1E2E2NN) x Triticum aestivum (2n = 42 = AABBDD). sugarcane. tobacum. 1964. and has been used for the transfer of resistance against the disease ‘eyespot’ from Ae. sugarbeet. namely ‘Roazon’ was produced. It was done by Evans (1964). two diploid species to produce two amphidiploids with the constitutions AABBDD and AABBEE. 175 5.ventricosa to wheat.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era DDNN) x Triticum turgidum (2n = 28 = AABB). 4. 2. namely TAF 46. which were crossed to produce AABBDE (14II +14I).E. new resistant cultivar of wheat. and N. 1. which were successfully utilized for transfer of resistance against the rusts to wheat. By repeated crossing of this amphiploid with wheat. E2 and N genomes). amber seeded triticale ‘DT 46’ was developed from IARI. groundnut. Evans (1964) used Aegilops squarrosa (DD) and Agropyron elongatum (EE). It. Availability aneuploids of hexaploid has greatly been enhanced because of its nature of polyploid. therefore. However. V. Proc. Feldman.. and D. A. Riley. (ed). . 1992. D. Mutation and recombination studies in wheat and rye. H. and Chapman. Nature 211: 368-369. Symp. 1966. Shepherd. Hereditas 73: 157-161. The diplodization of polyploid wheat. Joshi. Wheat mutants permitting homoeologous meiotic chromosome pairing. Chromosome analysis of the Dinkel genome in the offspring of a pentaploid wheat hybrid. In: Gaul H. M. 1957. (India) 1: 342-348. Chapman. Matsumura. and Chapman. R.H. Wheat Newsletter.K. Sears. III.W. Okamoto . Kruse. A. 1958 Intergenomic chromosome relationship in hexaploid wheat. Biol. Riley. Riley. R. R. V. 15: 407-429. Sears. Riley. 1968. 1973. Natl. Heredity. R.) Barley Genetics III.M. Sears. B.M. 12: 199-219. W. (ed. Riley. R. Induced mutation affecting the control of meiotic chromosome pairing in Triticum aestivum. Barley Genet. Messouri.. New Delhi. 17: 3549. R. Heredity. 260-270. R.W.. and Johnsen. 1971. 1958.M. and Sparrow. A. Hordeum X Triticum hybrids. R.R. E. Sta. 1952. D.A. 1966 The effect of chromosomes 5B. The genetic regulation of meiotic behaviour in wheat and its relatives. and Sparrow.Q.. Ann. and Rodenhiser.haplosomics and their relation to nullisomuics. Asyneptic effect of chromosome V. V. and Belfield. Agri. Genet. Bull. Genet. Wall. E. Sci. 1978. S. Sears. The transfer of leaf rust resistance from Aegilops umbellulata to wheat.M. (Proc. Cytologia. R. Okamoto.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era hexaploids (2n=42) having chromosome of Agropyron and Aegilops in addition to the A and B genome of Triticum durum Can. 1966b. 1963.. Sears.. Acad. 572:1-58. The sphaerococcum gene in wheat. Wheat Genet. Wheat Info. 3rd Int. D. 18: 311-328. Vth Intl. Islam. M. The aneuploids of common wheat.R..B. Hereditas (Suppl. E. 2nd Int.. Proc. Introduction of alien variation into bread wheat. Shepherd. Symp. 1947.. A. E. Brookhaven Symp.H. S. pp. and Chapman. Riley. Symp. Islam. Production and characterization of wheat-barley addition lines. Addition of individual barley chromosomes to wheat. K.. Genetics 32: 102-103. 1975.R. Loegering. 1957. Proc. M.R. Singh. 5D and 5A on chromosomal pairing in Triticum aestivum. Riley. J. 1956. In: Ramanujam.) 2: 395-408. The incorporation of alien disease resistance in wheat by genetic interference with regulation of meiotic chromosome synapsis. The effect of the deficiency of chromosome V (5B) of Triticum aestivum on the meiosis of synthetic amphidiploids. 1960. 38: 119-120. Services.K. 6: 19-28. V. Res.K. 5th Int. Genetic Control of the cytologically diploid behaviour of 176 hexaploid wheat. 5: 6. Res. Garching). 9:1-22.365371. 1954. (1978). (ed) Proc. Wheat Genet. Nature (Lord) 182 : 713715. Chapman. pp.C. V. R.B. Genet. Res. E. 29 Chromosome D. Wheat Genet.R. Mackey J. A. Proceedings of the Xth International Congress of Genetics 2: 258-259. USA 55:1447-1453. Agronomy Journal 49:208-212. Singh. Symp. Identification of chromosomes carrying genes for stem rust resistance in four varieties of wheat. Cytol. 18(4):473-484. Recent studies have clarified many Central Institute for Cotton Research. G and K while five allotetraploid species are designated with AD genome. with divergence of the two progenator diploid genomes occurring 4-8 mya. which comprises approximately 50 known species distributed in Arid to Semi-arid regions of the Tropics and Subtropics..hirsutum and G. 2N = 4x = 52). 2n = 26). 2003). C. These species originated following hybridisation between an African or Asian diploid species (genome AA. barbadense are cultivated and remaining all are wild species.herbaceum. Steward 1995 and Wendel 177 et al. Nagpur-10 . domestication of the four cultivated species and the origin of the allopolyploid cottons. F. Wendel 1995. hirsutum and G. G.. arboreum. D. 45 species are diploid and 5 allopolyploid falling into eight cytological groups designated as A. These species originated following hybridization between an African or Asian diploid species (Genome AA. G. B. is one of the ideal system for examining genome evolution in polyploids. 2n = 26). Post Bag No 2. as female with a diploid American pollen donor (Genome DD. Five natural polyploid Gossypium species are recognized of which all are allotetraploid bearing A and D genomes (viz. Molecular data suggests that allopolyploid Gossypium lineage arose about 12 million years ago (mya). Molecular data suggest that the allopolyploid Gossypium lineage arose about 1-2 million years ago. arboreum.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era ROLE OF POLYPLOIDY IN COTTON Khadi. Wendel et al. The genus Gossypium L. Five natural polyploids of Gossypium species are recognized of which all are allotetraploid bearing A and D genomes (AADD. 2n = 26). D. Recent studies have clarified many evolutionary aspects of Gossypium. is one of the best systems for examining genome evolution in polyploids.1999). 1985. barbadense are cultivated and remaining all are wild species (Endrizzi et al. G and K while five allopolyploid species are designated with AD genome. G. and Vinita P. Gotmare ABSTRACT Polyploidy is common in plants and probably has been involved in the evolution of all Eukaryotes). E. G. Wendel and Albert 1992). The resulting genomic reunions have led to an array of genetic mechanisms and adaptive response that are not yet fully understood. as female and with a diploid American pollen donor (genome DD. E. F. with divergence of the two progenator diploid genomes occurring 4-8 mya. B. 2n = 52). relationship within and among the eight genome groups.M. O. Out of these 50 known species of Gossypium. Introduction Polyploidy is common in plants and probably has been involved in the evolution of all eukaryotes ( Soltis & Soltis 1992) The cotton genus Gossypium L.1999. A peculiarity among the 50 species identified and described so far in Gossypium. Shankar Nagar P. B. with divergence of the two progenitor diploid genomes occurring 4-8 million years earlier (Seelanan et al. A peculiarity among the 50 species identified and described so far in Gossypium. C. AADD. 45 species are diploid and 5 allopolyploid falling into eight cytological groups designated as A. four species namely. which comprises of approximately 50 species distributed in arid to semi-arid regions of the tropics and sub-tropics. 1997. An insight of the polyploidy of Cotton will help in understanding its contribution to the ecological success and agronomic potential for its improvement. Out of these 50 known species of Gossypium. G. Molecular data suggests that allopolyploid Gossypium lineage arose about 1-2 million years ago (mya). 2n = 26) (Percival et al. herbaceum. Also that chromosome translocation have not played a role in the divergence of polyploid cottons . four species namely G. or fibres. one species G. These two genera which have now geographically isolated from one another by thousands of kilometers of open ocean (Kokia from Hawaii and Gossypioides from Madagaskar and East Africa) implies that trans-oceanic dispersal was evolved in the evolution of one or both genera. 2002b. barbadense (Pima cotton. Gossypioides-Kokia examples represent only the long distance. 1997. which includes eight genera (Fryxell et al. arboreum and G. wool and seed-coat anatomy.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era evolutionary aspects of Gossypium. hirsutum (upland cotton) and G. Coriacious capsule containing several seeds per locule. it was suggested that Gossypium branched off from Kokia and Gossypioides approx. An insight of the polyploidy of Cotton will help in understanding its contribution to the ecological success and agronomic potential for its improvement. Hampea. Seelanan et al. hirsutum has spread from its original home in Mesoamerica to over 50 countries in both hemispheres. Wendel et al. 2002b).Undivided style. Thus. 2002) Using sequence divergence data from the chloroplast gene ndhF and published sequence divergence rates to calibrate a molecular clock. G. Gossypium is distinguished from other related genera like Lebronnecia. hirsutum has dominated the world cotton scenario. domestication of the four cultivated species and the origin of the allopolyploid cottons. relationship within and among the eight genome groups. Wendel et al. Also that chromosome translocation have not played a role in the divergence of polyploid cottons ( Waghmare et al 2005). Egyptian cotton) have polyploidy genomes resulting from a truly remarkable chance biological reunion among ancestral diploid genomes that are geographically restricted to different hemispheres. Although all four cotton species spread beyond their ancestral homes during the last several millenia. Gossypium hirsutum and Gossypium barbadense and two from Africa-Asia namely G. Genus Gossypium in the tribe Gossypieae is largest and most widely distributed containing about 50 species (Fryxell 1992) including four domesticated species. 1997. herbaceum. 12.5 mya with Kokia and Gossypioides separating some 3 mya (Cronn et al. Monoploidy of the tribe has been confirmed 178 using comparative analysis of chloroplast DNA restriction site variation (La Duke and Doebley 1995) and DNA sequence data (Seelanan et al. 1992) is different from other members of the Malvaceae on the basis of morphological features of the embryo. The resulting genomic reunions have led to an array of genetic mechanisms and adaptive response that are not yet fully understood. The cotton tribe. and by the presence of gossypol glands also known as punctae or lysigenous cavities widely distributed on the plant body. Kokia. oceanic dispersal as a factor . Wendel & Cronn 2003). This parallel domestication process involved four species. two from Americas. Cephalohibiscus. 2002. Gossypioides. These cultivated species are genetically diverse but this diversity is dwarfed by that included in the genus as a whole whose species belong to both tropical and sub-tropical regions of the world. G. Cienfugosia and Thespeca by a combination of characters including . A somatic chromosome number of 26 and Presence of three foliaceous involucellar bracts subtending each flower Recent molecular phylogenetic analysis have demonstrated that the diverse group of species belonging to Gossypium constitute a single natural lineage (monophylectic group) despite their world-wide distribution and extraordinary morphological and cytogenetic diversity (Cronn et al. that occur on the epidermis of the seeds. Origin and diversification of Cotton Cotton is unique among crop plants in that four separate species were independently domesticated for the specialised single-celled trichomes. brichettii. 179 3 and 12 species respectively. Senata : G. Kulkarni & Khadi 1998). G. They comprise of C. Cultivated cottons of sub-section Gossypium. very limited material is available. 2000. one G. herbaceum : A genome 4 Sub section Anomalum : B genome species F-genome longicalyx. Later. G. 1. 2001a. releasing seeds that bear laisomes. Gossypium includes approximately 50 species. G. 2003. There are four subsections in Gossypium (Fryxell 1992). Molecular phylogenetic analysis have yielded conflicting results regarding interspecific relationships in this group (Liu et al. Asian-African species Gossypium consists of fourteen species from Africa and Arabia.(Sturtia). 2002b. it was suggested that the species having 26 pairs are allotetraploids and that the ancestral donors involved both wild American species and Asiatic species. but long distance dispersals have led to the evolution of G. turfacatum from deserts in Somalia.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era in the evolution of the cotton Tribe and the genus Gossypium (De Joode and Wendel 1992. 3. G-(Hibiscoides) and K(Grandicalyx taxonomic section) groups with 2. Seelanan 1999) American diploid species These are the New World D-genome diploids (Table-1) and have been collected and studied than others and their taxonomy is well understood. Species in the Genus Gossypium At present. Small & Wendel 2000. raimondii in Peru and G. Seelanan 1999. Wendel and Percy 1990). The wild species of cotton represent an ample genetic repository for potential exploitation by the cotton breeders but still remain largely untapped genetic resource (Khadi et al. Increasing evidences suggest that G.They are herbaceous perennials with a bi-seasonal growth pattern whereby vegetative growth dies back during the dry season. arboreum and G. Longley (1933) suggested that “a duplication of the chromosomes of an ancestral type for this doubled chromosome number 26”. African – Asian species and American diploid species. Grandicalyx have pedicels that recurve following pollination so that the capsules are pendent and open inverted at maturity. The centre of diversity for 13 species of D-genome diploids is western Mexico. Allopolyploid nature of the American tetraploid cotton species emerged from the work of Beasley (1940) and Harland (1940) wherein allotetraploids from A genome (Asiatic) and D genome (American) diploids showed that . but new species continue to be discovered from the primary centres of diversity in tropics and sub-tropics and are grouped as Australian species . Chromosomal evolution and the concept of genome group Cytogenetic investigations started as early as 1920s and revealed that species in Gossypium had haploid chromosome complement 13 and 26. This species is poorly understood taxonomically and cytogenetically and there is a possibility that it may not belong to Gossypium but to Cienfulgosia due to its unusual feature of dentate leaves. . Australian species Australian species (Sub-genus: Strata) comprises of 16 named species as well as a new species that is yet to be named. gossypioides is basal-most . 2. Sub-section Pseudopambak : E-genome. Cytogenetic characteristics or molecular phylogenetic affinities not yet studied. benadirense. Many of these species are poorly represented in collections are incompletely understood taxonomically. klotzschianum in Galapogas Islands. volksenii. which attract ants. Africa-Arabia (A.G. K genome). At the time of allopolyploid formation.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era these could form fertile hybrids. Gossypium is relatively ancient and was thought to be evolved 60-100mya (million years ago). The lineages of Gossypium were established in relatively rapid succession from Kokia – Gossypioides. (Cronn et al. America (Dgenome). isozyme markers. G. occurring mostly as scattered individuals. Recent molecular data suggest that the earliest split in Gossypium has taken place 12 mya (Seelanan 1997) and another Cp DNA sequence divergence data suggests that the genus originated 5-15 mya (Cronn et al. B & F genome in one group. and E genome in the other group). . New world and Old world diploids are phylogenetic sisters. tomentosum has more diffuse population structure. The phylogenetic studies suggest that all African – Arabian Cottons comprise a single group. 2002b) Phylogenetic history of Gossypium There exist four major lineages of diploid species corresponding to three continents – Australia(C. 2002). longicalyx could be sister to A genome species. All above three are the true wild species whereas the remaining two G. the Carribean and islands in the Pacific. arboreum and G. G. Each genome group corresponds to 180 single natural lineage. G. G. darwinii is native to the Galapogas islands where large and continuous populations are formed. which consists only one species G.). mustelinium is restricted to NE Brazil and is an uncommon species. phytochemical analysis. the A and D genomes have merged which represents the reunion of two genomes belonging to different hemispheres and diverged for millions of years in isolation from one another. These studies prove that the allotetraploid species formed from hybridization between A and D genomes ancestors. most nuclear genes are duplicated in the AD-genome cottons and when both copies are isolated and sequenced. hirsutum and G. Phylogenetic relationship among the species Recent molecular phylogenetic investigations have shown the genealogical lineages of the species and relationship within and among the different genomic group and geographical distribution. Long distance dispersal has played an important role in the diversification of Gossypium and atleast one dispersal between Australia and Africa and another to the America’s (probably Mexico) has lead to the evolution of the D genome diploids and later colonization of New World has taken place by the A genome ancestor of the AD genome allopolyploids. barbadense have been domesticated over a period of time. hirsutum is distributed in Central and South America. barbadense is distributed in the North of South America. These classical cytogenetic studies demonstrated that American tetraploid species are true allopolyploids consisting of A and D genomes and that D genome is similar to those found in the American diploids. While the maximum likelihood approach to estimate the lineage of diploid cottons suggest that their divergence occurred within a span of 2 mya. herbaceum. The wild forms are more closely related to the A genome species G. comparative genetic mapping and comparative analysis of DNA sequences. meoitic pairing behaviour in synthetic polyploid. A number of additional findings support this hypothesis of allopolyploidy origin of the American tetraploid origin which include studies of duplicate factors controlling morphology. G. African F genome. Five known allopolyploid Gossypium species are diversified and distinct. A lot of variation exists in the views for the divergence of Gossypium. they correspond phylogenetically and phenetically to those of A and D genome diploids (Wendel et al. G. G.davidsonii.tomentosum.condonderriense.trilobum. costulatum. G. Asia F (2n =26) G (2n =26) 1 3 E. G. G. herbaceum. G. thurberi. rotundifolium. somalense. W. pulchellum. G. G. S. G. bickii.mustilinum.raimondii. G.G.vollesenii. N. G. capitis-viridis G.armourianum. G. benadirense. lobatumG. sp. areysianum.bricchettii. G.incanum. anomalum. G. arboreum G. G. Galapagos Islands.turneri.gossypioides G. trifurcatum G. robinsonii G.klotzchianum. G. harknessii. Arizona E (2n =26) 8 Arabian Peninsula. G. G.darwinii Geographical origin Africa possibly Asia Africa.laxum. G. G. triphyllum. G. G.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1. sturtianum.aridum. G. nov G. australe. G.exiguum. cunninghamii.W. anapoides. G. G.barbadense. Peru.merchantii. G. G. Genome groups in Gossypium Genome A (2n=26) B (2n=26) C (2n =26) D (2n =26) Total species 2 3 2 13 Species G. stocksii. nelsonii G. Cape Verde Island Australia Primarily Mexico. nobile. longicalyx G. G.E. Africa Australia K (2n =26) 13 N. G.schwendimanii G. G. G. G. Australia AD(2n=56) 5 New world Tropics & subtropics including Hawaii 181 . enthyle. G. G. G. G. G. Africa. populifolium. pilosum.hirsutum. This evolutionary history raises the possibility that the G. Africanum) and that polyploidization has occurred following a trans Atlantic introduction to the New World of species similar to G. In this respect it is found that seeds of many species of Gossypium are tolerant to prolonged periods of immersion in salt water. there are difference of opinion for the chloroplast and nuclear genomes with respect to the relationship between G. Stabilization of Chromosomes and Genomic Interaction in Polyploids The A and D-genomes of allopolyploid . darwinii). raimondii. Addition support for the hypothesis of G. capitis viridis). herbaceum subsp. klotzschianum). Phylogenetic investigations using DNA sequencing of homologous genes is the latest tool. But G. from Western South America to Galapagos Islands (G. from Northern Mexico to Galapagos Islands (G. gossypoides. gossypioides and initial polyploid formation may have been spacially temporarally-associated events (Wendel et al. Thus. raimondii and a full understanding of the parentage of polyploids is yet not clear. floral features and extra floral bract morphology in synthetic A ´ D amphiploids and from observations of lint characteristics and vigour of 182 intergenomic hybrids (Hutchinson et al. darwinii (Stephens 1946) were the first two to explain the hypothesis of parentage and it states that either G. it must have acquired these introgressant genomic components after phylogenetic separation from the lineage leading to G. which may be insufficient for trans oceanic dispersal perhaps in some cases long distance dispersal.raimondii as D genome donor emerged from comparative analysis of plant habit and shape. A-genome introgression into G. distant from D-genome of the allopolyploids. Seeds of G. from Africa to Cape Verde Islands (G. gossypioides lineage was involved in the origin of allopolyploid. Allometric occurring allopolyploids G. raimondii (Abdalla et al. As a member of the D genome diploids G. gossypioides and G. herbaceum. The origin of Kokia – Gossypioides from a common ancestor suggest a common dispersal mechanism of Oceanic drift. raimondii in combination with G. klotzschianum its closed relative of G. 2001. 1985). from Peru. 1999) Hence. 1995b) But recent analysis of nuclear genes place G. Cronn et al. gossypioides diverged from G. tomentosum are capable of germination even after three years of immersions in artificial salt water. may have taken place through natural rafting on floating debris (Stephens 1966). Seeds of some species may retain buoyancy for atleast two to three months. raimondii). gossypioides as basal within the subgenus of. Parentage of Alloployploids Which of the modern species of A and D genome diploids best serve as models for the progenitor genome donors? Over the decades a diverse arrays of tools have been used to solve this questions. raimondii.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Long distance dispersal clearly has played an important role not only in the diversification of major evolutionary lines but also in speciation within Gossypium genome groups. hirsutum and G. The ployploid parentage could be explain with the help of cytogenetic data combined with the observations suggesting that the only known wild A genome cotton is African (G. davidsonii or G. Examples include dispersals from Southern Mexico to Peru (G. gossypoides genome contains a number of repetitive DNA’s that are shared with A genome species (Endrizzi et al. As G. arboreum would produce a hybrid showing considerable similarity to present day New World Cottons. belongs to Mexican evolutionary lineage and appears to share cytoplasm with G. long distance dispersal of A genome in the New World may have occurred after G. gossypoides is the only D genome diploids that exhibits evidence of genetic contacts with an A genome plant. 1945). darwinii & G. The fibre duplicated gene pair will become silenced and elongation terminates about two weeks from 183 . Genetic map comparisons showed that two reciprocal translocations arose in the diploid lineage after allopolyploid formation. ultimately degenerate as pseudogene.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Gossypium are more distinct from one another than their diploid progenitors (endrizzi et al. 1985) One possibility of genome stabilization after polyploidization could be reorganization of the two genomes so that they are no longer capable of homeologous pairing. wild forms in litoral habitats from Gulf of Mexico. the recombination in the two resident genomes differed by only The agronomic consequence of polyploidy by 5%. Four of recombination in Gossypium. Recent data shows that Chromosome – arm translocations have not played a role in the divergence of polyploid Cottons and that one terminal inversion on Chromosome 3 appears to differentiate G.genome diploids have twice the DNA content per cell as D genome diploids. seed with short seed trichomes and tightly divergence between the duplicated genes and adherent to the seed . Thus. In Gossypium allopolyploidy led to the established of a new ecological niche. colour and other properties but the earliest The other possibility of outcome of gene developmental stages are similar among all duplication could be that one member of the species (Applequist et al.barbadense and G . the allopolyploid could exploit the fluctuating sea levels i. the genetic length of these two genomes differ by 6 % and at tetraploid level. Polyploidy has promoted higher rates is important as it deals with the fibre. with a corresponding difference in chromosome size (Endrizzi et al 1985). In contrast to majority of diploid species . 2000. Wendel & Cronn et al. allopolyploid species occur in coastal habitat and among the five allopolyploid species . Mature seeds from wild acquisition of new function (Lynch and Conery species exhibit great diversity in fibre length . Fryxell 1979). evolution and gene silencing for stabilization of allopolyploids have played a very important role. 2003). The mechanism that affect gene expression . NW South America to Pacific Islands (Brubaker and Wendel 1994. 2000. In case of allopolyploid Gossypium. Earlier Gossypium species had duplication is responsible for relaxation. Recombination rates are conserved between A & D diploid genomes and for a common set of markers. Ecological and Agronomical Consequences of Polyploidization Polyploidy is often associated with broader ecological amplitude and novel evolutionary opportunity.tomentosum from G. 1998). two are completely restricted to near coastline ( G. Duplicated genes may maintain their original function or their function may be distributed . 2001) .e a new ecological niche. hirsutum . which allopolyploidy in Gossypium could be correlated evolved only once in the progenitors of all four to duplication of all nuclear genes and this cotton species . Zhao et al. although DNA content is not additive and A genome has chromosome size slightly smaller than those in diploids (Brubaker et al 1999b).tomentosum ) and for G. A . barbadense (Waghmare et al 2005). mediated by the increased “buffering” capacity afforded by duplicated genes and the enhanced vigor resulting from the fixed heterozygosity of their duplicated genomes. separate species of Gossypium were The genomic consequences of domesticated for their seed hairs. this dispersal capacity was associated with specialization for establishment in coastal communities. Otto and Whitton 2000. Allopolyploid Gossypium was not accompanied by chromosomal rearrangement (Paterson et al. These differences are maintained in allopolyploid Gossypium. (1992). USA 96. This prolonged elongation period represents a key evolutionary event in the origin of long fibre and it happened prior to domestication. J... (1996). Wiley.L. Brubaker. 42. F. C. Craven. A. R. P. The genome wide gene duplication caused by allopolyploidization provided the raw material necessary for the evolution of novel gene expression pattern. 17: 91-114. El-Zik. H. W.. Turcotte. C. L. Eds. Cothren. J. domestication of the New World Cotton was first precipitated by a developmental switch that occurred millions of years ago in a different hemisphere. Technology and Production” (C. (1998). Proc. and Wendel. J. cytogenetics. The origin and domestication of cotton. 89. C. Malvaceae) using nuclear restriction fragment length polymorphisms (RFLPs). J. J. Grandicalyx (Malvaceae). K. 707-725.. (1999a). Natl..K. DNA hybridization analyses of a Gosssypium allotetraploid and two closelyrelated diploid species.. Genetic diversity and relationships of diploid and tertraploid cottons revealed using AFLP.. Endrizzi. Theor. and Stewart. Dev. Cronn...Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era anthesis in most of the wild species while in A & F genome diploids it is extended to three weeks. Applequist. Bot. REFERENCES Abdalla. Brubaker. J.. . and evolution of Gossypium. F. 102: 222-229.. F. F.U. including the description of six new species. Genetics. Mol. A revision of Gossypium sect.. Cronn. 3-31.hirsutum and G. A. Rapid diversification of the cotton genes (Gossypium : Malvaceae) revealed by analysis of sixteen nuclear and chloroplast genes. Paterson. 184 Brubaker.. J. Bot. Thus . A. and Kohel. M. pp. L. and Pepper.F. which subsequently were exploited by the modern plant breeders of G. Theses studies in turn suggest allopolyplodization provided novel opportunities for agronomic improvement.. and Wendel. L. Cronn. W. J. Sci. R.. Syst. M... and Wendel. (2002b). and Endrizzi. L. and Wendel. (2001). Fibre growth curves for wild AD genome allopolyploids are similar to those of the wild A genome species but the fibre of allopolyploids is superior than that of cultivated Old World diploids. Comparative development of fiber in wild and cultivated cotton. (2001). Small. Small. and Wendel. A.C. E. and Wendel. Fryxell. History.. R. J.. F. Am. F. Smith and J. R. 23: 271-375. L. R.. Wright et al 1998) . E. A. O. (1999). Appl. Katterman. Genome 42: 184— 203. F. R. Bot. F. Reddy.. A. 14406-14411. barbadense (Jiang et al. J. L. 3:317. Bourland.. J. E. Acad. C. R. R. Genet.. Geever. and Wendel. (1999b). Paterson. New York. Genet. Zhao. Haselkorn. Adv.M.. In “Cotton : Origin. R. Duplicated genes evolve independently following polyploid formation in cotton. H.). F. 1998. J.X. J. Reevaluating the origin of domesticated cotton (Gossypiun hirsutum. J. M. T. E. (1985). C. Polymorphism and concerted evolution in a tandemly repeated gene family : 5S ribosomal DNA in diploid and allopolyploid cottons. Evol. 685-705. H. Cronn. Evol. Am. Comparative genetic mapping of allotetraploid cotton and its diploid progenitors. Majority of the loci affecting the fibre yield and quality are found in the D genome rather than A genome which explains the superiority of the lint of the allopolyploids. T. 81: 1309-1326. L. (1994). . Cronn. J. and Wendel. (2001a). F. X. R. T. B. (2000). Genet. J. D. Lynch. Comparative genomics of plant choromosomes. P. R. J F Wendel & AH Paterson (2005) Genetic mapping of a cross between G.. and Whitton. Molecular systematics of Australian Gossypium section Grandicalyx (Malavaceae). Plant Cell 12: 1523-1539. X. (2002). 100: 409-418.. K. J. G. R. Polyploid incidence and evolution. (2000). 4419-4454. Woo. (2003) Genepool concept for diploid cultivated cotton. and Patterson. and Conery. M.arboreum for meeting textile industry needs. Acad. Bowers. J.hirsutum (Cotton) and the Hawaii endemic . P. Polyploid formation in cotton is not accompanied by rapid genomic changes... Y. Hanson. R... 77: 553-559. Polyploid formation created unique avenues for response to selection in Gosssypium (cotton). Zwick. Evolution of interspersed repetitive elements in Gossypium (Malvaceae)..V. G...M. 185 Otto.. and price.. J. Brubaker.. Percy.A. Phyl. Stelly. D.M.. Paterson. C. (1990). and Wendel. S.G. and Wendel. Greece: 1074-77. App. F.... V. F. 24: 183-208. Bot.-P. 79: 529-542. C Rogers .Kulkarni. and Wendel. Theor. N. and Wendel. G J Pierce. M. C. Small. (2000). R. (2000). Allozyme evidence for the origion and diversification of Gossypium barbadense L. M. J. G. Genome 43: 874-880. . Proceedings of world cotton research conference-2 held at Athens. and Wendel. 34: 401-437. 16: 73-84. E.. (2000).. Jiang.Theor. and Khadi. L. Stewart. M. R. J. Lan.V.. DelMonte. F. Zhao. S. S. H...H. 85: 1364-1368. Ming. Sci. C.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Theor.. and Soltis. T. C. USA 95. Sci...Singh. Differential evolutionary dynamics of duplicated paralogous Adh loci in allotetraploid cotton (Gossypium). and Gotmare Vinita.N.Ansighkar A. H. R. A. 213-225 Kulkarni. Small. Appl. C. L. L. C. .. Bot. Hang.. . C. Phylogeny. Malvaceae). J. Islam-Faridi. Proc. S.. Burow.. A.. World Cotton Research Conference –3 held at Cape Town South Africa. S. Appl. Brubaker. Katsar.N.. QTL analysis of leaf morphology in tetraploid Gossypium (Cotton). Jiang. F. Wright. Acad. McKnight. Evol. Am. D. A.. J.B. Mol. a. Biol. J. Mergeai. Gemone 43: 874880. J. Soltis. (2000). Mol. L. J. Appl..N. Small.S. (1998). Khadi. 19:597-607. R. –R. M. (1998). Proc. Genet.. The dynamic nature of polyploid genomes. S.H. Genet.Long linted G. and Patterson. B. Evol. (1999). and intraspecific variation of Adh sequences in New World diploid cottons (Gossypium L. 8089-8091. J Rong . Theor. Genet. Natl. and Wright. S.. M. Craven.. The evoluationary fate and consequences of duplicate genes. and Wendel. F. R. L. Natl. E. Retroelement activation followed by rapid repression in interspecific hybrid plants. J. J. A. Seelanan.. Paterson. Liu.. L. Science 290: 1151-1155. –X. Waghmare V. (1998). Crane. Ei-Zik. Wright. tomentosum. Genetics 155: 1913-1926. (1995). R... F. Elsik. E.. C. 9-13 March 2003 pp. (2000). USA 92.. Syst. Liu. D. H.. Draye. Rev. duplication.V. Copy number liability and evolutionary dynamics of the Adh gene family in diploid and tetraploid cotton (Gossypium). Annu. B. F. T.. J.. C. J. Genetics 149: 1987-1996. Price. Polyploidy and the evolutionary history of Cotton. Cronn ( 2003) .H. Thaxton P.-P. Advances of Agronomy .F. Crane. 78: 139-186 Wright R. . Hanson. Y. K. F. Biol. X. and Paterson. A... C. Plant Mol. 186 .. C. (1998). H.. Dispersed repetitive DNA has spread to new genome since polyploid formation in cotton. H. Wendel.. Stelly. Wendel J F (2000). Zhao. M and Paterson A.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Genet. M. 8: 479-492. Genome evolution in polyploids. J.M . ( 1998) D-subgenome bias of Xcm resistance genmes in tetraploid Gossypium (cotton) suggests that polyploid formation has created novel avenues for evolution. Si. 42: 225-249 Wendel J F and R. El Zik . R. Genome Res.. E. J.676. 111: 665. D. 8-3. The tinctorius-type F1 plants were both male sterile and fertile. glaucus M. It is now grown for its much-valued edible oil.) AND WILD SPECIES. K1 and M. Material and methods Plant material: The wild species C. glaucus M. The resistance sources for many biotic stresses are either not available or extremely narrow within the cultivated species. partial to fully male sterile and fertile progenies with few distinctly intermediate traits of both parents as well as fertile progenies with predominantly tinctorius phenotype have appeared.) Anjani. Safflower (Carthamus tinctorius L. ANATOLICUS (BIOSS.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era CRYPTIC GENOMIC EXCHANGE BETWEEN CULTIVATED SAFFLOWER (CARTHAMUS TINCTORIUS L. The nuclear DNA content of male parent C. glaucus ssp anatolicus was quite high (6. The wild species Carthamus glaucus ssp anatolicus (2n=20) is not readily crossable to C. Carthamus species remained unexploited and there has been little research on these species. tinctorius (2. This paper will discuss the confirmation of partial hybridity and cryptic genomic exchange between the incompatible parental species.) and the wild species C. meiotic chromosomal behaviour and nuclear DNA content. BIEB. DNA content of partial hybrids (2. meiosis and nuclear DNA (2C) content were investigated in partial hybrids between cultivated safflower (C. Hyderabad-500 030. tinctorius is the only cultivated species. ssp anatolicus. Of which. It is a source of resistance to Fusarium wilt. The phenotype and 2C DNA content strongly suggest that the phenotype and genotype of partial hybrids were due to higher contribution of female parent to hybrid.) belongs to the family Compositae or Asteraceae. Email: anjani_kammili @rediffmail. In order to assay the feasibility of transferring the desirable trait from the wild species to cultivated one. tinctoius) as a female was manually crossed to C. Bieb. C. India. Introduction Safflower is a multi-purpose crop with wide adoptability.08 pg) was close to that of C. This indicated that the tinctorius-type F1 plants resulted from partial hybridization. C. tinctorius in morphological and phenological traits while the rest were intermediate to both the parents and female-sterile due to cytogenetic abnormalities. SUBSP. glaucus 1. The occurrence of plants with few intermediate traits among progenies of tinctorius-type hybrid suggests genome exchange between male and female genomes.31 pg). GLAUCUS M. when this interpecific cross was a failure due to female-male sterility. tinctorius (2n=24) due to chromosomal imbalance.com 187 . Nuclear DNA content of parents and tinctorius-type hybrids was estimated using Partec-PA flow cytometry. In F2 and F3 of tinctoriustype F1 plants.33 pg) as corresponding to their phenotype. Directorate of Oilseeds Research. tinctorius L. Pallavi ABSTRACT Phenotypic traits. the cultivated species (C. In fertile hybrids there were 24 chromosomes forming 10 to 12 bivalents. The cryptic genome exchange between cultivated and wild species in partial hybrids would allow exploitation of wild species genome.) to confirm partial hybridity About 2% of F1 plants were predominantly similar to the female parent C. Herein we report on the remarkable features displayed by interspecific hybrid plants and their self-derivatives and backcross individuals with regard to phenotypic traits. Bieb. Safflower is vulnerable to many diseases and insect pests. The genus Carthamus contains approximately 25 valid species. the major disease of safflower. ssp anatolicus (Bioss. 2n=20. The unknown samples as well as the remaining ‘A1’ were then analyzed. secondary and higher order capitula by visual observation for pollen presence.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era M. Crude samples containing nuclei were prepared from leaf material by chopping it very finely with a sharp razor blade in 300l of CyStain UV Precise P nuclei extraction buffer 188 and left the suspension for 10 minutes. Since CV of DNA peaks says nothing about the reproducibility of DNA content replicate measurements were taken for each genotype. To study meiosis. therefore. self-pollinated progeny of the plants of C. The F1 plants of the cross C. To minimize variation due to runs on different days. Preparation of nuclear samples: Approximately 0. 2C value represents the DNA content of a diploid somatic nucleus. SFS 2032). The recessive genetic male sterile lines MS 107 (R). glaucus ssp anatolicus exhibited intermediate-type and tinctorius-type . was added to the filtrated suspension. and by squashing anthers prior to anthesis in acetocarmine for stainability of pollen grains under microscope. The second sample of ‘A1’ was to determine accuracy. floral buds were fixed in Piennar’s fluid. Germany. tinctorius lines and C. relative to the standard.5 cm square slice of freshly picked leaf of a plant at rosette stage was used for each sample. Unstained pollen grains were considered sterile. tinctorius-type F1 and F2 plants. The first ‘A1’ sample was used to set the fluorescence intensity at channel 50. tinctorius (‘A1’. tinctorius x C. Fluorescence intensities were registered over 500 channels and displayed as histograms. Samples giving coefficient of variation (CV) less than 6% were considered for nuclear DNA count. glaucus ssp anatolicus (2n=20) belong to two different chromosomal groups of the genus Carthamus and do not cross readily (Ashri and Knowles1960). ‘A1’ is a variety and SFS 9943 and SFS 2032 are highly stabilized pure lines. the stained nuclei were analyzed using Partec-PA flow cytometer equipped with a mercury arc lamp. For nuclear DNA (2C) estimates. The symbol C corresponds to the haploid nuclear DNA content. PMC smears were stained with aceto-carmine. Diploid chromosome number of each species was confirmed prior to interspecific hybridization. Then the suspension was filtered through filer CellTrics and 1200l of CyStain UV Precise P staining buffer containing 4×-6×-diamidino-2phenylindole (DAPI). tinctorius were used as male sterile female parents in the crossing programme. At least 5000 nuclei were analyzed per run and each sample was repeated three to four times. The data were. Each capsule of female and male parents was covered with butter paper bag prior to anthesis as well as after pollination to prevent cross contamination through honeybee. SFS 9943. collected and compared as fluorescence intensity relative to ‘A1’. The initial crosses between male sterile C. Florescence ratios. tinctorius. The two types of phenotypes observed in F1 were backcrossed to PI 259994-1.). was established in the field and self-pollinated since 1997 to have true-to-types. glaucus ssp anatolicus and of the female parents used in the initial crosses and of PI 259994-1 used in backcross were taken along with three genotypes of C. a non-genetic male sterile line of C. two samples of ‘A1’ nuclei were analyzed each day. MS 6 (O) and MS 9 (O) belong to cultivated species C.tinctorius (2n=24) and C. Bieb. ssp anatolicus (Bioss. glaucus ssp anatolicus were made by hand pollination under controlled conditions. were used to calculate DNA content (pg) according to the formula 2C DNA content/ sample (pg): [Sample Peak mean x Standard DNA content]/Standard Peak mean (Lysak and Dolezel 1998). primary. Male sterility was assessed in main. After 20 to 30 minutes. Results and Discussion Morphological and Chromosomal studies: C. received from Institute of Plant Genetics and Crop Plant Research. But the meiotic abnormalities in backcross progenies clearly indicate presence of genomic variation in tinctorius-type F1 hybrid . Pollen stainability of sterile interspecific hybrids and the sterile backcross progenies has ranged from 0-3. In sib-cross. Genomic exchange between parental species was supported by presence of 20-22 univalents. tinctorius). loops and clumps in (F1-tinctoius-type x C. Pairing of chromosomes in intermediate-type F1 plants was not complete. These chromosomal aberrations were responsible for sterility in intermediate-type F1 plants. Sterile tinctorius-type plants were backcrossed to PI 259994-1 (C. Variation in pollen size and presence of multiple microspores were noticed in sterile plants. Similar chromosomal number and behaviour was observed in tinctorius-type F2 and F3 plants and in recombinant plants that possessed a few distinctly intermediate traits of both parents. about 2% of interspecific hybrid plants predominantly resembled C. F2 and F3 generations.6%. laggards. laggards and bridges were also observed. The intermediate-type phenotype and formation of bivalents and chiasmata in these F1 plants indicate genomic exchange between parental species. Tinctoius-type plants were observed among backcross progeny. glaucus ssp anatolicus and spontaneous doubling of chromosomes of C. where anaphase-II and telophase-II were found simultaneously in the same cell. which configured tinctorius-type plants in F 1. asynchronization of meiotic divisions was seen. uniform in size and round in shape. there should be perfect meiosis in backcross progenies when they were backcrossed to C. tinctorius during hybrid embryo development. tinctorius) backcross progenies. About 98% of F1 plants were intermediate to both parental species in their morphological and phenological traits and were female-male sterile. The uniform pollen size in them is in full accord with regular chromosome disjunction at anaphase. backcross. The fertile tinctoriustype plants were advanced to F2 and F3 through self-pollination and sib crossing to sister plants. Appearance of plants possessing intermediate traits with 24 chromosomes in F2 and F3 of tinctorius-type F1 plants indicates that C. Pollen grains of fertile plants were well stained. tinctorius and about 2% showed a few intermediate traits of both parents. glaucus ssp anatolicus genome was distributed during zygote formation but only a part of it was able to mix with the entire female genome prior to elimination of its chromosomes leading to partial hybridization. chromosome analysis of 189 tinctorius-type hybrid plants revealed presence of 24 chromosomes at meiosis instead of expected 22 chromosomes. about 98% of the plants resembled C. There was an indication of loose pairing between one pair of heteromorphic chromosomes forming rodshape bivalent. tinctorius. backcrossing to C. The mean number of bivalents per cell was 6 with a range from 0 to 9 whereas the mean number of the univalents per cell was 11 with a range from 10 to 22. In some of the cells. The chromosome number in pollen mother cells ranged from 20 to 22. which is an indication of partial non-homology. At the same time. tinctorius. Intermediate-type plants did not produce seed upon self-pollination. The variation in pollen size and presence of multiple microspores in sterile intermediate-type plants was in full accord with the irregular and multiploar disjunction of chromosomes at anaphase. Chromosome number and behaviour suggest progressive elimination of chromosomes of C. If there was no genome exchange between parental species and the only genome of C. Occurrence of multipolar division. Furthermore. There was perfect pairing of chromosomes in tinctorius-type F1 plants and 12 bivalents at diakinesis.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era phenotypes. tinctorius persisted in tinctorius-type F1 hybrids. sib crossing to fertile tinctorius-type sister plants thus indicating their male-female sterility. tinctorius and were both male sterile and fertile. The CV of analyses was from 4. bulbosum (Kasha and Kao 1970) and Crepis capillaries x C. partial hybridization had taken place between C. The 2C DNA content variability among individual partial hybrids could be due to variation in the amount of genome exchanged between parents. Partial hybridization was interpreted as a consequence of genomic shock (McClintock 1984).1999.31 pg. the present investigation indicates that under controlled pollination. Faure et al 2002) and cotton interspecific hybrids (Wendel et al 1995). tinctorius genotypes. proximity of their DNA content to . Its DNA content was in close agreement with that of other genotypes of C. which was in acceptable limits for accuracy of the measurements.1 to 5. Moscone et al. and N. Only very few well-documented cases of chromosome doubling have been reported.08 pg. Significant variation was not observed in DNA content among various C.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era that appeared from cryptic genomic exchange between parental species.33 pg and of C. tinctorius (2. wheat and oat pollinated by maize. Nuclear DNA content of tinctorius-type partial hybrids was very close to that of C.08 pg) from C. glaucus ssp anatolicus and doubling of C.6. tinctorius. Partial hybridization was reported in rice with introgressed traits from Zizania latifolia (Liu et al 1999).8-3. The signals occurring in the lower-channel region (0-50) are resulted from disrupted nuclei and/or non-specific staining of other cell constituents. The men nuclear DNA content of C. tabacum L. Asif et al.8 to 3. it can be attributed that the minute genomic exchange between parental species was responsible for the slight deviation of DNA content of partial hybrids (2. This is still to be analyzed but this sort of mild genomic shock is also possibly important in interspecific hybridization of incompatible species to isolate partial hybrids having introgressed hidden genomic part of the eliminated wild species. neglecta (Wallace and Landgridge 1971). Elimination of complete set of chromosomes of one species in interspecific hybridization was also observed in the interspecific cross between Hordeum vulgare and H. indicating absence of dividing cells in the material (Figure1). glaucus ssp anatolicus leading to occurrence of interspecific partial hybrids. 2003. Appearance of a few recombinants in F2 and F3. tinctorius and partial hybrids supports the cytogenetic findings of elimination of chromosomes of C. tinctorius was 2. This also validates that flow cytometry 190 had unambiguously determined the 2n ploidy level of material studied. Why genomic shock was seen only in a few zygotes that produced tinctorius-type partial hybrids is not understood. Table1 gives the nuclear DNA (2C) contents of parental species and partial interspecific hybrids. the amphidiploid hybrid between Nicotiana glutinosa L. tinctorius and C. Peaks corresponding to the G2+M (M=mitosis) phase or beyond were not detected. The close harmony between DNA contents of C. for example. Nuclear DNA content: Flow cytometry was used to determine nuclear DNA content of the parental species and the hybrid plants as it was found to be a useful and highly sensitive tool for determining nuclear DNA content in many plant species (Armuganathan et al. between cultivated sunflower and Helianthus tuberosus (Natali et al 1998. The nuclear DNA content varied remarkably between parental species. Because of occurrence of plants with a few intermediate traits expressed by recombinants in F2 and F3. ‘A1’ samples were used for determining the accuracy.33 pg). ranging from 2. tinctorius chromosomes during hybrid embryo development. tinctorius. 2001. Thiem and Sliwinska 2003). Flow cytometric analysis of nuclei isolated from leaves showed one peak that corresponds to the G0/G1 phase (2C level) of the cell cycle. glaucus ssp anatolicus was 6. (Clausen and Goodspeed 1925) and chromosome doubling in vine cacti hybrids (Tel-Zur et al 2003). In conclusion. . cytological and basic nuclear DNA content level. However.1960. an experimental verification of Winge’s hypothesis.. Nuclear DNA content of thirteen turfgrass species by flow cytometry.. Goodspeed. Some of the partial hybrids exhibited resistance against Fusarium wilt in wilt sick plot in two contiguous years.. . glaucus ssp anatolicus into cultivated species. The closeness of phenotype as well as DNA content of tinctorius-type F1 partial hybrids to C. F. 1984. Crop Sci. which would further support the cryptic genomic exchange between parental species at molecular level. M. R. High-frequency haploid production in barley (Hordeum vulagare L. Work is underway to analyse DNA of these plants to spot the introgressed or recombined fragments using various DNA markers. Ashri A and Knowles PF. Hunziker. 2001.. Qu.. K. Kao. K.. Estimation of nuclear DNA content in Sesleria (Poaceae). Faure . A tetraploid glutinosa-tabacum hybrid. Tallury.. which led to the conclusion that the crosses had failed.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era C. The significance of response of genome to challenge. Fraser.). Partial hybridization phenomenon in many crops when crossed with their wild relatives was overlooked because most of the plants did not display the expected hybrid pattern but instead resembled the female parent.Y. J Genetics and Breeding. indicating introgression of wilt resistant genomic part of C. Caryologia. H. Partial hybridization in wild crosses between cultivated sunflower and the perennial Helianthus species H..1999. S. M.A. R. J. Zhao.. tinctorius genome was contributed maximum and only a part of C. 51: 123-132. in our experiment this phenomenon could be established evidently at morphological.N.J. C. M. J. Liu. K.. Zhao. 54: 161-168. Science. Nature. The proposition of partial hybridization was conclusively proved in this investigation. J. Moscone. Asif.).. E. Mak.. 39: 1518-1521. Serieys.S. I. B.. Ebert. Kaan. 89: 31-39. 1925... Interspecific hybridization in Nicotiana. Caryologia.H. Characterization of indigenous Musa species based on flow cytometric analysis of ploidy and nuclear DNA content.H. 191 REFERENCES Armuganathan. II. 225: 874-876.. Agron. Ann of Bot. 226: 792-801. Lysak.J. T.. glaucus ssp anatolicus genome was able to mix with it. E. 1999.M. F. J. M. Berville. H.. Production and molecular characterization of rice lines with introgressed traits from a wild species Zizania latifolia (Griseb.10: 279-284. Othman.) species and their hybrids. So it was possible to transfer the desirable trait of C. Dolezel. Partial hybridization had allowed us to exploit a part of the wild species genome. 2002. Cazaux. tinctorius and occurrence of intermediate-type plants in F2 and F3 point out that C. F. R.. A. 52: 11-17.L. Zhao.N. Piao.1998. Baranyi.H.. mollis and H. Ehrendorfer. when the cross between cultivated safflower and wild species had apparently failed. R.. McClintock B. tinctorius with slight deviation and the DNA content variability among partial hybrids support cryptic genomic exchange between parental species as a result of partial hybridization and elimination of chromosomes of wild species as a consequence of genomic shock. Clausen. Genetics. 53: 279-284. The imprecise meiotic behaviour of backcross progenies also support the existence of cryptic genomic exchange that caused partial homology among backcross progeny chromosomes. glaucus ssp anatolicus to cultivated safflower through partial hybridization.P. Greilhuber. Kasha.E. orgyalis. 1970.A. Cytogenetics of safflower (Carthamus L. Bruneau. .. Heredity. Sci.. Wendel. H. Y. E. A. 1971. S. Abbo. Pl. 92: 280284. Proc.) in vitro cultures.. Bi-directional interlocus concerted evolution following alloploid speciation in cotton (Gossypium). Giordani. tinctorius (c) Tinctorius-type partial hybrid between C. Chromosome doubling in vine cacti hybrids. National Academy of Science of the USA. J.. 92: 21-29. Ann. A. Seelanan..T. Natali. Bar-Zvi. T. N. Y-axis: Nuclei count) (a) C.. T.F. glaucus ssp anatolicus (b) C. of Bot.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era A. B. Mizarhi. Polizzi. WHR.. Histograms of nuclear DNA content of parents and partial hybrid (X-axis: Channel number. L. glaucus ssp anatolicus 192 . D. Figure 1. Pugliesi.. Tel-Zur.164: 129-134. Differential amphiplasty and the control of ribosomal RNA synthesis. Cavallini. 1998. Genomic alterations in the interspecific hybrid Helianthus annuus x Helianthus tuberosus. Landgrige. J Heredity.. 97: 1240-1247. 1995. E. Thiem.. Sliwinska. Schnabel. Analysis of nuclear DNA content in Capsicum (Solanaceae) by flow cytometry and Feulgen densitometry. C.. 27: 1-13. Wallace. tinctorius and C. 94 (4): 329-333. Fambrini. Theoretical and Applied Genetics. Flow cytometric analysis of nuclear DNA content in cloudberry (Rubus chamaemorus L. M. 2003. 2003. 2003. 2-5. glaucus ssp anatolicus Parental species and partial hybrid C. tinctoius x C. tinctorius (Female parent) C.08 CV (%) 4.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1. tinctorius and C.1 5.3. glaucus ssp anatolicus (Male parent) C.8 .31 2.1 4.33 6. glaucus ssp anatolicus Chromosome number (2n) 24 20 24 2C DNA content (pg) 2. Nuclear DNA (2C) content of parents and partial hybrids between C.6 193 . several morphological. hexaploids and octoploids in C. N. Violet D’Souza. All the ploidy variants were studied for morphological characters such as leaf shape.Chikmagalur. can therefore. biochemical and molecular aspects of ploidy variants in coffee were analysed with an objective to better understand the influence ploidy on these characteristics. INDIA . leaf venation pattern.1. SantaRam and Jayarama ABSTRACT The genus Coffea consists of more than hundred species of which only C. M.K. Genetic diversification in polyploids. arabica (known as arabica coffee) and C.e. Sabir. polyploids and their diploid progenitors have been compared for diverse aspects like photosynthetic rate. For exploiting genetic potentialities. which is a diploid species. arabica. which is a putative allotetraploid. amino acid content and flavonoid profile pattern also have been investigated. In addition. Sreenivasan et al1982). allowing greater diversity at higher ploidy levels (Wendel 2000). Introduction The genus Coffea belongs to the family Rubiaceae and consists of over 100 species (Bridson and Verdcourt 1988). In the present study. Sandhyarani. a series of ploidy variants of spontaneous origin were recovered and documented. In addition. All the species of the genus Coffea are diploids and self incompatible except C. and stomatal features. colchicine was used successfully to induce tetraploidy. lead to increased polymorphism in nuclear and cytoplasmic markers. starch. Coffee Research Station – 577117 Dist. arabica. Vishveshwara 1960. Anil Kumar. Materials and Methods The details of plant materials used in the present study are given in Table. arabica and other species has been reported by various workers (Sybenga 1960. canephora. which is an allotetraploid and self-compatible species. Mythrasree. Karnataka. Central Coffee Research Institute.1. sugar. mutational and epigenetic interactions) and polyploidization will affect DNA structure. ( Couturon 1982). Ploidy status of all these materials was confirmed through chromosome counting (Chinnappa 1. polyploidy in higher plants has received maximum attention (Grant 1981. fertility. Due to the ubiquitous occurrence. arabica. Hareesh. The biochemical characters such as chlorophyll.K. canephora . carbohydrate. 194 biochemical constituents and molecular diversity.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era MORPHOLOGICAL. leaf anatomy. R. a few spontaneous triploid plants conforming to either arabica or robusta phenotype were also documented. These results along with the utilization of the ploidy variants in coffee breeding program is discussed. S. Techniques are also devised to obtain spontaneous haploids in C. The spontaneous occurrence of different ploidy levels such as haploids. BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OF PLOIDY VARIANTS IN COFFEE FOR GENETIC IMPROVEMENT Mishra. Masterson 1994). a few spontaneous triploid plants conforming to either arabica or robusta phenotype were also recovered. A perusal of literature reveals that duplicated genes caused by polyploidy retain their original or similar functions or one copy may become silenced (i. yield. In C. Molecular characterization of all the ploidy variants was carried out by using RAPD and PCR-RFLP and polymorphism was recorded. canephora (known as robusta coffee) are commercially cultivated. All the coffee species are diploid except C. In C. phenol.B. S. M. A. R. .0. Further the leaves were treated with sodium hydroxide at 400C for 12 hours and cleared with a thin brush. Similarly. Amplified PCR products were electrophoresed on an agarose gel (1.5mM MgCl2. pollen samples were stained in saturated solution of potassium iodideiodine (I2 K + I) and darkly stained fertile pollen grains were measured by ocular micrometer. Leaf area measurements were carried out using PT area meter. PCR reaction was performed in Palm Cycler (Corbett Research) using the following amplification profile: 1 cycle of 950C for 4 min followed by 40 cycles of 950C for 1 min 380C for 1min. Mishra et al. Sugars and starch were estimated following the method of Nelson (1944) and Patel (1970) respectively.. Genomic DNA was isolated from the fresh young leaves using the extraction protocol by Murray and Thompson (1990) with modifications.100 oM dNTP. For flavanoid studies. For leaf venation patter studies. 3units/ol). A strip of lower epidermis from the middle portion of the leaf was peeled off and mounted in glycerol after staining with safranin. Chlorophyll extraction was carried out from 100 mg samples of fully expanded leaves (4th pair) by using DMSO following the method of Hiscox and Israelstam (1979).3 o M of the primer (Operon Technologies) . (Delta – T Devices). and b= collective number of spots exhibited individually.5%) pre stained with Ethidium bromide in 1xTAE buffer and visualized by Syngene Gene snap (UK). the protocol adapted by our previous study (Mishra et al.1998) was 195 followed. chl b and total chlorophyll content were calculated using the formula of Arnon (1949). For anatomical studies. To determine pollen grain diameter. For detail microscopic studies. Leaves were further treated with saturated choral hydrate solution. For counting plastids in guard cells the epidermal peels were stripped and stained in a saturated solution of potassium iodide – iodine (I2 K + I) and mounted in glycerol. Total Carbohydrate was determined in the leaf samples of all the ploidy variants by Anthrone method following the procedure of Hedge and Hofreiter (1962). The flavanoid similarity was computed for pairwise comparison between different ploidy variants using the formula a/a+b where a= number of spots common to both. Chl a. Counts were made on plastids present in two guard cells of sixty stomata per plant in single plant samples and thirty stomata per plant in other samples.50 ng of template DNA. leaf samples were fixed in FAA and processed following the conventional paraffin methods of Johanson (1940). cleared leaf pieces were stained in safranin and mounted in DPX. 720C for 2 min 1 cycle: and lastly 1 cycle of 720C for 10 min. 1U Taq DNA polymerase (Bangalore Genei. PCR amplification using random primers PCR was carried out in a total volume of 25Pl Reaction mixture containing in 1x Taq assay buffer with 1. (unpublished).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 1968. Serial transections were cut using a rotary microtome and sections were stained in crystal violet – Erythrosin and mounted in DPX mountant. To determine stomatal guard cell length. Sreenivasan et al1982. 25 randomly selected microscopic field areas from five leaves were counted per plant to obtain stomatal and epidermal cell frequency. The method of Moore and Stein (1948) was used for calculating the total free amino acids and phenolics were analysed following the method of Malick and Singh (1980). third pair leaves were collected and immersed in 70% ethanol with several changes. For stomatal measurements the first pair of fully expanded leaves were used. 25 randomly selected stomata from five leaves per plant were measured microscopically using an ocular micrometer. canephora. The same conclusion was also drawn by Bingham (1968) in alfalfa and by Krishnaswami and Andal (1978) in Gossypium.1). The reduction in stomatal and epidermal cell frequency at higher ploidy level was attributed to the larger stomatal and epidermal cell size as well as reduced stomatal differentiation at higher ploidy level (Mishra et al. 1mg/ml BSA. In both C. canephora and dihaploids and tetraploids of C. no significant difference in stomatal frequency could be found between the hexaploid and octoploid levels although the mean epidermal cell frequency was significantly different. PCR amplicons were separated on an agarose gel (1. Mishra. arabica and C. Restriction enzyme (Fermentas) 4U at 370C for 2-3 hours. Stomatal characteristics The mean stomatal and epidermal cell 196 frequency.75) as well as tetraploids of C. there is a progressive increase in majority of the . the pollen grain diameter was found to be almost same indicating the less importance of genomic constitution affecting this trait in coffee (Sreenivasan et al.arabica (15..96) and C. The mean number of plastids in stomatal guard cells at different ploidy evels was counted and progressive increase in plastid number was observed with the increase in ploidy level (Fig1. Distinct differences were observed between the diploids and tetraploids of C. From the table it is apparent that although the basic anatomical structure is same at different ploidy levels. No significant differences in plastid number were observed between dihaploid of C. (1967) also observed a positive correlation with pollen grain diameter and ploidy level in Andropogon and Brassica respectively and the present observation lends support to their views. arabica (Table 1). 1992.29). Results and Discussion Leaf area and Pollen grain diameter Leaf area and pollen grain diameter associated with various ploidy variants were analysed.5%) pre-stained with Ethidium bromide in 1xTAE buffer and visualized by Syngene Gene snap UK. However. Foliar anatomy and venation pattern Various anatomical characters were analysed in the different ploidy groups and presented in table 2.1992). Restriction digestion of The Genomic DNA and PCR fragments PCR products (5-10ol) were digested in a reaction mixture (20ol) containing: 2. 1997). Gould (1957) and Speckmann et al. stomatal guard cell length and stomatal plastid number were calculated at different ploidy levels and data are presented in Table1. In dihaploid of C. The digested DNA was electrophored on 1.05) and natural diploids of C.0ol of 10x Assay buffer. canephora. And PCR was done according to Dane et al (2004). In contrast it is interesting to note that there was a progressive increase in pollen grain diameter with the increase in ploidy level (Table. 1991.J-K) except at the octoploid level where the plastid number decreased compared to the hexaploid level (Table1). 1992). However. there is no regular relation between leaf area and other ploidy levels. the stomatal and epidermal cell frequency decreased while stomatal guard cell length increased with an increase in ploidy level.5% agarose gel and visualized as described earlier. canephora (15. arabica and diploid of C. This clearly suggested that the plastid number is directly related to the chromosome number rather than genomic constitution (Sreenivasan et al. canephora (8.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era PCR amplification using mitochondria and chloroplast specific primers Intergenic regions of the chloroplast genome (trnL intron ) were amplified using conesenses primers (Taberlet et al 1991) .arabica (9. Sreenivasan et al. Starch. In general. thickness of spongy parenchyma and lamina thickness in polyploids compared to diploids and the present observation is in agreement with their report. This clearly suggests that not only ployploidy affect different physiological parameters differently but also depend upon the genotype. 1I). the percentage of total sugar. diameter of palisade. Among arabica ploidy variants. communicated). vertical extent of palisade tissue. starch and sugar content in different ploidy level of Coffea was studied and the same is given in table 4. the thickness of the 1Ú. At higher ploidy level. Leaf thickness was found to be strongly correlated with per unit area chlorophyll content (Leverenz. However in C. number of layers in spongy parenchyma and diameter of spongy cells. which is of hybrid origin. lamina thickness. (Table 3a) However. In contrast to the foregoing. In tall fescue. diameter of palisade cells.. In Coffea increase in leaf thickness from dihaploid to octoploid level was reported (Prakash et al. Biochemical characteristics Chlorophyll content In coffee. canephora. 1F. 1993). generally coffee polyploids (Hexaploids and octoploids of arabica and tetraploids of robusta) retain the full leaf complements and remain green during the drought conditions.18 mg/g) among the ploidy variants. except in triploid. an ascending order in chlorophyll content per unit leaf area was registered with increase in ploidy level (Table 3b). the areoles were small and the vein islets inside the areoles are extensively branched and very close to each other. and 3Ú veins increased with the increase of ploidy level (Fig1C. In field conditions. the per cent of total sugar and carbohydrate decreased and starch content increased from diploid to tetraploid level (Table 4). 1987) with increase of ploidy level. arabica. carbohydrate and starch were observed at tetraploid level. Phenols and Amino Acids The phenol and amino acid content was studied at various ploidy levels and data is presented in table 4. The leaf venation pattern was studied at different ploidy levels of Coffea. The small areoles with extensive vein islets is proposed to be advantageous in water conductions during stress conditions (Mishra et al. maximum percentage of sugar. In C. 1987).1I ) Suryakumari et al. (1989) observed similar tendency of increase in thickness of palisade. canephora. spongy tissue increased progressively with the increase of ploidy level (Fig1. Dihaploid arabica contain the highest chlorophyll (1. starch and carbohydrate increased from dihaploid to tetraploid level but decreased at the hexaploid and octoploid level. Contrasting reports are available regarding the effects of polyploidy on chlorophyll content in many plant species. total chlorophyll content generally decreased with the increase of ploidy level although significant differences were not seen in few cases (Mishra et al. It is observed that among ploidy variants of arabica octoploid contains highest phenol and lowest amino acids where . Hence the observed increase in chlorophyll value per unit leaf area could be due to the influence of leaf thickness. thickness of spongy tissue. chlorophyll/ mg/g fresh leaf tissue increased whereas in winter rye chlorophyll content decreased (Bordyugova. arabica and in C . chlorophyll content of diploid (1.1996).785 mg/g) and tetraploid (1. 2Ú.76 mg/ g) where as octoploid manifested the least chlorophyll (1. In C.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era anatomical features viz. vertical extent of palisade tissue. However no consistent pattern was observed among all the ploidy variants. in C. Therefore this anatomical feature could be of adaptive significance in combating drought conditions. carbohydrate and sugar content The percentage of total carbohydrate.497mg/g) shows significant 197 differences.canephora the lamina thickness.A. The hexaploid and octoploid group displayed less number of spots compared to tetraploid group. Restriction digestion of the PCR product with enzyme AluI revealed polymorphism among the ploidy variants (Fig 2C).795 and Sarchimor and thereby further strengthening our contention that hexaploids in coffee are of autoallopolyploid in origin. most of the flavanoid spots observed in hexaploids were also encountered in tetraploid group. Molecular analysis RAPD Random amplified Polymorphic DNA analysis was initiated to find out the polymorphism among ploidy variants. Most of the flavanoid spots observed in the dihaploid were encountered in tetraploid. Although the amplified DNA fragment seemed to be the same in size. This observation further strengthens the contention that in plants polyploidy affect different physiological and biochemical constituents differentially in various genotypes. canephora. the intensity of the bands were less in Sarchimor tetraploid and hexaploid and natural octoploid indicating the possibility of low copy number in these ploidy variants. A qualitative difference in flavanoid pattern was observed among the members. In addition. (Fig 2A).1991). Flavonoids Leaf flavanoids were isolated from various ploidy levels of coffee. In C. Loss of duplicate gene expression has been demonstrated in polyploid crop including Triticum and Chenopodium (Hart 1983. tetraploid group contain additional spots those are not seen in dihaploid. phenolic content increased and amino acids content decreased from diploid to tetraploid level. Interestingly. Among arabica ploidy variants. dihaploids exhibit the minimum and tetraploids exhibit the maximum flavanoid profile pattern compared to any other group (data not shown). arabica. Wilson et al. tetraploids contain the maximum amino acid content than any other ploidy variants. which supports the hypothesis of autoallopolyploid origin of hexaploid. 1983) and if so there may be a chance of gene silencing involving the loss of duplicate gene expression at higher ploidy level. variation in flavanoid profile pattern was observed between the diploid and tetraploid group. two bands which are present in diploid were missing in tetraploid. This could be ascribed to the origin of tetraploid and their genomic constitution (Saraswathi et al . Based on the similarity index value diploid was found close to colchicines 198 induced tetraploid than natural tetraploid (Table 3b). Using Operon primer (GGGTAACGCC) polymorphism was noticed among the samples. Variations in cpDNA are known to have evolutionary significance and therefore the . The RAPD data further revealed the close similarity between the tetraploid and hexaploid of S. canephora. Based upon the flavonoid similarity index value.1991) successfully amplified the corresponding cpDNA region in all the ploidy variants (Fig 2B). dihaploids of arabica was found to be closer to the octoploid group (Table 3a). In addition to the above. This missing bands in tetraploid could be explained either due to the alteration or the elimination of the particular sequence during genome duplication. In C. (1993) explained that flavanoid biosynthesis efficiency reached its maximum at tetraploid level and beyond that there is no increase. Mishra et al. canephora. Chloroplast and Mitochondrial DNA analysis The consensus primer pair of the trnL intron (Taberlet. a close similarity was observed between the two triploids of coffee and thereby supporting the close affinity between them.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era as in C. However more primers need to be screened for molecular evaluation of ploidy variants in coffee. In C. A.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era observed variation in cpDNA among the ploidy variants could be associated with ecological adaptation during evolutionary process. Arnon.1968. 1968. Dumolin et al. 24:1-15 Bingham. 1988. Due to its ubiquitous nature.C. V. C. D. Stomatal chloroplast in alfalfa at four ploidy levels. 1987. Bridson. and Verdcourt.795 and Sarchimor and hexaploid of Sarchimor (Fig 2D). However recently. In plants. 199 arabica) tetraploid level seems to be the optimum level as revealed by various morphological and biochemical characteristics.D. Our hypothesis is supported by the fact that tetraploids are commercially cultivated wherein the physiological and biochemical functions have reached their efficiency. Interspecific hybrids of Coffea canephora x C. which further suggests the gene diversification during evolution. E. Similarly.Rubiaceae (part2) Polhill R M (Ed) 727p.T. in coffee. Repeated attempts to amplify the mtDNA in these samples failed which indicate the possibility of sequence divergence in mitochondrial genome in those ploidy variants. REFERENCES Amaravenmathy. A. Effect of polyploidy on chlorophyll content of the leaves in winter rye. Although the PCR amplified DNA fragments seemed to be the same in size but there were differences in copy number. Copper enzymes in isolated chloroplasts. a natural triploid of Coffea canephora was crossed with arabica tetraploid and hybrid plants with both arabica and canephora phenotypes were recovered (Amaravenmathy et al. 2004.I. Flora of tropical east Africa. polyploidy is the subject of intense research by various workers. hexaploids and triploids are also important as they form the important breeding material for coffee genetic improvement.M. Polyploids and coffee breeding Unlike other crops. As a first step. 2004).. The consensus primer pair of the mt-nad1B – nad 1C region of the mitochondrial genome (Demesure et al. C. E. P. In the foregoing as we have observed. Polyphenol oxidase in Beta vulgaris L. Individual F1 plants were selfed and progenies were currently evaluated for various characteristics. the utilization of polyploids in coffee breeding is meagre. 37: 676-677. In coffee (C. research was focussed on utilizing the polyploids in coffee breeding. Chinnappa. Conclusion Polyploidy or the doubling of chromosome is a wide spread phenomenon in plants.1949. S. . Kumar. In: Novoe V Selektsii i. Bordyugova.S.. Crop Science 8: 509-511. polyploidy has differentially affected several features in different genotypes. Robusta-like Coffee plants with Arabica-like Cup qualityMyth or Possibility? ASIC 20th Bangalore 1165-1170.. Seminovodstve selskokokhozyaibrst vennykh kul’ tur.S . Srinivasan. A complete analysis of organelle DNA will probably give more information on the nature of ploidy variants in coffee and give insight to their evolutionary and adaptive significance. 1997) amplified the corresponding mtDNA region in all the ploidy variants except the tetraploid plants of Kents. B. Plant Physiol. 1995. polyploidy may be advantageous or disadvantageous depending on their effects. USSR 84-90. Kamennaya step. arabica Current Science. This is probably because of the perennial nature of the plant and enormous time that usually takes to release a coffee variety. Santaram. However haploids in coffee are important as they can be exploited to obtain the homozygous plants for both breeding and molecular studies. 1957. 71: 20-29. M. Science. C. 108: 958–966 Demesure. Physiol.P.109-112.H. N. 1982. Hiscox. Colowick.. M. 1996. F.. R. 1980.F. Vol. Mishra. J. Indian Journal of Forestry.. J. Prakash..Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Couturon.W. Hart. M. J. Columbia University Press. Sodzi.. Thompson. 1997. Pemonge. Jyothi. M. Leverenz.T. N..C. Polyploidy and chlorophyll content in Coffea L. Mol Ecol..P. S. Can. Journal of Coffee Research. Dane. Hedge. In isozymes Current topics in Biological research.. An enlarged set of consensus primers for the study of organelle DNA in plants. M. Theor and Appl Genetics. Chlorophyll content and the light curve of shade adapted conifer needles.. Lang. J. Dumolin. F. 1981. D.D. Mishra.S.1979.. Singh. M. Pollen size as related to polyploidy and speciation in Andropogon saccharoides A barbinodis complex. G. Plant speciation. C.. Stomatal characteristics at different ploidy levels in Coffea L.E .. Relationship of stomatal length and frequency to ploidy level in Coffea L. Bot. Gould. 9: 71-75. Plant. Mol.F. Stein. B. N. N.) Liss. Andal. W. 80: 689-692.D) Academic press New york 3468. Ecol.. Stomatal size in fossil plants: evidence for polyploidy in majority of angiosperms. Mishra.K.K.K.S. 1948. 1997.S. Comparative analysis of chloroplast DNA variability in wild and cultivated Citrullus species. M. Naidu. New York. D.. Johanson. 1995. 6: 393-397.K. Obtention d’ haploids spontanea de Coffea canephora Pierre par utilisation du greffage d embrynos Café Cacao The (Paris) 30: 155-160. P and Kaplan. M. 1940. R. M. S.. M..S. Israelstam. 1994. 1962.Prakash.: Methods in Enzymology (Eds. E. Plant Microtechnique.. Annals of Botany. Stomatal 200 chloroplast number in diploids and polyploids of Gossypium.A. 1991. 21: 32-41. Carbohydrate Chemistry 17 (Eds Whistler.S.57: 13321334. S. Bakhtiyarova.S. R. Srinivasan. . (1998) Comparative leaf flavonoid profiles of natural and induced purpurascens mutants of Coffea arabica .E. Proc. L. M.S. G. Rattazi et al(eds.. 264: 421-424. Plant Enzymology and Histo Enzymology Kalyani Publishers.... V. Krishnaswamy. 19(3): 241-243. B. Sreenivasan. Brittonia. P. Rapid isolation of high molecular weight plant . Genetics and evolution of multilocus isozymes in hexaploid wheat. R.10: 365-380.K. New York. N. Sreenivasan.N) Academic Press New York. 1978. Ram. Journal of Plantation Crops 127-132. 4: 129-131. R. 2004.S. Padmajyothi. Plant Science. Moore. 2nd edition.P.1993. A method for the extraction of chlorophyll from leaf tissue without maceration. and Be Miller. N. 1987. Masterson. J. R. M.. Mishra. Padmajyothi.S. Prakash. Sreenivasan. Indian Academy of Science 87B . Leaf flavanoid profiles in different cytotypes of Coffea arabica L .W. New Delhi p 286. Grant. McGraw-Hill. A.. J. 1983. Petit. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. D. Petit. Malick. Prakash. Murray. W.. 1980. D. Journal of Plantation Crops 21 ( supplement): 258-263. Mishra. Hofreiter. J. New York. R. . Seshavataram. Cultivar “ Kents”. Patel.S. M. Bouvet. Sreenivasan. Prakash.05 Triploid 75. Plant Mol Biol. Coffee Res. M. L.35 75.. M. Sybenga.S. No 1 2. Nelson.W. Euphytica.. Chem. J. 4. Mishra. Nucleic Acids Res.43 33. Frequency of polyploids in Coffea arabica Proceedings of PLACROSYM IV on Genetics. S. M. 1991. Ploidy level.65 69. Gielly. 1993. V. Mishra.14 12. Journal of Coffee Research. 11: 7-13. D.51 20.K. 1965 The length of stomata as an indicator for polyploids in Rye grasses. N. Suryakumari. Evaluation of some indirect ploidy indicators in Coffea L Cafe Cacao The Vol XXXVI No. 1991. Dijkstra. Walters.. 24: 123-124.. 1944. M. 1992. Leaf anatomical features of some interspecific hybrids and polyploids in the genus Arachis L.75 19. J..29 201 Sl..56 21. East African Agricultural and Forestry Journal. J.65 20.K. N. Loss of duplicate gene expression in tetraploid chenopodium.K.. J.Z..27 Octoploid 58.90 62. H. 8: 4321-4325.R. Indian Coffee..30 35. 153: 375-380.. 5 6 7 Variety Arabica Arabica Arabica Arabica Arabica Robusta Robusta .10mm 2 Dihaploid 28. Ramachandran.30 36..24 9.84 39. S. Barber. Saraswathi. A Photometric adaptation of the Somogyie method for determination of Glucose.S. Speckman..58 23.16 19.D. M. Occurrence of a haploid in Coffea arabica L. P. pollen grain and stomatal features at different ploidy levels Mean Stomatal Pollen guard Stomatal no.33 33. 1960. T.45 29. 21: 119-126.32 9. Prakash. Froechner.. M. G. Plant Mol Biol. 14: 225-230. A note on seasonal variation in starch content of different parts of arabica coffee. M. D. Post. Ram. Sreenivasan. Mean grain Ploidy level Leaf plastid stomata epidermal cell areacm2 diameter 2 cells length number 0. R. Mishra. 2000. Wilson. 23-28. Kasargod. 23: 75-83. Leaf area. J.10mm ìm ìm 0.45 20. 36:1-6 Prakash. 1970.Biol.S. 1989. 6:75-84. Murthy. 1982.S.J.33 Diploid 166.78 25. G.S.00 33. K.81 15. Oil seeds Res. Taberlet. J.S.. and Sreenivasan...13 17.75 Tetraploid 239. N. Sundar.24 27. 3. P.50 82. Bibliograhica Genetica ( Wageningen).C.19: 217 – 316. 17: 1105-1110. Ecol.its influence on leaf anatomical features of Coffea L. 1983.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era DNA .S. Vishveshwara.46 21.90 50. 1960. Pautou. Flavanoid profiles in diploid and tetraploid cytotypes of Coffea canephora Pierre ex. A. 42: 225-249. Biochem.47 15.20 Tetraploid 57..05 32. J. Genetics and cytology of coffee. Sreenivasan.40 17. Padmajyothi.88 10.64 8. Indian society for Plantation crops. U..15 26. Table1. Universal primers for amplification of three non coding regions of chloroplast DNA. Wendel.R. N. A literature review. H. Syst.55 28.00 26. Plant Breeding and Horticulture.3 199-205.96 Hexaploid 87. Genome evolution in polyploids. 94 11.52 0.of No.36 9.38 7.45 259.35 19.91 8.07 396.59 13.57 0.36 33.23 1 1 1 1 1 1 9. arabica) Triploid(interspecific) Tetraploid(C.30 Tetraploid colchicine 0.64 139.18 116.54 0.82 290.13 31.46 220.40 418.36 3 1 Dihaploid X Plant Breeding in Post Genomics Era 2 3 4 5 X 0.40 11.00 19.22 55. arabica) Hexaploid Octoploid Diploid (C.82 22.95 21.33 7. of of diameter of diameter of Thickness spongy spongy cell palisade epidermis epidermis of palisade spongy cells of palisade tissue layers layers upper cells lower 19.32 36.15 10.58 Triploid Tetraploid Hexaploid Octoploid 0.69 23.70 16.83 172.93 257.53 10.87 X 0.Table 2.canephora) Tetraploid (C.Index of flavanoid similarity for pair-wise comparison of ploidy level of Coffea arabica Table 3b.75 0.46 17.88 37.35 7.63 195.48 49. Anatomical characteristics of ploidy variants Second National Plant Breeding Congress 2006 Ploidy level Lamina thickness Thickness Thickness Average Average Thickness of No.52 13.07 9.38 9.29 375.23 16.66 0.23 28.36 2 X 0.70 75.60 241.35 202 Dihaploid(C.68 2 11. Index of flavanoid similarity for pair-wise comparison of ploidy level of Coffea canephora 1 1 2 3 X 0.04 16.30 11.13 18. anephora) Table 3 a .14 146.96 281.50 X 2 3 4 5 1 Diploid X Tetraploid natural 0.80 25.50 36.60 20.92 62.66 0.98 33.31 29.72 X .70 15. 0332 0.033 0.28 8.65 1.39 5.74 6 C.56 0. No Variety Ploidy Total Starch % Total Phenols Total free chl a Chl b Chl a/ Total chl Total chl Reducing Non 2 mg/g Chl b amino % carbohy mg/g mg/cm sugar % Reducing sugar mg/g acids % sugar % % drate % 0.74 1. arabica Triploid 0.52 1.28 6.52 1.975 6.026 0.05 1.40 0.035 1.08 7 C.70 1.arabica Dihaploid 1.62 1.98 203 3 C.54 1.028 1.49 0.81 9.62 0.76 0.78 0.56 0.76 0.10 2 C.41 1.66 0.085 0.004 0.200 0.56 1.70 0.76 13.29 8.79 8.18 0.43 0. arabica Tetraploid 1.042 1.69 0.72 1.033 2.52 0.975 Plant Breeding in Post Genomics Era .49 0.59 0.58 1.37 1.84 7.16 1. canephora Diploid 1. arabica Octoploid 0.18 9.75 1.52 0. arabica Hexaploid 0.77 11.93 5 C.33 8.040 0.180 Second National Plant Breeding Congress 2006 1 C.74 1.Table 4.83 1.84 7.85 1.87 1.68 1.86 1.04 12.65 11.56 1.39 9.38 9.53 0.32 9. canephora Tetraploid 0.05 1.08 4 C.91 8.12 5. Biochemical characteristics at different ploidy levels of coffee Sl.025 1.87 2.18 10. 1H. 1B.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era D E F G H I J K Fig.S of octoploid leaf lamina Fig. 1A – 1K C. 1J. 1D. Tetraploid leaf venation pattern Fig. Dihaploid leaf venation pattern Fig.Plastids in stomatal guard cells of hexaploid 204 . 1K. arabica Fig. T.S. of tetraploid leaf blade Fig. of octoploid leaf blade Fig. 1G.S of tetraploid leaf lamina Fig. T. of dihaploid leaf blade Fig. 1C. T.S of dihaploid leaf lamina Fig. Octoploid leaf venation pattern Fig. T. 1A. T.S. 1F. Plastids in stomatal guard cells of tetraploid Fig. 1I.S. T. 1E. DNA ladder 1.2d – Amplification of mitochondrial DNA Lane details M. Triplod ( natural.2) 9. Arabica hexaploid ( c. 274 ( Robusta) Tetraploid 3.2a –2d ( 1-11) Coffee Ploidy variants Fig.2b – Chloroplast DNA amplification of ploidy variants Fig. Kents) 4. Triplod ( Natural. Arabica tetraploid ( c.2c – Restriction digestion pattern of cpDNA with AluI enzyme Fig.v Kents) 5.v.v. Arabica haploid ( c. Arabica tetraploid ( c. Arabica Octoploid 10. Sarchimor) 205 . Arabica hexaploid (c. S.v. Arabica tetraploid ( c.795) 7.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Figure 2 a M 1 2 3 4 5 6 7 8 9 10 11 Figure 2b M 1 2 3 4 5 6 7 8 9 10 11 Figure 2c M 1 2 3 4 M 5 6 7 8 9 10 11 Figure 2d 1 2 3 4 5 6 7 8 9 10 11 M Fig.v. S.274 ( Robusta ) Diploid 2. Sarchimor) 11. 2a – RAPD profile in ploidy variants Fig.795) 6. 1) 8. S.v. between Saccharum officinarum and wild relatives mainly S. high biomass. Despite several attempts. high fibre. mainly Erianthus arundinaceus (Berding and Roach 1987. the genetic base of modern varieties appears to be very narrow and could be the reason for the present slow progress in sugarcane breeding. no conclusive success has been achieved. 1965.S. C1. Many classical cytological studies have been undertaken to provide general information about the cytogenetics of sugarcane and to support breeding programmes (Sreenivasan 1. arundinaceus characters in sugarcane varieties. To broaden this genetic base. Price. borers and good ratooning ability was attempted. Natarajan2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era CYTOLOGICAL STUDIES ON SUGARCANE INTERGENERIC HYBRIDS Babu.Koodalingam1. To broaden this genetic base. mainly the cane forming Erianthus arundinaceus which is known for high tillering. performed early this century.. Modern sugarcane varieties (Saccharum spp.. In order to overcome the problem of sterility. red rot. to introgress E. Cane forming E. The first difficulty appears to be the identification of true hybrids using morphological traits. Thus. U. to introgress E. K. Walker 1987). during the recent past. 2n=100130) are derived from interspecific crosses. The expected chromosome number from the cross IK 76-092 (2n=60) x SES 286 (2n=64) for n+n transmission is 62. during the recent past. Roach and Daniels 1987. use of other genera from the Saccharum complex. arundinaceus) x SES 286 (S. red rot.M. no conclusive success has been achieved. 2n=100-130) are derived from interspecific crosses. arundinaceus characters in sugarcane varieties. spontaneum (2n=40128). 1965). spontaneum in which only a few parental clones were involved resulting in narrow genetic base. spontaneum could be used as bridge species. high fibre. resistance to drought. a complex genus which comprises six species all characterized by a high ploidy level. spontaneum). resistance to drought. R. S. interest has turned to utilize other genera from the Saccharum complex. high biomass. Sugarcane Breeding Institute. Introduction Sugarcane belongs to the genus Saccharum. Shanthi2 and S. The root tips were examined and mean of two observations was taken as the chromosome number.. arundinaceus (2n = 60) is known for high tillering. Two other factors suggested to be responsible for this lack of success are difficulty in getting seed fertility and the lack of recombination between the chromosomes of the two genera. five intergeneric progenies were examined cytologically to confirm their hybridity. In one such cross IK 76-092 (E. Despite several attempts. Coimbatore 206 . The results showed that none of the hybrids had 62 chromosomes for n+n transmission indicating that chromosome elimination could be a common phenomenon in such crosses. between sugarproducing Saccharum officinarum (2n=80) and wild relatives mainly S. Chromosome elimination in these progenies ranged from 4 to 12. Coimbatore 2. borers with multiratooning ability. Centre for Plant Breeding and Genetics. Only a few parental clones were involved in these crosses (Arceneaux. The first difficulty appears to be the identification of true hybrids using morphological traits and other difficulty in getting seed fertility and the lack of recombination between the chromosomes of the two genera. Thangasamy1 ABSTRACT Modern sugarcane varieties (Saccharum spp.Tamil Nadu Agricultural University. 2n=60) and S. officinarum fails to transmit 2n gametes when it is crossed with E. the root tips were stained with basic fuchsine and kept in dark for 1. the root tips were washed and hydrolyzed with 1N HCl at 60°C for 13 minutes. officinarum and S. spontaneum) as male...5 cm in length were collected. 2n=64) observed by cytological methods had the expected 62 chromosomes for n+n transmission. 2002). Materials and Methods Single bud setts of the intergeneric hybrids viz. 013504. Another obstacle is that there is manifestation of sterility in the intergeneric hybrids. spontaneum nobilisation. Sreenivasan et al. S.. the resultant intergeneric progenies (013501. Results and Discussion Out of the five test entries viz. The mean of two observations was taken as the chromosome number and are given in the Table2. The washed root tips were then fixed in 6:3:2 (methanol: chloroform: distilled water) fixative 207 and kept in refrigerator for overnight (Ostergren and Haneen. arundinaceus (Natarajan. 1962). 013502. officinarum and E. spontaneum (SES 286. 2002). Similar results of chromosome elimination have been obtained by Piperidis et al. 1987). IK 76-092 and SES 286 (Kandasamy et al. After twenty days. The root tips were pretreated with a-1 bromonaphthalene and stored in refrigerator at 10°C for 1-1. arundinaceus. 013505 and 013102 root tips from four entries viz.arundinaceus) as female and SES 286 (S.2003.30 hrs.01. The root tips were washed free of HCl in running water and rinsed with distilled water. Although . Sufficient number of roots was not formed from the root eyes of the intergeneric progeny 013102. The actively dividing portion at the root tip get stained with basic fuchsine and that portion was carefully excised with a sharp blade in a clean glass slide and squashed with 1% acetocarmine and examined under microscope. none of the hybrids between E. 013501.. The salient features of the parental clones viz. processed and chromosome number was observed. One hybrid (013505) had chromosome number 58 (Fig. arundinaceus (IK 76-092. arundinaceus (2n=60). The occurrence of 2n gamete transmission in hybrids between S. Finally. To overcome these two difficulties. The procedure for the root tip squash technique was followed as per the method suggested by Jagathesan and Rathnambal. between 4 and 12 chromosomes were eliminated. Then.. 013504 and 013505 were collected. 013502. spontaneum and their first backcross with S. the germinated plants were carefully depotted and the roots were thoroughly washed in fresh running water and the healthy root tips (as indicated by white portion at the tip) of 0. The expected chromosome number from the cross IK 76-092 (2n=60) x SES 286 (2n=64) for n+n transmission is 62. 013504. Towards this objective crosses have been made (Natarajan. attempts have been made to use S. 2000 using GISH technique when S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era et al. 013501.. spontaneum as bridging species between S.30 hrs. officinarum (2n=80) was crossed with E. 013505 and 013102) were subjected to cytological studies to confirm their hybridity.. 2001) are given in the Table 1. 013501. The results showed that. 013504. 013505 and 013102 derived from the cross IK 76-092 (2n=60) x SES 286 (2n=64) were planted four each in mud pots containing pure sand in order to facilitate early growth of roots on 07. But unlike in S. 1983. 1967. officinarum has been demonstrated (Bremer 1922 and 1961). 013502.1) almost equivalent to the expected number 62 and this could be the result of n+n transmission followed by elimination of chromosomes to a lesser degree. The root tips were treated with 1:1 citrate buffer: pectinase mixture and kept in dark for 1 hr. 013502. The root tips were washed free of a-1 bromonaphthalene in running water and rinsed with distilled water. In one such cross between IK 76-092 (E. Berding. 1965. K. Coperscular. A. [English translation in Genetica. V. 1962. 1987. G. pp 321-334.V. 1967. pp 72. B.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era slight inaccuracy in chromosome count (due to the large number and small size of chromosomes) cannot be ruled out completely (Piperidis et al. Amalraj.J. ISSCT. Heriditas.. The Nucleus.. Sugarcane Breed. Indie. 43: 1033-1037. In: Winter school training manual.. P. N.. 1-112. J.J. In Heinz D.. Interspecific hybridization in sugarcane breeding. T. Bremer. Cultivated sugarcane of the world and their botanical derivation. Sugarcane breeding 208 . pp 131. 1987. 10: 159-167.A. 2001. Germplasm collection. Catalogue on Sugarcane Genetic Resources IV Erianthus species. Christopher M. 12: 1021-1026. and Mohan raj.. Madhusudana Rao. ISSCT. Ramana Rao. Karyotype analysis in Saccharum officinarum. G. Roach. Nobilisation – a pivotal procedure in sugarcane breeding. DIT.V. Workshop. Elsevier Press. A review of the origin and improvement of sugarcane. pp.S. Carroll. K. Sreenivasan. Amsterdam. G. spontaneum.J. Ahloowalia. REFERENCES Arceneaux. this probably reflects that chromosome elimination has occurred.J (ed.. T. Manipulating the genetic base of sugarcane. Proc.) Sugarcane improvement through breeding. Natarajan. Cytogenetics. In: Coperscular Int. M. 1987. and Heinz. Catalogue on Sugarcane genetic resources I S. Sao Paulo. and William Jebadhas. Molecular contribution to selection of intergeneric hybrids between sugarcane and the wild species Erianthus arundinaceus. In: Coperscular Int.T. Proc. and Haneen.. D.. maintenance and use. Coperscular. G. a squash technique for chromosome morphology studies. 5: 97-148.K. Rathnambal. D. Price. In: Heinz D. and M. 12: 844-854. Roach BT. 2002.C. 1965. U. 2000. D.V. B. T. pp 143-210. and genetics retrospects and prospects. Sreenivasan. Elsevier Press. Jagathesan. Genome. G. Sao Paulo.S. 2000). T. Ned. Problems in breeding and cytology of sugarcane. Palanichami. S.. Bremer. Walker.V. Sugarcane Breeding Institute (ICAR). Natarajan.. 1961.. Piperidis.J (ed. 1987. B. Sugarcane Breeding Institute (ICAR).) Sugarcane improvement through breeding. pp 42-48. Sreenivasan. 273-326 (1923)]. W. Ostergen. Kandasamy. Euphytica. Sugarcane Breed.C. Workshop... 10: 5978. Amsterdam. 1983. Nils Berding and D’Hont. B. Alexander. 1922. pp 211-253. 33 : 261-269. Daniels.J. pp 54.A. Observed Intergeneric chromosome hybrid number progeny 013501 013502 013504 013505 52 50 54 58 Expected chromosome number for n+n transmission 62 62 62 62 Chromosomes eliminated 1 2 3 4 10 12 8 4 Fig.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1. Results of the chromosome number observed in Intergeneric progenies Sl No. Salient features of Parental clones Parental clones Sl. 1.5 November 0.2 November 100 1 2 3 4 5 6 Table 2. spontaneum) 1951 (Spontaneum Expedition Scheme) 64 135 1.aundinaceus) 1976 (IndonesiaKalimantan) 60 300 1. Chromosome number in the intergeneric progeny 013505 209 . No Particulars Year and source of collection Chromosome number Stalk length (cm) Stalk diameter (cm) Flowering time Pollen fertility (%) IK 76-092 (E.0 SES 286 (S. raimondii [2n=6x=78. Arabia and Hawai (Fryxell et al. 1940. Gorham and Young 1996). Beasley. G and K based on the chromosome pairing relationships (Beasley. D.A. hirsutum var.S. while Gossypium hirsutum and Gossypium barbadense are tetraploids. while the five allotetraploid species are designated with AD genome. hirsutum var. hirsutum var. The F1 triploid plants were intermediate in morphological characters and they were highly pollen sterile as well as ovule sterile. hirsutum var. Morphological and cytogenetic analysis confirmed the true nature of triploid and its hexaploid hybrids. increased pollen grain size. but 10 I + 13 II + 1 III was the most frequent meiotic configuration. (AD1)D5] but 13 I + 7 II + 4 III was the most frequent meiotic configuration. N. T.. boll and seed set with fibres as compared to the F1 sterile triploid plants. (AD1)] AND GOSSYPIUM RAIMONDII [2N = 2X = 26. Raveendran and M. 2(AD1)D5] fertile hybrids between two varieties of cultivated tetraploid species G. Indian Subcontinent. Many interspecific hybrids have been made which provided (i) useful information for understanding species relationship in the genus Centre for Plant Breeding and Genetics. but 25 I + 19 II + 5 III was the most frequent meiotic configuration.. raimondii triploid [2n=3x=39. Coimbatore . In the triploid of G. E. D5] were synthesized by doubling the chromosome number of their respective F1 sterile triploid [2n=3x=39.35 bivalents. Kumar ABSTRACT Two interspecific hexaploid [2n=6x=78. Introduction The cotton genus Gossypium contains about 50 diploid and tetraploid species which are distributed throughout the arid and semiarid regions of Africa.Tamil Nadu Agricultural University. 2(AD1)D5] showed the expected features of the colchiploidised plants such as large sized flowers than triploids. Central and South America. (AD1)] viz. The hexaploids [2n=6x=78. 1989). raimondii [2n = 3x = 39. maximum of 15 bivalents was recorded with an average of 11. The tetraploid species (2n=4x=52) contains two distinct sub genomes which are related to the A genome of the Asiatic cultivated diploid species and the D genome of the American wild diploid species (Geever et al. D5] Saravanan. (AD1)D5] hybrids using aqueous colchicine solution. raimondii hexaploid [2n=6x=78. of which 210 Gossypium herbaceum and Gossypium arboreum are diploids. The morphological and meiotic behavior of these hexaploid hybrids provided valuable information for their practical utilization in a cotton breeding programme. MCU 5 X G.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era CYTOLOGICAL OBSERVATIONS IN COLCHICINE INDUCED HEXAPLOIDS AND THEIR TRIPLOIDS OF CROSS BETWEEN GOSSYPIUM HIRSUTUM [2N = 4X = 52. fertile pollen grains. 2 (AD1)D5]. A maximum of 18 bivalents per PMC was recorded in G. The wild species of Gossypium are rich with rare desirable attributes that are not available in the germplasm of cultivated species. C. The diploid species (2n=2x=26) are divided into eight different cytological groups designated by A. The hexaploid G. raimondii [2n=2x=26. (AD1)D5]. B. The maximum of 25 bivalents with an average of 19. hirsutum [2n=4x=52.68 bivalents per PMC was recorded in G. MCU 7 X G. MCU 5 and MCU 7 and wild diploid species G. 1992). F. 1942. MCU 5 X G. 2 (AD1)D5] recorded maximum of 31 bivalents per PMC with most frequent meiotic configuration of 7 I + 28 II + 5 III. MCU 7 X G. Cultivated types belong to four species. armourianum was transferred to G. Slides were prepared for cytological examination following usual procedures. armourianum to sakel cotton was reported by Knight et al. Materials and Methods The experimental materials used for this study consisted of two Gossypium hirsutum cultivated tetraploid [2n=4x=52. TNAU. The seeds of the F1 triploid hybrids were sown in the poly bags for colchicine treatment. selfing of parents was also carried out and selfed bolls were collected. G. The observations made . profuse branching and tolerance to jassids during both the seasons. Marappan (1960) reported the transfer of fineness from G. Without doubt. MCU 5 X G. The work of transferring bollworm resistance from. G. have their primary objective of the transfer of disease and insect resistance. tomentosum and boll weevil resistance from G. 2004). arboreum. wild diploid species Gossypium raimondii [2n=2x=26. hirsutum. raimondii and their colchicine induced fertile hexaploids [2n=6x=78. (AD 1)] genotypes viz. (AD1)D5] hybrids viz. 2(AD1)D5] viz. hybridization works involving thurberi gave successful results in the transfer of the high lint strength to upland cotton (Guany. Jassid resistance from G. most hybridization programmes utilizing wild species of Gossypium. raimondii [(AD1)D5] and G. their two F1 sterile triploid [2n=3x=39.2 per cent aqueous solution of colchicine were applied to soak the cotton wad to enable the efficient penetration of the chemical into the apical meristem. G. 211 raimondii and G. Doak’s method was followed for hybridization. raimondii and G. hirsutum (MCU 5) x G. MCU 7 X G. raimondii to susceptible and high yielding adapted genotypes. Simultaneously. MCU 5 X G. MCU 5 and MCU 7 (used as female parents). hirsutum var. Besides pest and disease resistance some of the fibre quality traits have also been introgressed from wild species of Gossypium to cultivated cottons. hirsutum (Narayanan et al. these characters were transmitted from the wild parent G. G.. hirsutum cotton varieties to synthesize new breeding lines with in-built resistance to biotic and abiotic stresses coupled with desirable fibre quality traits in addition to desired economic characters. anomalum to the back ground of G.. raimondii [(AD 1 )D 5 ] developed by interspecifc hybridization were found to be characterized by vigorous healthy and rapid growth. raimondii. raimondii to G.. hirsutum var. Muramoto (1969) synthesized hexaploid cottons by crossing G. Two triploids viz. MCU 7 X G. raimondii into cultivated G. hirsutum var. One week after germination when the seedlings attained two leaf stage.hirsutum and G. 1952). Evidently. Black arm resistance has been transferred from G. sturtianum and showed the possibilities of producing spinnable yarn with very high yarn strength.. D5] (used as male parent). (1953) and Thombre and Mehetre (1981).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and (ii) new sources of germplasm to be incorporated into breeding programme. thurberi and G. With this background the present investigation was attempted for introgression of desirable genes from G. Stainability of pollen grains was also studied using 1 per cent acetocarmine. The triploids and hexaploids used for morphological and meiotic behaviour studies were grown in the species garden maintained at the Department of Cotton. hirsutum (MCU 7) x G. hirsutum var. The treatment was given twice a day for five consecutive days.1 and 0.. Results and Discussion The present investigation was carried out to transfer the genes resistant to biotic and abiotic stresses combined with fibre quality characters from the wild diploid species G. raimondii to the triploid hybrids. barbadense and rust resistance from G. arboreum to G. a thin wad of absorbent cotton was spread over the apical meristems of the seedlings and sufficient drops of 0. In texas. ginned and seeds were secured. number of monopodial branches. The morphological expressions like slower growth. filament colour. stem and leaf hairiness of G. hirsutum (MCU 5) x G. increased size of pollen grains. number of anthers per flower. and broader leaves as compared with normal diploid. tallness. increased pollen grain size. raimondii [(AD)1 D5] and G. raimondii. Umbeck and Stewart (1985) also suggested that the doubling of interspecific hybrids is necessary to restore pollen fertility and it enabled to continue back crossing with cultigens. flower parts. (2003) also reported that the flower shape. thicker. flower size. slower growth. anomalum were also similar to those obtained in the present hybrids with 2n = 39 chromosomes. fertile pollen grains. flower colour. growth habit. but all involve the synthesis of a sterile intergenomic F1 and 212 doubling chromosome complement to achieve the fertility (Stewart. hirsutum (MCU 7) x G. raimondii [2(AD)1D5] obtained by chromosome doubling of their respective triploids were also intermediate between the tetraploid Gossypium hirsutum and their wild diploid parent G. (1999) also confirmed the doubling of G. some what lobed petal margins. Memon and Ahmed (1970) described similar interspecific triploid hybrid in terms of vigour. of G. The hexaploids G. ruffled. These two triploids were found to be intermediate between both the parents in plant height. size of anther. hirsutum (MCU 7) x G. petal colour. hirsutum and its reciprocal hybrid G. stem and leaf hairiness etc. sturtianum x G. petal spot. sturtianum by increased flower size. raimondii. pollen colour. hirsutum x G. less lobed leaves. anomalum in the triploid hybrid. petal spot. Stephens (1942) reported that doubled tetraploid showing “gigas characters”. petal spot and hairiness and reported that these characters were being transmited from G. flower size. A number of strategies have been proposed for overcoming the ploidy barrier. the bract shape of G. The leaf shape. The same author further reported that such differences at diploid and triploid levels might be due to the presence of two Ah Dh chromosome complements carrying genes or modifier complex or both inhibiting the expression of the characters of the diploid parent G. Mehetre et al. raimondii were dominant as the F1 triploid hybrids and their hexaploids exhibited these characters. hirsutum indicating the dominance nature of these characters in cultivated upland hirsutums and recessive in wild relatives. raimondii [(AD)1 D5] were polyploidised using colchicine. Brubaker et al. 1995). more regular shedding of pollen and often by more irregular. hirsutum was dominant while leaf shape. Brown and Menzel (1952) also observed that amphidiploids were distinguished from their corresponding F1 hybrids by larger. flower shape. The triploids did not produce fertile pollen grains obviously due to chromosomal differences. and length of pistil and bracterial teeth number which concur with G. anomalum. hirsutum and G. Mehetre and Thombre (1982) reported that in F1 triploid. Thus polyploidy has been used as the main tool to overcome the sterility of interspecific hybrids. stunted growth. However the hybrids had flower shape and petal colour of G. hirsutum x G.. raimondii [2(AD) 1D 5] and G. larger anther. large sized flowers. In the present study also two triploid plants G.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era by Deodikar (1949) involving G. abnormal branching. petal spot and gossypol glands of G. hirsutum (MCU 5) x G. Similar observations have also been made by Harland (1940) and Amin (1941). raimondii were dominant in the F1 triploid hybrids of G. larger and broader bracteole. boll and seed set as compared to normal F1 triploids suggested that the chromosome complements of these colchicine treated plants were successfully doubled. raimondii and conformed to the findings of Brown and Menzel (1952) who . anomalum were dominant. coarser and fleshier vegetative parts. 86 III + 1. (2003). low frequency of trivalents.31 III + 0.32 III at metaphase I of F1 hybrid involving G. in the hexaploids [2 (AD)1 D2].13 & 14). which controls regular pairing behaviour in Gossypium. A2 (arboreum). The hexaploids G.68 II + 3.73 III + 0. hirsutum (MCU 5) x G. The chromosome association observed in these hybrids did not markedly differ from earlier report (Barducci and Madoo. The formation of trivalents and higher chromosome associations in triploids and hexaploids indicate the pairing affinities between the genome involved. a thorough knowledge about the chromosomal behaviour in hybrids is essential as it forms the basic information over which the breeding programme is formulated.23 IV + 0. quadrivalents and pentavalents besides univalents and bivalents were observed.13 II + 1. In these two hexaploids. G. Cytological study helps in establishing desired forms in a more precise way within a shorter span of time. In the development of intergenomic hybrids for resistance. raimondii.04 VI and 1. normal orientation.97 II + 2. hirsutum CMS x G. raimondii (Plate I-Fig. Mehetre et al.55 I + 19. Brown and Menzel (1952) concluded that the triploid hybrids.02 V + 0. raimondii [2(AD) 1D5] showed a mean association of 24.55 III + 1. hirsutum (MCU 7) x G.18 III + 5. Influence of the wild genome on individual plant parts varies markedly from species to species. G. from which the hexaploids are derived. raimondii [2(AD) 1 D 5 ] showed a mean association of 4. A high frequency of trivalents (2. raimondii [2 (AD)1 D5] normal boll formation was observed occassionally with well developed seeds (Plate I-Fig. (2002) observed on an average of 12. the hexaploids. hirsutum (MCU 5) x G.31) and as high as 4 trivalents in majority of PMC’s (18. G.25 II + 0.73 IV (Table 2) indicating diverse genetic constitution of parents. The cytological analysis in the F1 hybrids. hirsutum (MCU 7) x G.50 I + 9. hirsutum (MCU 7) x G. is the differences in the degree of chromosome . hirsutum and the wild diploid parent.81 II + 1. sturtianum. B1 (anomalum) and D1 (thurberi) hexaploids are also rather highly self-fertile. raimondii [(AD) 1 D5] showed the mean pairing association of 11.91 II + 4. In the present study.32 I + 32. hirsutum (MCU 5) x G.96 III respectively (Table 1).26 I + 25.17 & 20). indicate partial homology of D 5 chromosomes with A and D chromosomes of cultivated tetraploids. but both the diploid and the hirsutum components are clearly discernible in all. raimondii [(AD)1 D5] and G. The A1 (herbaceum). The fibres produced on the hexaploid seeds are light brown in colour.50 I + 11. Beasley (1940) also reported similar results. while in the D5 (raimondii) hexaploids boll set was occasional (Brown.75 %) observed.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era reported that in general.05 I + 26. Similar results were also noticed by Mehetre et al. harknessii and [2 (AD)1 C1]. are almost completely sterile while all the hexaploids. like F1 triploid hybrids. Endrizzi (1962) reported that the main force.75 IV + 0. hirsutum x G.35 II + 0. Iyengar (1944) and Brown (1951) also recorded similar results of mean association 2. 1940). The E1 (Stocksii) hexaploids are most prolific and readily set many selfed bolls with a high number of seeds. are intermediate between G. G.19 IV respectively. The bolls produced in the two hexaploids involving D5 genome were smaller in size than the hirsutum but larger than the diploid raimondii. in diploid and tetraploid 213 species. hirsutum x G. shorter in length and less dense than the fibres on seeds of the upland cotton probably due to dominant influence of G. are more or less fertile.78 I 11. 1951). association and disjunction of chromosomes were observed while in triploids and hexaploids. the degree of fertility being different with the varying diploid species involved. raimondii [2(AD1)D5] and G.32 V (Table 2). But the other hexaploid G.16 IV and 13. As expected. Cytological analysis of the hybrids revealed that they were true interspecific crosses. raimondii AD) 1 D5 G. it is worthwhile to go in for backcrossing of the hexaploids with respective cultivated tetraploids repeatedly and observe for the cross over segments carrying resistant genes for jassid resistance so that high yielding resistant genotypes can be achieved in due course.35 III 1 2 2 3 1 1 1 25 0. chromosome pairing indicated a close homology of G. Hence success in transfer of characters in such interspecific crosses has been limited because of the sterile nature of their F1s though the allohexaploids of these triploids were fairly fertile.96 IV - Table 1. Chromosome association in triploid hybrids: G. Thus. The successful utilization of wild species in breeding programme is often restricted by the operation of either prefertilization or post fertilization barriers during wide hybridization. Hence. raimondii FreqFreqI II III IV uency uency of PMC of PMC 1 16 10 1 4 2 6 12 3 1 4 13 8 2 1 2 3 10 13 1 5 1 18 9 1 2 2 8 8 5 1 3 14 11 1 3 5 13 10 2 5 2 10 10 3 3 1 13 8 2 1 2 3 18 6 13 7 4 Total 368 319 74 5 26 32 Mean 11. The univalents observed in this study can be attributed to asynapsis because of lack of homology between the different sets of chromosomes or to the failure of the chromosomes to remain associated (desynapsis).16 Associ ation 214 .31 0. In the present study.5 9. hirsutum (MCU 7) x G. Homeologous chromosome of differently sized Gossypium genomes rarely pair. Observations of meiotic metaphase chromosomes indicated the degree of relatedness between species. G. development of stabilized lines from such an interspecific gene transfer has been a long-term programme with comparatively low probability of success.97 2.50 II 10 8 11 12 8 12 15 13 9 295 11. those species with D genome can be used successfully in gene transfer if fertilization barriers are overcome by novel techniques. hirsutum (MCU 5) x G. raimondii (D5) with D subgenome of the G. greater homology observed between A and D genomes aid in production of desirable recombinants despite minor cytological disturbances as there are successful boll setting and viable seed production in hexaploids. hirsutum. Nevertheless. raimondii I 16 17 11 15 14 14 9 10 18 351 13.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era condensation. hirsutum x G. 1962.A. 5: 1-14. The production of polyploids in Gossypium sp. Chromosome association in hexaploid hybrids: G. Sci. R. Syst. Theor. 1989. Fryxell. Grace.19: 389-399. (G. 1940. J.55 1.S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 2. Evolution. haploids and induced polyploids of Gossypium. Brown. DNA hybridization analysis of a Gossypium allotetraploid and two closely related diploid species. C. M. 5: 25-41.B.73 Associ ation REFERENCES Amin.F.S. raimondii 2(AD) 1 D5 G. hirsutum (MCU 7) x G. 77: 553-559. anomalum with cultivated cotton. Indian Central Cotton Committee.H. Cytogenetic studies on cross of G. species hybrids.E. Endrizzi. Indian J. Endrizzi.. 108: 199-213. Geever. 31: 39-48. 1952.68 3. J. 1999. A. Cytology of hexaploids.D.M. Production 215 of fertile hybrid germplasm with diploid Australian Gossypium species for cotton improvement. Evolution. P.23 0.R. hirsutum x G. Brown. L. C. . Meiotic chromosome behavior in species. M. 17: 91-114. Genetics and Plant Breeding. Brown. and M. 1942. hirsutum (MCU 5) x G. Menzel. Hered. Bot. raimondii FreqFreqII III IV V I II III IV V uency uency I of PMC of PMC 1 3 17 7 5 3 34 12 4 2 5 7 28 5 5 25 19 5 3 5 24 4 2 1 1 21 22 3 1 2 3 31 3 1 2 18 20 4 2 1 2 27 3 2 1 2 17 24 3 1 4 2 27 6 1 1 22 25 2 1 4 23 4 4 4 25 22 3 3 4 27 5 1 3 24 19 4 1 2 2 31 2 2 1 28 22 2 Total 89 592 100 27 7 23 540 433 82 16 Mean 4. 1992.Y. anomalum) doubled x G. O. Interspecific hybridization and colchicine induced polyploidy in cotton.32 24. Brubaker. G. The spontaneous occurrence of amphiploidy in species hybrids of Gossypium. A revision of Gossypium sect. The diploid like cytological behaviour of tetraploid cotton. Euphytica. Agric. F. Deodikar. Beasley. Kilby and J. K. 1941.H. M. Grandicalyx (Malvaceae). pentaploids and hexaploid combinations.91 4. Genetics.. including the descriptions of six new species.55 19. 27: 25-56.E. Genetics. hirsutum x G. 1949. Craven and J McD.J. Katlermand and J. hirsutum. 37: 242263. I. Polygenomic hybrids in Gossypium. I.05 26.O.P. Stewert. raimondii G.L. J.A. Genet. Beasley. Appl. 1951.. J. 16: 325-329. Stewart. Stewart. S. 39 –52. Euany. H. 2004. Indian J. R. anomalum. In: recent advances in cotton research and development in India-Lead Papers presented at the National Symposium on “Changing world order – Cotton research.L. February 14-17. M. 1995. 1953. and G. Stephens. Forrester. M4 x G. Harland. 14: 253-265. Australia. 1996.S. In hybrid between G.S. New polyploids in cotton by the use of colchicines. S.W. 13-15 march..S. Knight. Colchicine produced polyploids in Gossypium. Stewart. D. Crop Sci. Tropical Plants. anomalum. 171-181. S. 9: 2729. Gr. Cyotmorphology of haploid Gossypium hirsutum x G. Impressions of American Cotton Research. Cytomorphology of interspecific hybrids between Gossypium hirsutum L.. Brishbane. Indian J. 1970. 2004. 2003.V. 1940. Melborune. L. Agric. its haploid and Gossypium raimondii.V. Young. Montpellier Guany. Genet. Tod.Crop Sci. Memon. Ranga Agricultural University. pp.S. Gawande. Waw. 3-24. AhAh) x G. Substitution of cotton cytoplasms from wild diploid species of cotton. Mehetre. 1952. 1985. 44: 272-295. Constable and N. Genet.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Gorham. P. S.M. and S.Montpellier. 1942. P.C. development and policy in context. E. Punit Mohan and Vinita Gotmare. Pak. pp. R. J. Wild relatives of cotton and rice as sources of stress resistance traits. and J. Thombre.L.M. Cytologia.C. 1960. hirsutum.M. 63 (4): 319 – 324. 216 . Muramoto. Thombre. I. Rev. CIRAD. XXIX. August 10-12. Emp. S.V.10-16. Marappan.V.. Australia. Singh. 46(1/2): 291-299. Potential for crop improvement with exotic germplasm and genetic engineering. Acharya N. 17: 53-54. thurberi. and M. Cott. 1981. A. V.A. S. Et. 42: 144-149. Mehetre. interspecific hybridization in Gossypium. Shinde. 313-327. haploid (2n=2x=26. In: Challenging the future.L.G.G. J. Trop.Ahmed.C. cytological and fertility studies in interspecific hybrid G. Park and R. Var. Cott. Meet. 25: 1015-1019. V. Hyderabad. R.. and M. (2n=2x=26. and E. Genet. G. (eds. Germplasm and its utilization in cotton improvement retrospect and prospects.) Proceedings of the world cotton research conference-1. Progress report from experimental stations (1951-52). Mehetre. Narayanan.O.C. Umbeck. 1982. Morphological. G. Proc. Cotton improvement through interspecific hybridization: Behaviour of arboreum – anomalum back crossing. Hexaploid cotton: Some plant and fiber properties.C. II. 1996. Aher. A. Peyr. An autotetraploid Asiatic cotton and certain of its hybrids with wild diploid species. L.F. Dissertation submitted to the University of Madras as part fulfillment for the award of Master’s degree.S. 2D1D1). 1969. hirsutum L. J. M. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 217 . Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 218 . evolutionarily advanced trinucleate pollen grains have fully developed mitochondria at dehiscence. The present investigation was undertaken to estimate the requirement of the preconditioning period and to evaluate extent of pollen tube attrition after selfing and crossing and to ascertain the role of stigma and style in restricting or preventing the pollen tube to reach the ovary in incompatible species. With regard to pollen tube growth under in vivo. the competition among the male gametophytes (pollen competition) and the other. and T. This suggests that genetic interaction may play a major role in the regulation of pollen tube attrition. Gunasekaran. consisting in female mate choice that could interact with the male – male competition. In most plant species the number of pollen grains deposited on the stigma greatly exceeds the number of ovules available for fertilization (Plitmann. The rate of pollen tube attrition is more or less the same along the selfed pistils of different ploidy levels as well as the pistils of tetraploid and diploid crosses. gossypioides did not require pre. it is not clear to what extent pollen-pistil interaction may play a role in determining the success of fertilization in distant hybridization particularly. M.conditioning for good germination where as other species required 15 to 45 minutes of pre-conditioning to attain more than 90 per cent of pollen germination. allowing for a rapid germination when it contacts with the stigma (Hoekstra. These are further assembled during a lag phase prior to emergence of the pollen tube. Hence pollen of such species show low germinability and the maximum could be obtained only when it was Tamil Nadu Agricultural University. Coimbatore – 3 pre-conditioned in a humid atmosphere. In contrast. (Hormaza and Herrero. The greater percentage of pollen tube number reduction in diploid and tetraploid crosses due to the presence of inhibitory substances besides physical and physiological barrier was observed. the post pollination success is based on two mechanisms. 1994). many binucleate pollen species like Gossypium have far less developed mitochondria. trilobum and G. inter sexual mechanism. 1994).S. In general. 1979). This kind of studies have been extensively made in self incompatible species (Lewis. 1993) and consequently numerous male gametophytes are lost inside the pistil during the process that extends from pollination to fertilization.Raveendran ABSTRACT The effect of pre-conditioning of pollen grain in in vitro and pollen tube dynamics following selfing as well as cross pollination under in vivo of seven diploid wild species and two cultivated tetraploids of the genus Gossypium was studied. hybridization among the species of different ploidy levels.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era STUDIES ON THE EFFECT OF PRE – CONDITIONING OF POLLEN AND DYNAMICS OF POLLEN TUBE GROWTH IN GOSSYPIUM SPP. showing prolonged germination. Pollen grains of G. However. the dramatic reduction in the number of pollen tubes occurs as they grow along the style both in selfing and crossing and the percentage on number of pollen tubes grow on the style and entry into the ovary was found to be independent of the initial pollen load during selfing. These two mechanisms have been intensively studied in numerous animal species but only recently have their implications in plants started to be considered. The arrest of pollen tube growth in stylar regions of the majority of diploid and tetraploid crosses suggested that stylar pollination could not be an effective method to overcome the prefertilization barriers in cotton. 219 . Introduction In plants. The materials were replicated three times with five slides per replication.barbadense when their pollens were placed in the medium for 45 minutes after anther dehiscence.hirsutum (Variety MCU 5 and MCU 9) and G. Results and Discussion In vitro pollen germination studies Among the seven wild and two cultivated species studied. The stained pistils were placed on a glass slide 220 containing a drop of glycerol and covered with 23 x 30 mm coverslip and gently pressed. G. illuminated with 200w high pressure ultraviolet lamp.trilobum recorded more than 90 per cent germination in artificial medium and indicated that these two species are evolutionarily advanced and pollen grains of these binucleate type equiped with fully developed mitochondria.1 N K3PO4. 30 and 45 minutes of dehiscence.hirsutum var. triphyllum and G. The percentage values were transformed into angles and analysed in Completely Randomised Design (CRD) and transformed means were compared with Duncan’s Multiple Range Test. thurberi. G.armourianum G. the pistils taken out from fixative were washed with distilled water three to four times and then macerated in 10 N NaOH for 10 hours (when diploid was used as female parent).thurberi. G. G. fixed in 6:3:1 (ethanol : chloroform : acetic acid) fixative and stored at 4-10oC for 24 hours.barbosanum and G. G. The data were analysed in CRD to find out the statistical significance. The duration of preconditioning period for each species was assessed by recording the percentage of pollen germination. There were also significant differences between the different duration of pre-conditioning. thurberi.. G. Then they were thoroughly washed in distilled water and stained for four hours to 12 hours in 0. For in vivo studies.10. MCU 5 and MCU 9 required 15 minutes of pre-conditioning to give more than 90 per cent of pollen germination. G. all the species had less than 90 per cent germination. G. gossypioides. Except G.3 per cent aniline blue prepared in 0. The number of pollen tubes on stigmatic surface.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Materials and Methods Seven wild diploid species viz. In vitro pollen grain studies The pre-conditioning period for pollen grains for different species of the genus Gossypium was studied with pollen grains from freshly dehisced anthers and those after 15. barbosanum (2n-26) and two cultivated tetraploid species G.davidsonii. The above pollen grains were dusted on a drop of medium placed on a cavity slide and observed under microscope. G. required active respiration and quick pollen germination (Table1). The pistils were then transferred to 70 per cent ethanol and stored in refrigerator till further use. the freshly dehisced pollens of G. davidsonii and the cultivated G. middle of the stylar region and at the entry of ovary were recorded from 10 pistils per cross combination per replicate and observations were recorded thrice.12 and 24 hours after pollination.armourianum.trilobum.. The pollens of other species viz.trilobum and G. The slides were observed under Nikon – Microphot – Fx microscope with fluorescence attachement. G. G. G.hirsutum had higher pollen germination of more than 90 per cent which . G. The observations were taken with B (380 – 490 nm) and BG (650 nm) excitation filters in combination with BA 520 barrier filters.gosssypioides and G.babadense (variety Suvin) (2n-52) were subjected to investigation.davidsonii.gossypioides. The percentage of pollen germination was more than 90 per cent in the species G.triphyllum. In vivo pollen tube growth studies Self pollinated pistils and cross pollinated pistils of direct and reciprocal combinations of above parents were collected at 2. armourianum. Although many studies in other species have shown (Herrero and Dickinson. The existence of variation in the duration of pre-conditioning in both ploidy levels indicates that ploidy level did not have any influence on the above phenomena. Penetrabily is limited to one pollen tube irrespective of more pollen tubes formed in Triticum durum (Rudramuniappa and Panchaksharappa. This suggested that the selection pressure in Gossypium species appears to occur along the entire style length.barbosanum provided higher percentage only after 45 minutes of preconditioning. However.11 (G. Pimienta et al. diploid x tetraploid and tetraploid x diploid cross combinations is presented in the Tables 2. It is believed that two main forces could determine such a reduction of male gametophyte in the pistil. 1975 and Winsor and Stephenson. The reduction in the number of pollen tubes passed on the stylar and entry of ovary region in diploid x tetraploid and tetraploid x diploid cross combinations was found to be higher than in selfing and suggested that the genetic interactions may play a role in the regulation of the pollen tube attrition. significant differences among the number of pollen tubes on the entry of ovary in different species showed the presence of genetic variability among the species studied. 1995).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era sustained during subsequent treatments also. with the number of pollen tubes reaching the ovary being more or less similar. Stanley and Linkens (1974) also observed that in Petunia freshly shed pollen showed low germinability and pre-conditioning improved the germination. only in few cases the pattern has been studied. This modulation would comprise both physical and physiological constraints and genetics of pollen – pistil interaction as was reported by Hormaza and Herrero (1994). One force could be the differences in competitive ability of the pollen and the other could be a modulation of these differences by the pistil.triphyllum and G. 1974). However.barbadense required minimum period of 30 minutes per-conditioning while the two species G. According to Herrero (1992) the width of the transmitting tissue of the style would be a physiological limitation while physical . MCU 9) per cent of total pollen tubes reached the ovary in self pollinated pistils. In the present study. In vivo pollen tube growth studies The number of pollen tubes at stigmatic. gradual reduction in the number of pollen tubes occur along the style and only 6. the present reduction in the number of pollen tubes was independent of the initial load during selfing. The results showed dramatic reduction in the number of pollen tubes as they grew along the style both in selfing as well as crossing in Gossypium species and this phenomenon appears to be consistent upon selfing. The present study reveals the existence of species variation for the pre-conditioning in the genus Gossypium. It also indicated that the level of phylogenetic advancement of the male gametophyte is characterized by the overall state of metabolic development at dehiscence rather than by the number of generative cells or ploidy level of the pollen. stylar and at the entry of ovary in selfing of parents. According to Bar-Shalom and Mattsson (1977) the pollen from plants of wet stigma type is often found to germinate readily in liquid media with appropriate osmotic balance. The main bottleneck seems to be the upper portion of the style in Brassica oleracea and Cucurbita pepo (Ockendon and Gates. 3 & 4 respectively. 1983. Different number of pollen tubes grew in the style depending on the initial number of pollen 221 grains deposited. In contrast. Herrero 1992) reduction in the number of pollen tubes growing down the style.thurberi) to 26.9 (G.hirsutum var. 1980. pollen from species possessing dry stigma often requires special condition to establish something near a natural hydration rate. G. 148 : 217-221. Mode of hybridization as an important factor in the germination of trinucleate pollen grains. PP 372 – 400. REFERENCES Bar-Shalom. Herrero.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era limitation include restriction in the nutrient supply. P. Genetic control of incompatibility and reproductive development in flowering plants. Histochemistry of pollen tube growth in vivo in Triticum durum. B. Demographics of pollen tube growth in Cucurbita pepo. Syst. Kester (1983).A.G. Clarke. R. Gametophytic competition and selection. The bionuleate pollen. after an initial period of autotrophic growth. Know and A. Dordrecht. Genetic control of incompatibility and reproductive development in flowering plants. Such greater percentage of reduction in pollen tube number can be attributed to the presence of inhibitory substances besides the physical and physiological barriers. Winsor. Hormaza. (1979). Pimienta. Clarke (eds). grows heterotrophically consuming large amount of nutrients required to produce cell wall from stylar tissues. Pollen tube growth following compatible and incompatible interspecific pollinations in Petunia hybrida.F. From pollination to fertilization in fruit trees. Evol. Rudramuniyappa. Ann. Pp 88-107.K.G. Kluwer. New Phytol.. (1975). (1977)..A. Growth of cross and self pollen tubes in the style of Brassica oleracea.G. and Panchaksharappa.. A. D. Springer – Verlag. 73 : 583 : 589.I. Desf. and Stephenson. (1994). Herrero. Tiddskv. J. Lewis. C. J. Can. J. Berlin. Plant. Gametophytic – sporophytic incompatibility. (1992). in diploid x tetraploid crosses out of 21 crosses.G. 188 : 6572. (1974). E. Pollen tube growth in cross and self pollinated ‘Nonpareil’ almond. M. Dordrecht. 11 : 27-32. 77 : 254 – 257. Bot. Plitmann. M. Sci...B. 39 : 665-671. as in the case of crop under investigation. U. Knox R. Williams E.E.J. and H. D.J. In the present investigation. Cytologica. M and Dickinson. Polito and D. D.E. Soc. Kluwer. and M. and Gates. In : Williams E.G. Mitochondrial development and activity of binucleate and trinucleate pollen during germination in vitro. Pollen : Biology. 108 : 643 – 647.R. Horti. Linkens (1974). This trophic dependence allows the pistil to influence the pollen tube growth rate and dynamics. and Mattsson. V. A. Biochemistry and Management. (1993). pollen tube reached the entry of ovary only in nine crosses. H. I.). but also on the genetic interactions among the male gemetophytes and between the male gemetophytes and female tissues and appears this type of interactions are probably super imposed. 222 Hoekstra.G. Ockendon. J. Pollen tube attrition as related to breeding systems in Brassicaceae. . O. Stanley. Bot. (eds. It is also observed from the present study that the fertilization does not depend uniquely on passive physical or physiological constraints by the pistil. F. 75 : 155 – 160. (1980). Planta.S. (1995).E. (1994). Herrero. 145 : 25-26. Plant Growth Regul. Percentage values are in parentheses Table 2.4) 47(18.0) 57. of pollen tubes Middle of the style Range Mean 133-172 106-159 127-175 127-173 138-170 116-192 102-157 135-182 123-177 175-212 7. barbosanum G.09) 80.10 ab(95. davidsonii G.79 73.52 b(96.50 ab(96.3) 160(60.00 b(95.64 ab(97.7) 79.788 2.64 a(97.5) 69(26.3) 110(51.54 b(95.3) 80. barbadense var.31) 58. hirsutum var.66 e(51.3) 0.16 231(100) 213(100) 240(100) 237(100) 254(100) 231(100) 235(100) 278(100) 265(100) 310(100) Entry into ovary Range Mean 37-64 40-52 50-55 41-61 32-55 46.61) 45. Pre-conditioning of pollen grain of parents Species G.899 2.7) 80.50 abc(96.87 b(87. hirsutum var.3) 56.98 24.82 56.) 81.88 160(69.64 a(97.71) 68. hirsutum var.4) 198(63.94 28. armourianum G.7) 77.0) 78.5) 46(19. armourianum G.64 ab(97.60 e(86.09(83.7) 68.8) 223 .0) 80. gossypioides G.49 e(85.5) 140(59.54 cd(95. gossypioides G.00 b(95.34 c(92. trilobum G.22e(53.12 a(97.3) 74.55 55.3) 77.65 42.1) 46(19.25 a(97.829 2.6) 158(65.04 a-d(96.0) 80.27 ab(97.1) 179(64.7) 78. barbosanum G.3) 79. after dehiscence of anther 15 30 45 Freshly shed pollen 68. Number and percentage (in brackets) of pollen tubes at stigmatic and stylar regions and entry into ovary in parents upon selfing No.95 5.62 b(86.97 c(82. triphyllum G.95) 81.7) 78.12 ab(97.7) 78.6) 68(24.42 c(71.14 16.33 a(96. trilobum G.8) 139(59. davidsonii G.11 ab(97.15) 47.617 In a column. MCU 5 G.7) 67.56) 69. MCU 9 G.9) Parents G.3) 82.91 ab(97.7) 79.05 a(98.3) 68.887 2.06 bcd(95.696 78.06 bcd(95.3) 53(22.17 c(69.12 ab(97. MCU 5 G.0) 80.7) 80.324 78.1) 80(25.447 77.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1.98 b(96.19 16(6. Suvin SE CD (%) Stigmatic region Range Mean 197-247 206-216 198-258 219-278 229-265 180-250 212-247 190-290 202-271 296-318 8.0) 80. hirsutum var. armourianum G.71) 64.54 b(95.88) 0. means followed by common letters are not significantly different at the 5% level by DMRT. Suvin SE CD (5%) Pollen germination (%) min.4) 129(55.3) 80.0) 78. barbadense var.62d(72.0) 0.1) 151(59.3) 0.5) 52(22.9) 45(21. triphyllum G.15b(87.62 b(86.87) 66.3) 80. MCU 9 G. thurberi G. 82 52-94 82-152 19-62 31-78 66-96 32-91 8.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 3.9) 27 (45. G. G.7) 50(27.9) 7-19 11(7.70 232(100) 128(100) 53(100) 183(100) 215(100) 22(100) 20(100) 209(100) 142(100) 92(100) 180(100) 191(100) 16(100) 39(100) 29(100) 178(100) 112(100) 40(100) 55(100) 37(100) - 77-125 15-43 25. G. 224 . Number and percentage (in brackets) of pollen tube at stigmatic and stylar and entry of ovary in diploid x tetraploid crosses No. thurberi x MCU 5 armourianum x MCU 5 davidsonii x MCU 5 gossypioides x MCU 5 trilobum x MCU 5 triphyllum x MCU 5 barbosanum x MCU 5 thurberi x MCU 9 212-250 100-147 42-68 152-206 190-226 10-63 15-50 190-227 115-163 77-115 165-221 181-210 12-51 34-50 22-43 160-231 86-132 29-73 18-71 20-65 17.barbosanum x Suvin SE CD (%) 90(38.3) 19-25 22(11.44 27.gossypioides x Suvin G. G. thurberi x Suvin G. barbosanum x MCU 9 G.5) 69(38.9) 2. trilobum x Suvin G.96 . gossypioides x MCU 9 G. armourianum x MCU 9 G. G.8) 44(24.0) 19(14.8) 11-21 14(7. armourianum x Suvin G. G.52 G.8) 12-34 21(9. G. triphyllum x MCU 9 G.0) 7-19 11(6.0) 77(35.2) 75(39.8) 15-26 19(8.8) 96 22-35(12. davidsonii x MCU 9 G.triphyllum x Suvin G.9) 41(28.7) 12-17 13(7.07 6. trilobum x MCU 9 G.denotes no pollen tube growth. of pollen tubes Middle of the style Range Mean Parents Stigmatic region Range Mean Entry into ovary Range Mean G. davidsonii x Suvin G.30 50. 0) 22(30. Number and Percentage (in brackets) of pollen tubes at stigmatic and stylar regions and entry of ovary in tetraploid x diploid crosses No.armourianum Suvin x G.4) 46(73.0) 42(24.2) 32(24.5) 21(41.2) 84(65.64 58-69 40-53 42-73 70-95 68-100 19-65 22-46 74-96 26-58 46-71 76-115 73-120 27-39 16-41 13-27 59-90 15-32 12-19 57-95 10-60 25-53 66(52.9) 47(66.4) 26(22. trilobum Suvin x G.3) 8(15.armourianum MCU 9 x G.3) 29(24.4) 21(37.1) 5.4) 29(46.0) 62(57.gossypioides MCU 9 x G.thurberi MCU 9 x G.triphyllum Suvin x G.6) 92(51.5) 32(57.3) 65(55.5) 2.8) 95(54.32 18-26 9-12 35-53 31-45 19-37 15-29 21-40 19-37 14-22 35-50 33-46 8.60 16.2) 83(63.triphyllum MCU 5 x G.2) 65(54. of pollen tubes Parents Stigmatic region Range Mean Middle of the style Range Mean Entry into ovary Range Mean MCU 5 x G.92 14.5) 34(64.9) 17(28.barbosanum SE CD (%) 82-135 62-75 94-141 102-138 152-195 37-72 38-59 98-152 55-69 66-137 165-206 159-200 44-65 37-68 47-65 76-146 40-75 56-62 96-135 19-69 28-70 105(100) 71(100) 120(100) 128(100) 180(100) 65(100) 51(100) 131(100) 63(100) 107(100) 186(100) 175(100) 57(100) 51(100) 52(100) 115(100) 64(100) 60(100) 117(100) 51(100) 56(100) 9.9) 10(8.gossypioides Suvin x G.9) 19(36.90 225 .3) 40(31.triphyllum MCU 9 x G.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 4.0) 15(26.barbosanum MCU 9 x G.22 12-24 7-10 23-44 5-10 10-18 23-35 5-26 12-32 20(19.63 16.0) 39(21. trilobum MCU 9 x G.6) 37(72.thurberi Suvin x G.1) 40(61. trilobum MCU 5 x G.armourianum MCU 5 x G.barbosanum Suvin x G.gossypioides MCU 5 x G.1) 15(14.8) 23(35.davidsonii Suvin x G.2) 31(54.thurberi MCU 5 x G.8) 16(31.5) 78(67.6) 7(10.2) 39(21.7) 27(41.9) 14(23.davidsonii MCU 9 x G.davidsonii MCU 5 x G.9) 89(47.3) 17(33.34 6.3) 29(56. To asses the reasons for the high female sterility in the F1.umbellata cross. sublobata cross. The univalents and quadrivalents were frequently observed. radiata x V. Kumar ABSTRACT Among the twelve interspecific crosses attempted. There was no seed set in back cross with both parents.28) + II (4. Muthiah and M.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era CYTOLOGICALANALYSIS VIGNA RADIATA X V.. All types of abnormalities were observed in the megaspore cells. all types of abnormalities were observed. hainiana. analysis of pollen mother cells (PMCs) was carried out. Tamil Nadu Agricultural University. The reason for no seed set could be attributed to complete pollen sterility. radiata x V. the cytogenetic. Out of 25 PMCs studied at Anaphase 1. sublobata and V. HYBRIDS Pandiyan. radiata var. The occurrence of abnormal megaspore was frequently observed which leads to female sterility.radiata x V. vexillata and V. The triads and tetrads were observed in the all the cross combinations except V. The lowest number was observed in V. radiata var. To asses the reasons for the high pollen sterility in the F1. The hybrid cell megaspore completely degenerated.96) + I (6. radiata x V.. The average chromosome association per cell was IV (1. The sporad count for parents and direct crosses were also studied. radiata x V. Precarious separation of chromosomes and formation of anaphase bridges was commonly observed in many PMCs. seed set was observed in the entire cross combination except V. radiata x V. The highest number of dyads (8 each) was observed both in V. AR. In the sterile interspecific hybrid. M.96).641 003 226 . Coimbatore . hainiana. Subbalakshmi. only one cell revealed 11 bivalents. mungo var silvestris and V. The number of univalents ranged from 0 to 14 while the number of quadrivalents ranged from 0 to 5. the cytogenetic analysis of megaspore cells was carried out. B. UMBELLATA L. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TECHNICAL SESSION IV HYBRID BREEDING IN CROPS . JK Agri Genetics. Genetics in seed cost reduction especially GMS. Self-incompatibility induction through biotech approaches was indicated as alternatives and enable harvesting of crossed bolls from both parents projected. but also accelerated the process of privatization of R&D and seed distribution on a more globally competitive scale.1 ABSTRACT Heterosis has been effectively used in cotton to increase yield through expansion and harmonization in the expression of various yield influencing parameters and fibre quality. S. The use of molecular marker Restriction Fragment Length Polymorphism (RFLP) and coefficients of parentage for identifying heterotic effects in cotton had been beneficial. but still not turned into practical use. SSRs and SNPs considerably facilitated the estimation of genetic diversity. AFLPs. technology for production management for maximizing the genetic potential for yield and fibre quality in transgenic hybrids.S. Extra-long staple cottons are needed with 2. independently and collectively represent the primary factors influencing the success and sustainability of the transgenic hybrid technology.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TRANSGENIC HYBRID COTTON TECHNOLOGY AND SOME GENETIC OBSERVATIONS Narayanan. Development of marker systems such as RFLP. Such study has been helpful in detecting Retired Scientist. Genotype deployment strategy.6 to 4.. In-house germplasm development in private seed industry has gained momentum and is the primary source of parents in successful hybrids rather than acquired germplasm. If the public sector R&Ds can intensify their basic researches in this area. The genetic engineering advances and thereby the incorporation of B. scientific seed production practices for transgenic hybrids and systems for ensuring cost reduction and assured planting quality etc. CICR. by incorporating Bt Cry 1Ac gene (transgenic hybrid). Micronair value of 3. parental purity maintenance techniques. in-house germplasm development strategy for use as parents of hybrids.90 and above strength-length ratio. it would help the Indian seed industry to depend more on local technology and provide service at lower cost to farming community. If heterosis exploitation is one method to rapidly increase the stagnating cotton yields.5% span length of >34 to 38mm. molecular evaluation strategy. Hyderabad 227 . Nagpur & Research Advisor (cotton). gene outsourcing technique. while concurrently broadening the adaptability to larger areas. the hybrid will yield double benefit of yield improvement through heterotic vigour for yield as well as consolidating the yield gains through bollworm control at a reduced cost of production. tensile strength of >28-32 with 0. transgenic-conversion strategy. Parallel development of hirsutum and barbadense germplasm using superior sources in global gene pool and identifying the best combinations for fibre quality and wide adaptation are suggested.t gene (from Bacillus thuringiensis) technology for bollworm control into hybrid technology of cotton have not only enabled to achieve a quantum jump in yield. Private seed companies and their R&D face the pressures from competition in the market based on grower acceptance of the technology and generate partnerships with necessary agreements to advance in this area. strategy for developing competitive hybrids and placement in farms and meeting the expectations of spinners.4 with ginning outturn >33-35 per cent. mass scale hybrid evaluation and selection techniques at initial and advanced testing stages and in multi-location and market acceptability tests. CMS-R or gametocide systems have not become successful nor made any recognizable impact on seed production cost. . lint percentage. the purest form of cellulose in nature and also a substantial quantity of oil and protein in the cotton seed on which the spinnable lint hairs are borne. influencing the industrial economy and global markets. several major cotton-growing countries have adopted this technology on a large scale as a result of which global cotton output has reached 26 million tonnes and average yields to 730 kg lint per hectare. Earliness in cotton should allow the maximum usable growing period within the given seasonal limitations for effective lint production and expression of fibre quality attributes. Australia growing only variety has reported 2100 kg / ha average lint yield. Regarding Plant Varieties Protection as per TRIPs. a system for protection has been established in India through the Patents Act and the Plant Variety and Farmers’ Rights Protection Act. Introduction Cotton crop yields the most versatile fibre. Certain frequently asked questions for which more analytical genetic and breeding researches are needed have been listed in the paper. a variety genotype or hybrid is sometimes responsible for the lapses in commercial realizations in the field as well as at the end-user level. while that of India it is only 460 kg / ha even with hybrids. functional genomics. The potentiality for revolutionary improvements in the diploid cottons as well as barbadense and hirsutum may be expected to touch new horizons in the history of cotton improvement. boll weight. The transgenic hybrid technology after facing initial resistance from certain farmers and others has now created a great demand from farmers as well as textile industry as it has helped to improve the production to more than 4 million tonnes and productivity to over 460kg/ha within 3 years of its introduction in India. During 2005-06. the era of cotton genetics and breeding would undergo further metamorphosis. Once such a project takes full shape at the global level and the various scientific laboratories come together for the mapping of the cotton genomes on a coordinated basis.e. potentially resulting in increased photosynthetic activity per plant in cotton. The most relevant proprietary technologies and materials being developed all over the world are: (1) transformation systems (2) promoter systems (3) insect resistance genes (4) disease resistance genes (5) selectable marker genes (6) genetic markers (7) drought resistance genes (8) fibre quality-enhancing genes especially for strength. i. Systematic cotton improvement through the intelligent application of Genetics and Plant Breeding has proved to be the most practical means for achieving these primary objectives . The International Cotton Genome Initiative (ICGI) is gradually providing guidelines for the study of structural genomics. and span length of fibres. elongation and length (9) diagnostic probes and (10) others. A mismatch between Farmers’ and Breeders’ perception of genotype product for a given area. A large leaf area during seedling growth allows the F1 hybrids to absorb more light than their parents. In the world. genetic resources and germplasm stocks and bio-informatics in cotton for a better appreciation and understanding of the molecular basis of differentiation in the genera.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era significant heterosis for total and first harvest yields. The goal of cotton breeding is to primarily increase the (1) productivity and profitability to the cotton farmers and enable them to produce what the spinners need (2) to improve the combinations of quality parameters desired by the textile industry and trade and to 228 face inter-fibre as well as global competition (3) to increase the oil output primarily through enhancement of seed yields with reasonable optimization of oil and protein on the one hand and the spinnable lint fibre on the other and (4) to ensure reasonable employment opportunities and sustainable livelihoods for a large section of the population representing various sectors. evolutionary relationships among Gossypium species and related members of the plant kingdom. The testing of transgenic presence in grow-out test lots is a critical requirement. but also accelerated the process of privatization of R&D and seed distribution on a more globally competitive scale. whether transgenic or non-transgenic. some increase in seed coat fragments and motes. technology for production management for maximizing the genetic potential for yield and fibre quality in transgenic hybrids. unimpressive fibre strength improvements.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and now the new tool of biotechnology and genetic engineering has provided further impetus to crop improvement in cotton. in-house germplasm development strategy for use as parents of hybrids. major casualties include lower ginning outturn. Further. wide variations in micronaire values due to genetic and management deficiencies. Yet in most advanced countries especially in ten top ranking countries.conversion strategy. the testing of fibre harvested in the hybrids should be based on proper samples from well-maintained crop plots. strategy for 229 developing competitive hybrids and placement in farms and meeting the expectations of spinners. Seed rate has been drastically curtailed and boll load per plant has been increased to five to six folds in India in the use of hybrid technology both in Bt and non-Bt versions. The genetic engineering advances and thereby the incorporation of B. Multiple strategies for success Genotype deployment strategy. both the seed cotton yield and fibre quality improvements witnessed higher growth rates. If heterosis exploitation is one method to rapidly increase the stagnating cotton yields. molecular evaluation strategy. Existing genotype analysis Product analysis of cotton genotypes of proprietary and non-proprietary kinds in India in the current context of global competition and mill industry needs is urgently needed to tone up breeding research in both sectors for ensuring a 4 per cent higher growth rates. far higher yields per hectare are obtained from superior straight variety cultivars. the hybrid will have added advantage of double benefit of yield improvement through heterotic vigour for yield as well as consolidating the yield gains through bollworm control at a reduced cost of production. Transgenic hybrid technology When a shift from traditional breeding methods adopted up to the latter half of 1960s occurred in favour of hybrid breeding technology in cotton in India. Measures to prevent the ginned seeds from commercial crops of transgenic hybrids going to the planting seed market as transgenic F2 should be undertaken to ensure the supply of homogeneous lint parameters to the textile industry in the interest of real long-term benefits. scientific seed production practices for transgenic hybrids and systems for ensuring cost reduction and assured planting quality etc. In hybrid cotton breeding technology. Heterosis has been effectively used in cotton to increase yield through expansion and harmonization in the expression of various yield influencing parameters and fibre quality. incorporating Bt Cry 1Ac gene (transgenic hybrid). transgenic.t gene (from Bacillus thuringiensis) technology for bollworm control into hybrid technology of cotton have not only enabled to achieve a quantum jump in yield. mass scale hybrid evaluation and selection techniques at initial and advanced testing stages and in multi-location and market acceptability tests.. the higher boll numbers per plant produced and retained through heterosis and transgenic effects has given a boost to transgenic heterotic cultivars. In addition. while concurrently broadening the adaptability to larger areas. each of which represent a critical factor influencing the success and sustainability of the transgenic hybrid technology. While admitting that India has a large rain-fed area unlike those . gene outsourcing technique. parental purity maintenance techniques. Analysis of molecular variance has assumed importance in detecting polymorphism. Appreciation of the molecular basis of complex traits will provide genetic solutions and remove the misconceptions currently inhibiting an understanding and improvement of the performance of hybrids. Breeding for quality ELS cottons Extra-long staple cottons are needed with 2. for critically studying the quantitative trait loci (QTL) and also to detect linkage with undesirable genes.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era top cotton countries. but superimposed on the hybrid technology with the popular hybrids in vogue in last ten years has caused innumerable deficiencies in the field level. higher elongation per cent and appreciable micronaire value apart from drought tolerance and certain critical factors that influence length uniformity in fibre even under rain-grown conditions. Gene x Environment (G x E) interaction in hybrids is an important fact that cannot be ignored in genotype deployment and hence special attention to multi-location testing with special precision and attention and critical evaluation of performance a must for ensuring the success of the selected hybrids. Though 100 percent seed replacement rate is advocated for cotton Bt or non-Bt hybrids and use of labeled seeds year after year. micronaire value of 3.90 and above strengthlength ratio. gossypol. inferring the effects of selection based on very efficient targeted molecular selection practices in hybrid breeding programme. but valuable attributes. to map the genome to identify the traits of interest. The spectrum of genetic and phenotypic diversity in cotton is critical for understanding the complex processes in plants. superior parental choice and efficient painstaking breeding methods are advocated that was not effectively taken care of in the first generation Bt cotton hybrids and a realization has come after costly mistakes have been committed.6 to 4. Introgressive breeding has been revived after a long gap in India and the breeding material reported developed under NATP and TMC projects appear impressive. Hybrid technology has also become a ploy in the hands of certain unscrupulous farmers and traders by floating of numerous versions of hybrids with low genetic diversity and causing harm to genuine private seed companies with R&D with a vision and mission to help the growers and textile industry. But the purification process needs to be done to the core 230 to carry out genetic enhancement of parental lines developed through introgressive breeding to get the best results through superior expression for known and novel. linters and other by-products. tensile strength of >28-32 with 0. Potential of this powerful technology may be ruined by such unscientific activities. This requires priority efforts in the next three years and R&D . This is also a major reason for our shortfalls in production and deficiencies in fibre quality. New efforts needed Bt cotton transgenic technology has become a boon to farmers. it is being widely misused by certain traders and misguided farmers by enabling the supply of F2 seeds. Genomic tools & diversity Genomic tools like MAS have a significant new role in parental line development with enhanced fibre quality attributes like high fibre strength. For a superb performance of Bt plus hybrid technology. Potential of technology Hybrid and Bt cotton hybrid technology have enabled substantial increases in cottonseed yields resulting in higher contribution to edible oil output. traders and textile industry. the scope for India to accelerate its yield levels by effective transgenic hybrid deployment and cooperative contractual farming type crop management cannot be underestimated.4 with ginning outturn >33-35 per cent. protein.5% span length of >34 to 38mm. recurrent and single seed descent systematically for developing cultivars. The public breeding programme has fallen by nearly half during the last one decade. boll features and fibre quality are unattractive. it would help the Indian seed industry to depend more on local technology and provide service at lower cost . Bt gene technology with stacked genes would be helpful in effecting early maturity. Earlier cotton improvement resorted to pedigree selection. which are over 25 years old and TCHB 213 also similar. If the public sector R&Ds can intensify their basic researches in this area. is essential. Self-incompatibility induction through biotech approaches was indicated as alternatives and enable harvesting of crossed bolls from both parents projected. but for the absence of any alternative. which often tells on the stability and fibre quality. Adoption of strict selection criteria for genes controlling yield. CMS-R or gametocide systems have not become successful nor made any recognizable impact on seed production cost. reselection. but still not turned into practical use. In the private seed R&D sector also constant changes in personnel have resulted in lower breeder retention rate. handling and processing to the H x H or H x B hybrids on account of the various advantages derived by growing the latter. pubescence. Attention is needed to improve these aspects through the genetic engineering route. good quality cotton and pest resistance. still superior inter-specific hybrids or even a more adaptable pest resistant Suvin-like (3 decades old barbadense cultivar). transfer of pollen in cotton hybridization is a problem requiring manual work and an issue requiring molecular approaches to fix heterosis. politics and constant escalations. stability. but now short cuts have been employed with hybrid development. The desi cotton hybrids/varieties are no match in production. Irrespective of various mechanisms planned. if desi cotton has to make a higher progress in superior spinning uses. Parallel development of hirsutum and barbadense germplasm using superior sources in global gene pool and identifying the best combinations for fibre quality and wide adaptation are suggested. Genetics in seed cost reduction Forecast or continued efforts on new technology to reduce the cost of hybrid seeds produced especially GMS. superior genotypes with acceptable fibre quality standards have not been developed and the above mentioned genotypes have lost their charm and preference. The desi hybrids with GMS system are also not 231 making much headway. By and large. Importing such type quality cottons are dictated by ruling international prices. More innovative approaches rather than standard breeding methods are required to make it useful in the global competitive scenario. Innovative approach on diploid cottons Desi or diploid cotton area expansion especially under rain-fed cotton areas is advocated using the released hybrids and recent straight variety cultivars in Maharashtra state. resistance to drought and pests. Private seed companies and their R&D face the pressures from competition in the market based on grower acceptance of the technology and generate partnerships with necessary agreements to advance in this area. Public and private sector R&D cooperation Public cotton breeders in India spend very little efforts in transgenic breeding since access to transgenic by public breeders has been limited.. Bt cotton Performance enhancement Performance appraisal all over the country on Bt with hybrid technology indicated that there is need for much more R&D in agronomy and IPM technologies to maximize potential output and fibre quality for the entire crop duration.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Units should focus on this need. After Varalaxmi and DCH32. backcross. fibre properties etc. bulk. Cotton is a predominantly selfpollinated crop and often cross-pollinated to varying extents in different environments and may mimic crosses between inbred lines and out-breeders. In well-documented breeding lines. if a large number of crosses are tested. Coimbatore and Sirsa). over-dominance. Need for higher genetic orientation The principal genetic models in heterosis are dominance. But there is a limit to the level up to which this may be acceptable. Other factors most important from end-user point of view like seeds per boll. A magnificent look at the phenotype of the hybrid is an important factor for farmer acceptance besides a set of prominent agronomic attributes related to field performance in identifying the best hybrids. By pedigree data. In-house germplasm development In-house germplasm development in private seed industry has gained momentum and is the primary source of parents in successful hybrids rather than acquired germplasm. The hybrid cotton release and 232 replacement process in the competitive scenario is a delicate decision making process and is an important factor in private seed scenario for survival and brand image. The large array of hybrids floated in the market also can provide ample scope for new germplasm development by all participants by undertaking pedigree selection coupled with panmixis. MAU. have been accelerated rather than mere acquisition from other countries and this has been practiced in a systematic manner. pre-parental germplasm development for hybrids and also line development in different cultivated species particularly in CICR (Nagpur. Choice of transgenic hybrid The search for any unique genetic combination average more than 100 combinations in a well planned crossing programme each year involving over a thousand or more twin parental crosses (single cross) and depends on distinct parental development and choice of the right material. relatedness and consequently genetic distance can be deduced from pedigree selection. Quality improvement & MAS Development of marker systems such as RFLP. epistasis and also interaction between genetic and environmental and also physiological / biochemical factors which explain the causes of heterosis and hybrid vigour. Even in the public R&D centers. selective intermating and other methods.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era to farming community. These are very important to decide on the suitability to meet consumer industry requirements. habitability for biomass production ranging from 60-85 per cent has been reported. biochemical data and DNA data. one can analyze parental genetic distance. pseudodominance. Cotton breeders are also no longer unduly concerned about segregating populations and assumed that heterogeneity and heterozygosity are beneficial to commercial cotton production. . SSRs and SNPs considerably facilitated the estimation of genetic diversity between genotypes in various centres. lint per cent. Parbhani etc. UAS.. fibre length and fibre fineness are measured after harvesting. The vast genomic and technological resources available in model species like Arabidopsis etc could be used to rapidly advance our understanding of the underlying physiological and molecular processes and a precedence could be established that may support the analysis of heterosis in cotton to make further breeding advances Genetics of biomass and harvest index In crop plants. The relationship between molecular markers’ heterozygosity and heterosis depends on germplasm used and the characters analyzed. morphological data and agronomic performance information. AFLPs. Dharwad. lint per seed. No other country could adopt this technology successfully on such a large scale for various reasons including the difficulty of hybrid seed production. Some breeders are attempting shifting of photosynthates to lint at the expense of seed to increase the lint per cent by decreasing the seed size. Benefits & side effects of technology India is a pioneer in hybrid cotton technology and has made great impact on R&D. Any increase 233 in seed cotton yield and thereby increased seed yield can provide the higher oil output and also protein. increase in cost of production and facing other problems.125 kg per hectare (15-20kg in variety technology in India and 20-70 kg in certain countries) with high cost value of seeds. it can cause problems in ginning with seed coat fragments to the detriment of textile processing. In the continued special emphasis on hybrid cotton technology. But the primary . exploitation of the potential for high boll load (80-150 bolls per plant). The use of molecular marker Restriction Fragment Length Polymorphism (RFLP) and coefficients of parentage for identifying heterotic effects in cotton had been beneficial. root biomass. Such study has been helpful in detecting significant heterosis for total and first harvest yields.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Hence use of detailed characteristics of germplasm and an in-depth comprehension of the genetic basis of heterosis would be needed to develop strategies for utilization of molecular markers in pre-breeding parental lines exclusively for a hybrid programme and prediction of hybrid performance. Seed oil development requires higher amount of energy than lint development and lint being the primary commodity for which cotton is grown may be given the priority for lint attributes. fibre quality improvement to meet textile needs. commercial seed production practices. and span length of fibres. opting for high pesticide application. R/S ratio at seedling stage coupled with hybrid vigour and harvest index can be useful to identify better hybrids at initial stage of testing. Earliness in cotton should allow the maximum usable growing period within the given seasonal limitations for effective lint production and expression of fibre quality attributes in full. potentially resulting in increased photosynthetic activity per plant in cotton. still managed to far exceed the average productivity level of India. employment potential. textile industry and by-product utilization. But if it is unduly smaller seeds. Since its introduction in 1970s to 2002. the total production increased substantially and spinning potential of India’s cottons from 40s to 80-120 counts. Though they have retained the straight variety-based cultivation. lint percentage. boll weight. Quantitative traits being the most important for improvement of yield and fibre attributes. the focus on genetic factors underlying them should be given importance along with heritable epigenetic factors influencing gene expression. Fragile seed can affect planting seed quality also. Attention on biomass productivity. trade. certain casualties and deficiencies had occurred such as low volume seed rate of 1. The farmers have realized the advantage of hybrid vigour on yield potentials and quality up-gradation and millers got the produce they wanted. high quality seed with 100 per cent seed replacement rate and many other spin-off benefits. Genetics of hybrids for earliness & quality A large leaf area during seedling growth allows the F1 hybrids to absorb more light than their parents. Hence in identifying the best hybrids. primary attention may be focused on higher seed cotton yield with good quality fibre and then avail the benefit of resulting higher seed yield and therefore higher amounts of seed oil and protein there from. large scale privatization of seed industry. farmers’ ways and means of cultivation and profitability. Hybrid technology has a special role in several situations in India. while that of India is only 460 kg / ha even with hybrids. serious emergence of whitefly. if hybrids are produced from inbred/homozygous lines. However. (2) high per se performance and good adaptation of the parent populations to the target regions and (3) low inbreeding depression. escalation in cost of production. It also far reduced the realizable benefits from heterosis and hybrids.e. a study has shown that in certain combinations of G. the heterosis for yield was not consistent enough to warrant the production of hybrid seeds in cotton for achieving higher yields. the F2s of such hybrids can be expected to yield good fibre and high yield. elongation and length (9) diagnostic probes and (10) others. it was found that in a hybrid. cotton research would be witnessing expanded and amazing activities in cotton breeding with the help of the new gene technologies. barbadense hybrids. in upland cottons. Analysis of the existing products in the country would indicate only partial attention to these aspects and a better adherence to these criteria may help to improve the performance of cotton hybrid genotypes in future. * Differential potentials in different Cry . In hybrids with one parent having above average fibre quality combined with high yield and yield combining ability. 234 hirsutum x G. because the bollworms took a heavy toll on the high boll loads. The most relevant proprietary technologies and materials being developed all over the world are: (1) transformation systems (2) promoter systems (3) insect resistance genes (4) disease resistance genes (5) selectable marker genes (6) genetic markers (7) drought resistance genes (8) fibre qualityenhancing genes especially for strength. indebtedness.. FAQs & research investigations Certain frequently asked questions on the subject include the following for which more and more analytical genetic and breeding researches are needed and to provide solutions for major deficiencies in the future: * The genetic behaviour of hybrids with transgenic (Bt) in hemizygous locus and homozygous dominant loci condition * Bt gene incorporation in FP or MP or both parents and effects and advantages. a system for protection has been established in India through the Patents Act and the Plant Variety and Farmers’ Rights Protection Act. Under-use of diverse germplasm is responsible for the genetic diversity remaining untapped and in recent years. In the USA. one parent should be from the targeted region of adaptation and the other parent from any other source provided it is a good combiner. A mismatch between Farmers’ and Breeders’ perception of genotype product for a given area. damage to beneficial insect population and other harmful effects. Australia has reported 2100 kg / ha average lint yield. During 2005-06. IPR and genetic engineering Regarding Plant Varieties Protection as per TRIPs. success depends on (1) high mean performance and a large genetic variance in the hybrid population. emergence of resistance in insects. Australia’s experience Under the very high yield conditions in Australia. i. In the next one decade. a variety genotype or hybrid is sometimes responsible for the lapses in commercial realizations in the field as well as at the end-user level. this process is hampered by the non-availability of genetic resources from various sources to users easily.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era loss from bollworms caused high environmental pollution from large-scale use of chemicals. the fibres were stronger and finer appearing to be better suited to cotton spinning equipment now being used in their textile industry. However the Bt transgenic hybrid technology has come in handy from 2002 to ward off these deficiencies. Perception of commercial genotype In hybrid breeding. red-plant body pigmentation and effects on major expressions for agronomic and technological attributes. smooth leaf. naked seed. scientists with different perceptions and such numerous queries . * Hybrid performance as influenced by incomplete conversion into original parental genotype in cry 1Ac Bt genotypes * Plant age increase and diminishing gene expression in prolonged crop periods through plant management techniques for greater effectiveness * Genotype-phenotype relations and Cry 1Ac Bt protein expression variations in cotton hybrids * Bt Cry 1Ac in hirsutum and barbadense parents either in one or both parents on Bt gene effectiveness in hybrids on bollworms and influence on fibre quality. * Constitutive Bt genes in Bollgard I and II and effect on plant metabolism. due to linkages on other factors * Gossypol in cottonseed may lose the effective role as a deterrent against bollworm in Bt cotton and the effects thereon. * Whether the Bollgard II versions nearing the release stage is really superior in bollworm management in Indian conditions and how much superiority can be expected in yield. In the same genotype hybrids with BGII versions. protein interaction and yield level in cotton in differing environments. ginning outturn. * Combining CLCV/whitefly resistance with Cry 1Ac Bt gene by genetic engineering. beside pest resistance * Role of MAS approach with various tools and techniques for drought tolerance and fibre quality parameters in Bt cotton and manner of combining them * Randomness of bombarded Cry 1Ac gene incorporation in cotton genome/ chromosomes through genetic analysis and the differential genetic behaviour. * Bt transgenic based GMS and CMS-R hybrids and effect on simultaneous conversions for male sterility and Bt gene. (whitefly is normally a minor pest that assumed serious proportions with nonjudicious use of synthetic pyrethroids and now with Bt cotton and reduction in such pesticide use. boll size and boll weight and seed weight if any. hairy leaf. nectarilessness. and BGI versions and what are the yield advantages likely. F1 and straight varieties and dilution of effects if any * Genetic disturbances in Bt Cry 1Ac gene inserted genotypes on oil content. * Genomic explanations for earliness by 50% flowering.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 1Ac versions and ability to keep all the three bollworms and Spodoptera under control. * Genetic purity assessment techniques / tools and their relative efficiencies in detection for planting seed quality * Comparison of fibre quality and bollworm 235 resistance efficacy in F2. 50% boll bursting and Bartlett’s earliness index in Bt Cry 1Ac cotton hybrids. * There are many other points raised by NGOs. * Bt Cry 1Ac in different character backgrounds like medium okra leaf. whether both whitefly and induced CLCV would come down) * Complete backcrossing and limited backcrossing and pedigree selection in Bt gene incorporation into hybrid’ parental genotype. The International Cotton Genome Initiative (ICGI) is gradually providing guidelines for the study of structural genomics. super weeds. itching of fingers and palm during cotton picking in Bt cotton etc) by undertaking well-planned studies. 236 . In the world. The technology is powerful and to make it safer and sustainable as well as making new innovations for improving fibre quality and drought/disease resistance rests in the hands of geneticists. the era of cotton genetics and breeding would undergo further metamorphosis. The potentiality for revolutionary improvements in the diploid cottons as well as barbadense and hirsutum may be expected to touch new horizons in the history of cotton improvement. functional genomics. Conclusion The transgenic hybrid technology after facing initial resistance from certain farmers and others has now created a great demand from farmers as well as textile industry as it has helped to improve the production to more than 4 million tonnes and productivity to over 460 kg/ha within 3 years of its introduction in India.. genetic engineers and cotton breeders. genetic resources and germplasm stocks and bioinformatics in cotton for a better appreciation and understanding of the molecular basis of differentiation in the genera. evolutionary relationships among Gossypium species and related members of the plant kingdom.g. out-crossing and transgene flow. several major cotton-growing countries have adopted this technology on a large scale as a result of which global cotton output has reached 26 million tonnes and average yields to 730 kg lint per hectare.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era also need a scientific study and answer (e. Once such a project takes full shape at the global level and the various scientific laboratories come together for the mapping of the cotton genomes on a coordinated basis. Among the hybrids. The coefficient of variation was very low (1. the inheritance pattern of brix in fruits in intervarietal hybrids between genetically diverse tomato varieties and inbred lines showing brix values ranging from 3. Significant positive heterosis was evident in 39 hybrids ranging from 7. Forty four genetically diverse tomato entries comprising 32 processing tomato varieties and 12 breeding lines were utilized as parents.0%. taste and nutrition. In this paper. 47 and 28 were showing over dominance. Sree Rangasamy ABSTRACT Total soluble solids [TSS] measured as brix is an important fruit quality trait in tomato adding to the flavour. medium [3. The hybrids were evaluated for brix from fruits collected from replicated trials. dominance x dominance. The differences between the parents and hybrids were highly significant. dominance x additive and additive x additive and recessive epistasis governing the brix trait were evident connoting differences in alleles and different directions of non allelic interactions within the polygenic system for brix trait. A total of 182 intervarietal hybrids have been generated by crossing between diverse parents. R.00 to 3.Greece 237 . Inheritance studies of brix in tomato made previously have indicated that it is quantitative in nature and in general intermediate between parents. medium and high for brix expression.Agroaxon S.A.0 to 5. TSS consists of fructose and glucose sugars and acids. Brix shows a continuous phenotypic range in tomato varieties. dominance and partial dominance respectively. Preponderance of dominant gene action more in proportion in large number of hybrids suggests recurrent selection for further enhancement of brix levels.4 is presented and discussed. Significant and positive and negative heterosis was estimated.50] and high brix [4.52).51 and above] phenotyes and hybrid between the three groups were also grouped into low. Different kind of gene actions such as dominance. Michalakopoulos and S. Overdominance and dominance that were not reported in the hybrids between interspecific inbred lines x variety have been inferred in this study with intervarietal hybrids and this may be due to differences existing in the alleles between species.50]. Expression of brix in interspecific hybrids and inbreds developed from such crosses also has indicated that brix is governed by several quantitative trait loci.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era EXPRESSION OF BRIX IN TOMATO INTERVARIETAL HYBRIDS Panagiotis A.51 -4. In 36 hybrids brix was equal to either parent [Pt=P2=Ft] and in 22 of them brix was equal to the lower parent.. The pattern of variation in the parents and hybrids was continuous and similar. Research and Development Divison. 39. The parents were grouped into low [3. Nine had brix lower than the lower parent.5 to 30.Almyros 37100. 45 double. Reniform nematode. The research efforts launched within and outside the All India Coordinated Research Project (AICRP) on Oilseeds resulted in the development of a number of high yielding varieties of regional and multi-regional importance with relatively early maturity habit (90-150 days). Successful cultivation of castor hybrids viz. high branching. Orissa. 10 multiple and 20 back crosses were effected since 1998. GCH 4. Madhya Pradesh (<10%) and 48% is under irrigated conditions. 2003).01 l. Special emphasis has been given to incorporate resistance to pests and diseases like Fusarium wilt..44 l. long effective spikes (25-40 cm) are preferred. t) and ranks first in both area and production (2002-03). Hyderabad . Botrytis is another major biotic stress limiting the productivity in rainfed regions of castor cultivation especially during high humidity. Tamilnadu. convergent breeding programme combined with stringent selection pressure for early and medium duration high yielding varietal/male lines with resistance to pests and diseases. Rajendranagar. purification. Early or medium (150-180 days) duration varieties so as to complete their maturity within the maximum rainfall period with less node number to primary spike (1214). short duration and wilt resistant male lines or combiners.500 030. M. Macrophomina root rot. Introduction India accounts for nearly 55% of the world castor area (11. Breeding programmes initiated at the Directorate of Oilseeds Research.32 lakh ha area with 8.A ABSTRACT Castor.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era DEVELOPMENT OF MALE LINES RESISTANT TO FUSARIUM WILT IN CASTOR (RICINUS COMMUNIS L. 750 bulk selections were made. 2500 individual plant selections.1 and Raoof. continuous rainfall. Karnataka.63 lakh ha) and 51% of world castor production (11. Directorate of Oilseeds Research. and cloudy weather.. Production and productivity of castor is limited by wilt complex involving Fusarium wilt predisposed by Reniform nematodes and Macrophomina root rot in rainfed regions of Gujarat. C. Hyderabad to develop high yielding male lines with in built resistance to Fusarium wilt and its importance are reviewed in the present paper. t production and 1094 kg/ha productivity earning nearly Rs. Botrytis. and Tamilnadu. 52% of castor area is under rainfed conditions in states like Andhra Pradesh (40%). Using 700 crosses. A total of 800 single. Latest developments of breeding for high yielding male lines with in built resistance to Fusarium wilt at Directorate of Oilseeds Research is reviewed in the present paper. leaf miner and diversity of wilt resistance and parental material based on geographical diversity (Table 1). DCH 32 and DCH 177 even in rainfed regions emphasized the need for development of high yielding. In India.614 crores through the export of castor oil (2003-04). The most significant achievement was the release of wilt resistant varieties like 48-1 and DCS-9 for Southern India (DOR. 30 triple. It is cultivated in 7. a non edible oilseed crop is an important income generating crop of several small / marginal farmers’ of rainfed regions of Andhra Pradesh. 238 . Karnataka. Materials and Methods A systematic and stream lined programme of activities is involved in collection of germplasm. Several selections were generated through hybridization involving 1. Maharashtra.) Lavanya. DCS 57. DCS 9. 125-1. 2003). 299-2. About 128 bulk selections were evaluated along with 3 checks replicated after every 20 rows in an Augmented RBD.e. Wilt resistance was governed by a single dominant gene in Baker and by two complementary genes in 48-1 (Rao et al. DCS 33. Seventeen promising entries were evaluated in the wilt sick field along with 5 checks for . 1989). nature of stem and capsules are not linked with wilt resistance (Rao et al.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era wilt resistant male lines viz. However. early duration. several sources of wilt resistance have been identified through extensive screening of germplasm lines in the wilt sick plot. Results and Discussion At the Directorate of Oilseeds Research. Development of cultivars or 239 lines with improved disease resistance is associated with the breeding methodologies and selection procedures depending on the mating systems of the plant. Pedigree method of selection is used to generate high yielding.. interaction of duplicate genes (Sviridov. solid stem without hollowness in the central portion (pith) of the stem may be associated with wilt resistance and the character is being used in visual selection proceduresby breeders. Co-1 and accessions like Baker 239. 1988) and polygenes (Desai et al. 294-2. Six lines were found wilt free while three lines recorded <15% wilt incidence (Annual Report. bloom. Among different phenotypic traits. 122-5.. M 584 followed by back cross and pedigree method of breeding.. DCS 43.. 1967. REC 116 with wilt resistant. These lines were screened for wilt incidence in a wilt sick plot established at DOR. Such selections were bulked as advanced lines after attaining homozygosis for morphological characters like stem color. 398-1. Castor. stem and petiole color. 2001-02). 2003). 19992000). initially. Promising lines in the trial were further evaluated in preliminary station trials in three replications and multi location trials. 2001). Hyderabad. branching types like REC 2. Sviridov. bloom and capsule nature and evaluated for their seed yield and yield components in an augmented randomized block design (ARBD). 544-3 and 544-7 were further advanced by pedigree method ofselection for selection of resistant lines (Table 2). about 35 lines were found promising for seed yield and yield components (Table 3). Screening of early and advanced generation material in wilt sick plot Ninety-six entries comprising early generations from F2 to F4 stage were screened under wilt sick plot conditions for resistance to Fusarium wilt (Annual Castor Report. high yielding pistillate lines like DPC 9.. 3921.. M 574. DPC 11. Nineteen entries were found resistant with less than 20% wilt infection. 119-2. 1993 and 1994). JM 6 have been identified as resistant sources to this pathogen (AICRP Castor. and heritability of the trait i. 1967. Among them the entries with zero wilt incidence viz. 122-3. wilt resistant lines. DCS 74. the breeding methodology was confined to hybridization followed by selection of individual plants in the early segregating generation in the field condition and finally testing the lines in the wilt sick field conditions. 9-2. About 200 crosses were generated using the available pistillate lines. Varieties like 48-1. Podkuichanko. Studies on inheritance of wilt resistance indicated that Fusarium resistance is controlled by recessive genes (Moshkin. In the absence of any authentic information on inheritance of Fusarium resistance in castor. 1992. high yielding male lines and hybrids with the above sources of resistance and geographically diverse germplasm accession. DCS 41. other morphological characters viz. Among 128 bulk selections evaluated in augmented black design. disease resistance. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era confirmation of wilt resistance. Three advanced lines Kh-2k- 505, 660, 1264 were wilt free while Kh-2k-1262, 1267, 507 recorded <10% wilt incidence (Annual Report, Castor, 2001-02). During the last decade about 50 advanced lines recorded high seed yield ranging from 8-62 % over the best check with low node number varying from 8.9 to 17.1 (Table 4). Among them, advanced lines 2K 1262 (37%), and 2K 1253 were high yielding than DCS 9 (833 kg/ha) and resistant to Fusarium wilt with 8 and 17% wilt incidence in wilt sick plot in preliminary station trials. Evaluation of varieties/ male lines in AICRP multi location trials Among six inbreds viz., DCS 99, DCS 100, DCS 101, DCS 102, DCS 103, DCS 104 evaluated in AICRP multi location trials (200405), DCS 102 evaluated in 11 rainfed centres and 4 irrigated centres recorded 5% increase over the best check 48-1 (1604 kg/ha) and resistant to Fusarium in wilt sick plots of Directorate of Oilseeds Research, SK Nagar and Palem (Table 5). Several wilt resistant sources are available both in the germplasm and male lines or varieties due to the net working of common resources. Researchable gaps like screening procedures for combined infection of root rot, nematode, Fusarium and their interactions, studies on variability of the pathogen and resistant sources to isolates need to be thoroughly examined. Emphasis need to be given for thrust areas like studies on variability of wilt pathogen considering the susceptibility of released wilt resistant varieties and hybrids like GCH 4, GCH 5 etc., Molecular tagging of genes for resistance to Fusarium wilt resistance may increase the efficiency of screening of large number of diverse germplasm in addition to already available field screening techniques and artificial root dip techniques. REFERENCES 240 Annual Progress Report Castor. 1992-93. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. PP 17p. Annual Progress Report Castor. 1993-94. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. PP 33p. Annual Progress Report Castor. 1994-95. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. 165p. Annual Progress Report Castor. 1999-2000. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. 198p. Annual Progress Report Castor. 2001-02. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. 181p. Annual Progress Report Castor. 2001-02. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. 16p. Annual Progress Report Castor. 2002-03. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. 132p. Annual Progress Report Castor. 2003-04. Directorate of Oilseeds Research. Rajendranagar, Hyderabad. 133 p. Chattopadhyay, C., Reddy,MCM. 1995. Wilt Complex of Castor (Ricinus communis L.): Role of reniform (Rotylenchulus reniformis Linford and Oliveira) nematode. J. Oilseeds Res.12: 203 - 207. Desai, A.G., Dange,S.R.S. and Pathak, H.C. 2001. Genetics of resistance to wilt in castor caused by Fusarium oxysporum f.sp. ricini Nanda and Prasad. J. Mycol. Pl. Pathol. 31: 322-326. DOR (Directorate of Oilseeds Research). 2003. Castor in India. Research achievements. 17 p. Rao, Hanumantha, C., Raoof, M.A., Lavanya, C. 2003. Study on segregation patterns and linkages between morphological characters Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and wilt resistance in castor ( R i c i n u s communis L). J. of Oilseeds Res. 22: 114118. Moshkin, V.A. 1967. Castor. Oxonian Press Pvt. Ltd. New Delhi. 132-145 . Nanda, S., Prasad, N. 1974. Wilt of Castor a new record. Indian J. Mycol. and Plant Path. 4: 103-105. Podkhichenko, G.V. 1989. Donors of resistance to Fusarium in castor oil plant. Instituta Maslichnykh Kullar.1:24-26. Sviridov, A.A. 1967. Breeding for resistance to Fusarium. In: Moshkin, VA editor. Castor. Oxonion Press Pvt. Ltd. 157-163. Sviridov, A.A. 1988. Results of improving the parent forms of the castor hybrid Kranodarskit 3 for resistance to Fusarium. Institute Maslichnykh Kultur. 2: 16-19. Varaprasad, K.S. 1986. Rotylenchulus Reniformis Linford and Oliveria, 1940 – A comparative account of systemics, biology and management. In : Swarup G, Dasgupta DR, editors. Plant parasitic nematodes of India-Problems and Progress. New Delhi (India): Indian Agricultural Research Institute.194-210. Table 1. Sources of resistance used in crossing programme Resistance to Leaf miner Fusarium wilt Germplasm RG 1472, RG 1647, RG 1648, RG 1938, RG 1941, RG 1944, RG 2127, RG 2178, RG 2445, RG 2529, RG 2602, RG 2612, RG 2661 DCS 33, DCS 41, DCS 43, DCS 57, DCS 59, DCS 69 DPC 9, DPC 11, M 574, M 571, M 619, M 584 RG 297 RG 1713, 1719, 1726, 1741, 2040, 2377, 2559, RG 1582, 1514, 1586, 1526, 1523, 30, 2300, 2426 RG 1930 Source Advanced lines Pistillate lines Fusarium wilt, root rot and nematode Botrytis Diversity of parental lines (based on geographic diversity) Table 2. Promising advanced generation material resistant to wilt Entry 623-1 617-1 607-2 586-1 597-1 556-2 306-1 376-1 407-1 14 entries 241 Pedigree DPC 11 x DCS 43 DPC 11 x DCS 43 DPC 11 x DCS 43 DPC 11 x DCS 43 DPC 11 x DCS 43 DPC 11 x DCS 33 DPC 11 x DCS 9 DPC 9 x DCS 23 DPC 9 x DCS 59 Wilt incidence in wilt sick plot (%) 0 0 0 0 0 0 15 11 8 < 20 % Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 3. Seed yield and components of promising advanced lines evaluated in ARBD S. No. Selection number Number Effective Effective of nodes spike length spikes to primary (cm) per plant spike 13.6 14.2 15.2 14.2 16.2 19.4 14.8 15.6 17.4 11.8 12.5 12.7 12.5 15.3 13.1 13 14.3 11.1 13.5 13.1 15.1 11.9 14.7 12.7 13.7 12.1 11.7 1.97 3.94 4.55 3.6 29.4 29.0 36.6 43.0 31.2 36.6 37.6 39.2 42.8 31.4 25.7 33.5 22.5 39.9 22.7 28.3 30.5 20.7 36.7 24.3 31.7 30.3 27.5 35.5 24.9 33.7 22.9 8.13 16.27 18.8 14.9 5.9 6.7 7.5 7.4 4.5 3.1 4.9 5.9 3.9 3.7 6.4 6.4 7 6.8 12.8 11 7.7 6.7 7.1 5.9 7.3 1.8 2.8 5.4 4.8 11 4 3.1 6.21 7.17 5.7 Oil (%) Seed yield (g/plot) I set 1 2 3 4 5 6 7 8 9 10 II set 1 2 3 4 5 6 7 III Set 1 2 3 4 5 6 7 8 9 10 CD between Two checks 2 varieties in same block 2 var. in different blocks Check and variety 1.56 3.12 3.61 2.9 436 871 1006 795 DCS 9 GCH 4 DCH 32 743 793 801 804 DCS 9 GCH 4 DCH 32 44 46.3 44.8 43.5 44.3 45.8 43.1 42.8 48.0 47.2 412 1189 617 856 515 759 1321 472 730 655 DCS 9 GCH 4 DCH 32 681 713 715 741 43.4 48.6 46.2 49 39.8 41.6 47.1 747 797 674 638 1028* 1123* 920 DSC 9 582 592 600 617 623 639 644 670 672 43.8 43.1 40.7 45.3 44.0 38.0 47.2 47.7 45.2 46.1 581 806 1086* 837 859 909 1060 1088* 1087 987 242 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 4. Promising advanced lines evaluated in Preliminary Varietal Trials (1998-2004) Year Advanced line Seed yield (kg/ha) 1560 1320 1239 2194 2060 1140 1159 2127 2537 2030 1659 1542 1545 1973 1638 1597 2952 2148 2067 No. of nodes to primary spike 8.9 10.9 15.9 11.9 10.2 12.1 9.0 11.2 12.1 13.1 16.1 17.1 11.6 14.0 13.1 12.0 18.1 14.0 13.3 Increase over best check (%) 68 42 34 16 9 37 39 21 45 16 39 29 29 49 24 20 60 16 12 1998 2000 2001 2002 2003 2004 (Set I) Set II Kh-96-461-2 Kh-96-458 Kh-96-545 Kh-98-338-1 Kh-98-393-1 2K 1262 2K 1253 PVT-25 PVT-26 PVT-27 PVT 25 PVT 26 PVT 29 PVT 17 PVT 8 PVT 12 PVT 37 PVT 33 PVT 43 Table 5. Promising varieties for seed yield and wilt resistance in AICRP trials (2004-05) S. No. Entry Pedigree Seed yield (kg/ha) 1685 1572 1316 1471 1604 % of best check 105.0 98.0 82.0 91.7 100 Wilt incidence (%) Palem DOR SK Nagar 27.5 33.3 41.2 31.4 25.5 7.2 3.4 6.7 10.8 7.7 24.2 18.9 0.0 0.0 3.3 1 2 3 4 5 DCS 100 DCS 102 DCS 103 DCS 9 (C) 48-1 (c) DPC 11 x DCS 43 DPC 11 x DCS 43 M 571 x REC 2 243 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era DEVELOPMENT OF SUPERIOR INBREDS AND SELECTION OF EFFICIENT RESTORERS FOR DIVERSE CMS SOURCES IN SUNFLOWER Ranganatha, A.R.G.1, V. Vijay, C. Lavanya and K. Rukminidevi ABSTRACT Development of diverse and superior inbreds for seed yield and yield attributes, oil content and autogamy is required to develop new hybrids with higher heterotic potentials. In this direction, the inbreds are synthesised following recurrent selection from diverse gene pools. The superior inbreds identified morphologically were tested for the maintainer and restorer reaction. The identified maintainer inbreds are converted to develop diverse CMS lines under the background of different CMS sources. The identified superior hybrids are tested in the station and multilocation trials to save the time of conversion, utilizing the Gibberlic acid technique, to produce the male sterile inbred line. The results of the experiments conducted during kharif, rabi and summer seasons of 2004 and 2005 are discussed in this paper. Introduction Sunflower is becoming one of the important oilseed crops in various agro-production situations. However, the productivity levels of sunflower are continued to be low (Virupakshappa and Ranganatha, 1998 and Virupakshappa and Ranganatha 1999). Hence, to increase the productivity levels and to diversify the inbred base to develop superior hybrids the following investigations were taken up in sunflower. Material and methods The morphologically superior inbreds were tested for the maintainer and restorer reaction. The maintainer inbreds were back crossed to develop new CMS lines under the back ground of different CMS sources. Further, the paralelly identified promising hybrids were tested in the station and multi-location trials to save the time of back crossing, utilizing Gibberlic acid technique to produce the male sterile inbred line. The newly developed inbreds were regularly tested further for maintainer and restorer reaction. The new inbreds and crosses synthesized were evaluated in the station and in the multi location trials during kharif, rabi and summer seasons of 2004 and 2005. Results and discussion The inbreds were synthesized following recurrent selection from different gene pools (Ranganatha et al., 2000 and Ranganatha et al., 2003). The superior inbreds were tested for their maintainer and restorer reaction. The inbreds and crosses were evaluated for seed yield and yield attributes. Evaluation of new inbred lines Newly developed inbreds were evaluated during kharif and rabi seasons and a number of promising inbreds were identified for seed yield, oil content and other attributes. The identified inbreds possessed 4-5% higher oil content. Two inbred selections (GP 9-472-7-2 and GP 9-38-C-2-1) recorded higher oil per cent (>45%) and also exhibited higher necrosis resistance. The inbreds developed through the inbreeding generations and the superior stabilized types were evaluated under different sets and the performance of superior inbreds are given in tables 1 to 3. GP9-322-1 exhibited highest oil content (45%) followed by GP9-839- 1. Directorate of Oilseeds Research, Rajendranagar, Hyderabad – 500 030 244 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 5-1 (44.8%). In set-2, GP317-3 exhibited maximum oil content (45.5%) followed by GP2150-5 (44.8%). For seed yield, GP325-3 recorded highest (38.7g) followed by GP2166-5 (31.7g). In set-3, GP1-1044 (45.7%) recorded maximum oil content followed by GP1-10 (45.3%). For seed yield, GP1-69 (35.5g) recorded highest followed by GP1-2210 (32.9g). Development of new restorer lines The GP line inbreds were evaluated for the maintainer and restorer reaction during summer and kharif seasons and identified 22 new restorers for diverse CMS lines (Table-4). The studies resulted in identifying the following effective restorers in another set for diverse CMS sources viz., inbred GP201 restored fertility in ARM 243A, ARM 247A and PET-2-7-1A; line RARM-241 restored in 234A and ARM 247A; DRM-34 restored in ARM 247A, PF853A, PET-2-7-1A and PET2-89A; GP9-163 restored in ARM 247A, PET2-7-1A, IMS-400A, IMS-WG and IMS-IB-4; GP9-472-5 restored in ARM-247A, IMS-400A, PET2-7-1A and PFMRA and PF-853A. Further, P356 restored fertility in 9 lines; 3376R restored in 8 lines; R 856 restored in 8 lines and R-272-1 restored fertility in 3 lines. Evaluation of inbreds for combining ability A total of 150 experimental hybrids are synthesized and evaluated. Identified the new crosses DSC-20, 6, 35, 23, 27, 4 and 245 as superior hybrids compared to the popular checks KBSH-1 and MSFH-17 hybrids (Table-5). The hybrid DRSH-102 exhibited superiority over popular checks KBSH-1, PAC-1091, MSFH17 and KBSH-44 for seed yield; KBSH-44, MSFH-17 and PAC-1091 for oil content and KBSH-44, MSFH-17 and PAC-1091 for oil yield in the multilocation evaluation of 14 centres (Table.6). Another hybrid DRSH-103 also exhibited seed yield and oil yield superiority over KBSH-1 (Progress Report, 2005) with zero per cent downy mildew in the multilocation evaluation. REFERENCES Ranganatha, A.R.G., Pradeep Kumar, P and Chattopadhyay, C, 2000. Evaluation of new CMS and inbred lines in sunflower, J. Oilseeds Research. 17: 385-386. Ranganatha, A.R.G., Tirumala Rao, V. and Rukmini Devi, K. 2003. Development of diverse maintainer and restorer inbreds and populations in sunflower. In: Advances in Genetics and Plant Breeding – Impact of DNA revolution, UAS, Dharwad, p. 67. Virupakshappa, K. and Ranganatha, A.R.G. 1998. Approaches for enhanced exploitation of heterosis in sunflower. Lead paper presented in Heterosis national seminar, PKV, Nagpur Progress Report 2005. NATP-Sunflower Hybrid Project, DOR, Hyderabad Virupakshappa, K. and Ranganatha, A.R.G. 1999. Heterosis and hybrid seed production in sunflower. In: Heterosis and hybrid seed production in agronomic crops. ed. A.S. Basra, Food Products Press, New York, pp. 185-216. 245 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1. Performance of top inbreds, Set-1 Entry Days to maturity 90 90 95 97 97 94 88 89 96 96 89 96 94 Plant Head height diameter (cm) (cm) 100 110 80 130 90 90 127 94 116 126 77 112 121 10.2 9.3 8.0 12.2 8.6 10.2 10.6 11.4 10.3 12.2 12.4 11.2 12.4 Seed yield (g/Plant) 26.6 20.3 10.8 33.1 16.9 18.1 17.4 24.0 19.3 21.1 25.4 30.0 31.0 Oil content (%) 43.3 44.6 43.8 41.9 44.1 44.8 45.0 44.1 43.0 43.4 39.0 40.0 39.5 Oil yield (g/Plant) 11.5 9.0 4.7 13.8 7.4 8.1 7.8 10.5 8.3 9.1 9.9 12.0 12.2 GP9-33-E-4-2 GP9-116-5-1 GP9-472-1-5 GP9-472-4-1 GP9-472-5-3 GP9-839-5-1 GP9-322-1 GP9-414-5-3 GP9-472-5-4 GP9-472-7-5 Morden (c) TNAUSUF-7 (c) GAUSUF (c) Table 2. Performance of top inbreds, set-2 Entry Days to maturity 97 90 88 95 87 104 93 97 90 96 96 Plant Head height diameter (cm) (cm) 78 7.0 124 13.6 100 9.6 100 9.8 100 11.1 100 6.9 88 9.4 126 14.3 76.0 12.2 113.0 11.1 116.0 12.0 246 GP-317-3 GP-325-3 GP-557-3 GP-1159-1 GP-2150-5 GP-224-1 GP-886-1 GP-2166-5 Morden (c) TNAUSUF-7 (c) GAUSUF-15 (c) Seed yield (g/Plant) 13.2 38.7 15.0 28.1 14.5 32.1 27.3 31.7 23.8 26.7 31.4 Oil content (%) 45.5 44.6 44.7 42.8 44.8 43.8 43.3 42.2 37.4 38.9 38.3 Oil yield (g/Plant) 6.0 17.2 6.7 12.0 6.4 14.0 11.8 13.3 8.9 10.3 12.0 8 10. New Restorers for different CMS lines S.7 45.0 10.No.8 4.6 35.5 Oil yield (g/Plant) 13.3 30.2 108 9.0 100 6. PET2-7-1A . PET2-7-1A IR-265A I-IB4.9 36.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 3.1 44.9 Oil content (%) 45.2 Seed yield (g/Plant) 29.6 13. PF-400A PF-274A.0 44.8 87 9.7 125 13.1 13. PF-400A PET2-89A.0 37.4 26.0 13.3 85 7.5 35. PET2-89-A. ARM-245A PET-2-7-1A PET-2-7-1A PET-2-7-1A PET-2-7-1A ARM-245A PF-274A.2 9.9 43.1 32.1 10. Performance of top inbreds. PET2-7-1A PF-274A PET2-7-1A IMS-WGA.3 119 7.6 37.9 13.5 22.3 15.8 42.9 45.4 120 12.9 30.8 5. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Genotype (Restorer) GP9-856-3 GP9-755-1 GP9-53-2 GP9-30-1 GP9-58-4 GP9-1932 GP9-220-1 GP9-846-4 GP9-733-5 GP9-556-7 GP9-811-4 GP9-811-5 GP9-201-1 GP9-58-5 GP9-1446 GP9-163-8 ARM-239 ARM-247 ARM-243 VND-5 (NB) LIB-02-M3 DRM-71-2 247 CMS line ARM-245A ARM-245A PF-274A PET2-7-1A PF-274A ARM-245A PET2-7-1A. ARM-245A ARM-245A PET2-89A.8 GP1-10 GP1-69 GP1-737 GP1-1044 GP1-1986 GP1-2086 GP1-2210 GP1-2283 Morden (c) TNAUSUF-7(c) GAUSUF-15 (c) Table 4.2 30.0 77 13. I-852A.0 111 8.3 43.4 14. I-WGA. Set-3 Entry Days to maturity 91 95 100 97 95 93 97 90 91 95 100 Plant Head height diameter (cm) (cm) 108 13.3 100 12. 0 36.5 11.9 12.9 25.6 133.0 162.6 143.5 130.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 5.1 26.1 35.1 143.3 150.1 10.4 14.6 129.5 33.9 35.9 29.3 108.6 33.7 Head dia-meter (cm) 13.4 11.1 32.5 12.5 DSC-20 DSC-35 DSC-6 DSC-18 DSC-243 DCS-53 DSC-29 DSC-27 DSC-4 DSC-23 DSC-56 DSC-245 MSFH-17(c) KBSH-1 (c) Table 6.4 35.3 33.0 35.3 130.7 35.4 37. Performance of superior new crosses in Sunflower Entry Days to 50% flowering 58 54 60 60 61 67 59 65 64 64 53 58 57 55 Days to maturity 93 90 96 94 96 99 92 97 96 95 90 94 94 91 Plant height (cm) 151.5 117.9 Seed yield (kg/ha) 1614 1398 1403 1165 1035 1008 1137 1265 1337 1465 1117 1331 1165 1150 Oil con-tent (%) 38.0 137.8 150.3 Oil yield(kg/ha) 568 532 406 431 549 481 248 .1 12.5 31.7 11.6 12.7 12.8 149.2 36. Performance of DRSH-102 (Mean of 14 locations) Entry PAC-309 DRSH-102 KBSH-44(c) MSFH-17 (c) KBSH-1 (c) PAC-1091 (c) Seed yield(kg/ha) 1716 1517 1505 1468 1462 1446 Oil content(%) 33.8 11.7 33.0 12.9 13.3 37. Exploitation of available sources of CMS is necessary to overcome the problem arising due to the overdependence of single CMS source (WA). K. S. Five crosses which had more than 20 per cent spikelet fertility were advanced to F2 generation . WC 35. Utilisation of this CMS line in hybrid rice development has been hampered due to nonavailability of restorers.com CMS line IR 66707A possessing the cytoplasm of O. panicle length. To achieve the desired productivity and sustainability of rice hybrids such an overdependence on few CMS lines is undesirable.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era RESTORER IDENTIFICATION FOR CMS LINE (IR 66707A) WITH ORYZA PERENNIS CYTOPLASM Banumathy. WC 7. perennis cytoplasm. Maximum pollen (48%) and spikelet fertility (67. number of productive tillers per plant.3 to 67. perennis and nuclear genome of IR 64 was developed by Dalmacio et al. perennis cytoplasm was crossed with 50 wide cross derivatives. Pollen fertility studies of F1 progenies revealed that the revertants had no fertility restoring ability although they became fertile. Crossess were effected between IR 66707A and the newly identified fertile revertants. Seeds of IR 66707A were subjected to various doses (10. plant height. Thiyagarajan and K. Of the 26 F1s. Burton (1977) discovered fertile revertants from a CMS line possessing A cytoplasm in pearl millet. Hybrid rice research must therefore broaden the nuclear diversity of parental lines through the conversion of agronomically superior genotypes into CMS lines.0 per cent and that of spikelet fertility varied from 10. WC 20. WC 4. days to 50 per cent flowering. Observations were recorded on pollen fertility. Fertile revertants were observed in the population irradiated with 50kr. Pollen and spikelet fertility studies revealed partial restoration in eight crosses involving IR 66707A with WC 3. WC 36 and WC 53. CMS lines possessing Oryza perennis cytoplasm express stable sterility and good agronomic characters.33%) were observed in IR 66707A /WC 20 followed by IR 66707A /WC 53 with 30 and 40 respectively. Among various sources. germination was observed only in 20 crosses which were analysed for fertility restoration ability. WC 9. (1995). (1996) from male sterile 249 . A stable TNAU. Coimbatore E-mail: mathysakthi@yahoo. the fertile revertant isolated by Shen et al.33 per cent.. The revertants were morphologically similar to the maintainer line IR 66707B. panicle exsertion and spikelet fertility. 40 and 50 kr) of gamma irradiation. The range for pollen fertility was between 6. Pollen fertility studies of F2 progenies of IR 66707A/WC 4. Fertile revertants are the fertile plants isolated from any CMS line either naturally or by induced means.0 and 48. Siddeswaran ABSTRACT In order to identify restorer for O. Seeds were sown after 20 hours of soaking along with the untreated seeds of IR 66707A. The revertant has the ability to restore the fertility of a CMS line from which it is originated. Introduction Most of the commercial rice hybrids released in India depend on few IRRI bred CMS lines. More than 50 percent of plants in IR 66707A/WC 20 expressed 70-80 per cent spikelet fertility. The F1 seeds were obtained only for 26 cross combinations. the CMS line (IR 66707A) with O. However. 20. These revertants had no fertility restoring ability although they became fertile. IR 66707A/WC 20 and IR 66707A/WC 53 showed segregation for fertility and sterility. 30. Of the 26 F1s. perennis cytoplasm was crossed with 50 wide cross derivatives (Table 1). fertile plants were identified in M1 generation and crossed with IR 66707A to analyse the restoration ability of fertile revertants. dry seeds of IR 66707A were subjected to gamma irradiation at 10. 30. perennis cytoplasm was crossed with 50 wide cross derivatives (Jayamani. The treated and control seeds were immediately soaked in distilled water for 24 hours. number of productive tillers per plant. plant height. Pollen and spikelet fertility studies revealed partial restoration in eight crosses involving IR 66707A with WC 3. more than 90 per cent of commercial hybrid production involves only WA cytoplasmic source for male sterility (Yuan. Five plants were randomly selected in each hybrid at the time of flowering for recording biometrical observations viz. WC 4. 250 Results and Discussion Diversification of cytoplasmic base is also very essential as that of widening the genetic base. Of this. percentage of panicle exsertion and percentage of pollen and spikelet fertility. Various CMS lines possessing different types of sterile cytoplasm can be used to overcome the problem arising due to overdependence on WA cytoplasm. The F1 seeds were obtained only for 26 cross combinations. Observations were recorded on pollen fertility. panicle length. WC 20. perennis and nuclear genome of IR 64 (Dalmacio et al. 1993) diversification of the types of available cytoplasmic male sterile sources is essential to reduce the genetic uniformity and resulting vulnerability of hybrids to pests and diseases.perennis cytoplasm. Research efforts in many countries attempted towards the identification of restorer for O.2000). perennis cytoplasm. Materials and Methods Crossing with Wide Cross Derivatives The CMS line IR 66707A with O. Earlier reports (Ganesan et al. The . The F1 seeds obtained from 20 cross combinations were raised during summer 2000 by adopting a spacing of 20 x 20 cm. Use of Wide Cross Derivatives In order to identify restorers for O. All the seedlings were transplanted by adopting a spacing of 20 x 20 cm during kharif 2000. Development and Use of Fertile Revertants Fertile revertants are the fertile plants identified in the M1 generation of any CMS line. the CMS line IR 66707A possessing the cytoplasm of O. the present study was directed towards the use of wide cross derivatives and development and use of fertile revertants for identification of restorers for IR 66707A. Hence. which were analysed for fertility restoration ability.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era indica line II-32A was able to restore the fertility of CMS line II-32A. perennis cytoplasm. WC 9. Keeping in view. Coimbatore. 40 and 50 kr at the gamma chamber 60 Co at Sugarcane Breeding Institute.. panicle length. Since. Based on pollen fertility studies. the CMS line (IR 66707A) with O. WC 7.. WC 36 and WC 53 (Table 2). in the present study two approaches involving the use of wide cross derivatives and fertile revertants were adopted for the identification of restorers for O. panicle exsertion and spikelet fertility. In the present study. days to 50 per cent flowering. For each treatment 250 seeds were used. germination was observed only in 20 crosses. Excess water was drained and then sown in sowing trays. plant height. 1998) indicated that most of the cultivable varieties were unable to restore the fertility of IR 66707A. Single seedling per hill was planted. 20. days to 50 per cent flowering. WC 35. These revertants are used to restore the fertility of the parental CMS line from which it was originated. The untreated seeds were kept separately.. 1995) was identified as the best due to its stable sterility along with desirable agronomic characters. IR 66707A/WC 7. 40 and 50 kr) of gamma irradiation. although they became fertile. perennis. Pollen and spikelet fertility studies of F2 progenies of the cross involving WC 20 as male parent showed that 70 per cent of plants recorded 70-80 per cent fertility indicating the improvement of fertility in advanced generation. These revertants were classified into B and R types. Five crosses viz. longistaminata 101221) and WC 53 (CO 43/ O. IR 66707A/WC 7 and IR 66707A/WC 35 did not exhibit plants with high spikelet fertility. Fertile revertants were isolated successfully from CMS lines in a number of crops (Burton. They obtained fertile revertants from BT CMS line when treated with ethyl methane sulphonate. IR 66707A/WC 4. The B type was similar to maintainer and R was similar to restorer. Radiation and chemical mutation are the suitable ways to produce fertile revertants especially in the case where restoration for certain types of CMS lines is difficult to obtain. in terms of their fertility restoration ability.33 per cent. 1987.. IR 66707A/WC 20. F2 progenies of crosses IR 66707A/WC 20 and IR 66707A/ WC 53 showed segregation for fertility and sterility. These revertants were crossed with IR 66707A to identify the restoration ability. Shen et al.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era range for pollen fertility was between 6. (1987).33 %) were observed in IR 66707A/WC 20 followed by IR 66707A/WC 53 with 30 and 40 per cent respectively. The F2 progenies of IR 66707A/WC 53 segregated for fertility and sterility and the fertile plants recorded 40-50 per cent spikelet fertility. 1989). Fertile revertants were observed in M1 generation of the population irradiated with 50 kr. (1987) and Smith (1987) showed that this type of reversion might have resulted from recombination and or deletion of mitochondrial DNA. Seeds of IR 66707A were subjected to various doses (10. the advanced generation progenies of the cross involving IR 66707A and WC 20 may have better chance to restore fertility of O. 1977. (1996) isolated a fertile 251 . (1996). Studies of Rottmann et al. Nawa et al. However. IR 66707A/ WC 35 and IR 66707A/WC 53 had more than 20 per cent spikelet fertility. The selfed seeds of these crosses were advanced to F2 generation in order to identify and select plants with high percentage (>80%) of spikelet fertility. (1987). Seeds were sown after 24 hours of soaking along with the untreated seeds of IR 66707A. 30. 20.00 (IR 66706A/WC 3) and 48. 1983.. After 2-3 selfings the fertile lines obtained may be used as restorer parents for the restoration of fertility of IR 66707A. The pedigree of WC 20 (IR 64/O. as suggested by Shen et al. The revertants were morphologically similar to the maintainer line IR 66707B and recorded more than 70 per cent pollen and spikelet fertility. longistaminata 101221) revealed that the wild species O.. longistaminata might have possessed the restoring gene which in turn resulted in partial restoration of IR 66707A.30 to 67. Similar results were also observed by Nawa et al. This implies that there was a slow progress in fertility improvement as compared to the other F2 progenies of IR 66707A/ WC 20. The F2 progenies of IR 66707A/WC 4. He et al. Umbeck and Gangenbech. Nawa et al. Maximum pollen (48 %) and spikelet fertility (67. These revertants had no fertility restoration ability.00 per cent (IR 66707A/ WC 20) and that of spikelet fertility varied from 10. Development and Use of Fertile Revertants Fertile revertants are the fertile progenies obtained from any CMS line either spontaneously or by induced means. The study of pollen and spikelet fertility of F1 progenies showed that the revertants had no fertility restoration ability. As compared to these F2 populations. K. Cloning of the plasmids in CMS rice and changes of organisation of mitochondrial and nuclear DNA in cytoplasmic reversion. Gao. G. D. Sitch. Y. S. T. 1987. 17: 635-637. 252 . Isolation and genetic characterisation of fertility restoring revertant induced from cytoplasmic male sterile rice.. Ishii. Li T. Wang. L. M.Rottmann WH. Coimbatore (Unpublished). Rangaswamy.. Brears T. 2000. sativa).. Cai... R. Mitochontrial DNA rearrangements in Pennisetum associated with reversion from CMS to fertility. Dalmacio. Thiyagarajan. Restorers and maintainers for CMS lines of rice. REFERENCES Burton. R. T. the maintainer of II-32A. Umbeck. S.G. Li Z. Peoples’ republic of China. 1987. 1995. P. Virmani.. T. Acta Genet. 1977.).A.W. K. Reversion of male sterile T-cytoplasm maize to male fertility in tissue culture..N. Thesis submitted to Tamil Nadu Agricultural University. Changsha. Khush. editor. 1989.D. Y.S. Nawa. In: Wilson KJ. Brar. T 24 was morphologically and agronomically similar to II32B. The mitochondrial gene is lost via homologous recombination during reversion of CMS-T maize to fertility. Fuji. Euphytica. 6: 1541-1546. M. M.K.International workshop on Apomixis in rice. Q. 13-15 Jan 1992. Jpn. Fertility sterility maintainer mutants in cytoplasmic male sterile pearl millet. 1998. Gangenbach.P. Amarlal. The acquired revertant.. Genet. Sinica. 35: 163-164. Sano. 16: 1-6. X.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era revertant from the male sterile indica line II-32A when treated with 60Co gamma rays at a dose of 290 GY. 1993. Hunan Hybrid Rice Research Centre. Oryza. Plant Mol. Euphytica 90: 17-23. B. 9: 277-286. 23: 583-588..P. Advances and constraints in the use of hybrid rice varieties. 1987.. 62: 301-314. Ph. p 1-4. K.S. Wide hybridisation to transfer cytoplasm and floral traits in rice (Oryza sativa L. 1983... Identification and transfer of a new cytoplasmic male sterility source from Oryza perennis into indica rice (O. Jayamani . 82: 221225. Crop Sci.F.P. J. Biol. Hodge.. Smith. D. Ganesan. The revertant was able to restore the fertility of a number of CMS lines besides II-32A and was identified as a near isogenic line with II-32A for restorer gene.. Fertility restoring mutants in T type wheat cytoplasmic male sterile line irradiated with 60Co gamma rays. Shen. S.. Yuan. Yamada. Crop Sci. L. He P. EMBO J. M. 1996. rufipogon 100916 ASD 18 x O.rufipogon 100916 ASD 18 x O.nivara 105343 ASD16 x O.rufipogon 103305 IR50 x O.nivara 105343 ASD16 x O.longistaminata 101221 IR64 x O.rufipogon 103305 ASD 18 x O.rufipogon 103305 IR50 x O. longistaminata 101221 CO43 x O.rufipogon 103305 IR50 x O.longistaminata 101221 IR58025 B x O.longistaminata 101221 IR50 x O.rufipogon 100916 ASD 18 x O.longistaminata 101221 IR58025 B x O.nivara 105343 ASD16 x O. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 Wide cross derivatives WC O3 WCO4 WC O5 WC O6 WC O7 WC O8 WC O9 WC 10 WC 11 WC 12 WC 13 WC 14 WC 15 WC 16 WC 17 WC 18 WC 19 WC 20 WC 21 WC 22 WC 23 WC 24 WC 25 WC 26 WC 27 WC 28 WC29 WC30 WC 31 WC 32 WC 33 WC 34 WC 35 WC 36 WC 37 WC38 WC 39 WC 41 WC 42 WC 43 WC 44 WC 45 WC 46 WC 47 WC 48 WC 49 WC 50 WC 51 WC 52 WC 53 Parentage ASD16 x O.nivara 105343 CO43 x O. longistaminata 101221 CO43 x O.rufipogon 103305 IR50x O.rufipogon 103305 IR50 x O. longistaminata 101221 253 . No.nivara 101871 CO43 x O.rufipogon 103305 IR50 x O.rufipogon 103305 IR50 x O.rufipogon 100916 ASD 18 x O. longistaminata 101221 CO43 x O.rufipogon 103305 IR50 x O.rufipogon 103305 IR50 x O.nivara 101871 CO43 x O.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1.longistaminata 101221 IR64 x O.rufipogon 100916 ASD 18 x O. longistaminata 101221 CO43 x O.longistaminata 101221 IR58025 B x O.rufipogon 103305 IR50 x O. Wide cross derivatives used in the study Sl.longistaminata 101221 IR58025 B x O.nivara 105343 ASD16 x O.nivara 101871 CO43 x O. longistaminata 101221 CO43 x O.rufipogon 100916 ASD 18 x O.nivara 101871 IR64 x O. longistaminata 101221 CO43 x O.rufipogon 100916 CO43 x O.longistaminata 101221 IR64 x O. longistaminata 101221 CO43 x O.longistaminata 101221 IR58025 B x O.longistaminata 101221 IR64 x O.nivara 101871 CO43 x O.nivara 101871 CO43 x O.nivara 105343 ASD16 x O.rufipogon 100916 ASD 18 x O.longistaminata 101221 IR64 x O. 7 86.0 96.0 23.7 73.1 85.3 21.7 21.2 64.0 0.0 63.5 65.5 19.0 0.4 91.5 69.3 23.0 23.5 20.0 Plant height (cm) 63.0 70.0 98.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 2.0 61.0 72.7 88. Data on quantitative characters of crosses involving IR 66707A and wide cross derivatives Cross Pollen Days to combinations fertility 50 % (%) flowering IR 66707A/WC 3 IR 66707A/WC 4 IR 66707A/WC 5 IR 66707A/WC 7 IR 66707A/WC 9 IR 6707A/WC 10 IR 6707A/WC 13 IR 6707A/WC 14 IR 6707A/WC 20 IR 6707A/WC 25 IR 6707A/WC 26 IR 6707A/WC 29 IR 6707A/WC 33 IR 6707A/WC 35 IR 6707A/WC 36 IR 6707A/WC 37 IR 6707A/WC 43 IR 6707A/WC 46 IR 6707A/WC 47 IR 6707A/WC 53 6.0 0.0 54.3 23.5 22.0 64.0 24.7 20.2 25.5 87.0 73.3 30.1 88.0 0.0 23.0 20.6 88.0 10.0 0.0 89.0 0.0 97.4 25.0 94.0 0.0 67.5 24.0 0.5 23.0 92.7 25.5 25.7 23.3 83.0 0.0 20.0 95.0 102.0 0.0 90.0 40.0 89.0 No.0 113.0 22.3 10.3 63.5 22.0 69.0 20.6 94.0 0.0 0.4 12.0 95.0 30.9 0.0 0.5 22.3 0.0 10. of Panicle Panicle Spikelet productive length exsertion fertility tillers per (cm) (%) (%) plant 21.0 90.3 91.0 0.4 87.7 64.1 93.0 0.3 89.0 62.0 24.0 23.5 22.0 71.0 90.0 23.0 93.0 0.1 18.0 95.0 72.3 0.0 21.0 0.5 27.0 0.0 98.7 23.0 254 .0 95.3 18.0 22.0 0.0 48.7 87.0 22.0 98.0 0.0 24.0 100.3 24.0 0.3 23.3 13.0 24.0 20.0 92.0 28.8 90.9 88.0 71.7 90.5 18.5 19.0 95.0 95.7 89. Kulkarni ABSTRACT Chilli is. pungency and aroma. fruit length and green fruit yield per plant suggesting the involvement of cytoplasm in the expression of these traits. UAS. S. Most of the cultivars in chilli are conventional hybrids. number of seeds per fruit (2. UAS.2). Similar results were also obtained with respect to standard heterosis for days to flowering (12. However. Department of Genetics & Plant Breeding. one of the major spice cum vegetable crops. 80 hybrids. Ramesh and R. synthesized using two CMS lines and their corresponding maintainers (as lines/ females) and 20 testers (as males) were evaluated along with their parents and commercial check (NS 1101) in RBD with two replications during summer 2005 at the experimental plots of the Department of Genetics & Plant Breeding. more number of hybrids based on fertile cytoplasm expressed positive standard heterosis for green fruit yield per plant (2. 0). 7). specially consumed as food additives for its unique color. Main Research Station. A. Hebbal. Combined analysis of variance of isonuclear-alloplasmic lines and their hybrids revealed significant mean sum of squares due to and within cytoplasm for days to flowering. plant spread. The results revealed favourable effect of sterile cytoplasm on specific combining ability and standard heterosis for many traits suggesting the need to exploit CGMS system to develop heterotic hybrids in chilli. red fruit number (3. 2) and number of green fruits per plant (3.8). C1. GKVK. number of seeds per fruit and green fruit yield per plant. CMS based hybrids were of little success in the hands of the private seed companies. plant height (14. Of the 80 hybrids.14). In this background.. 1. Bangalore 255 . Exploitation of CGMS in any crop species needs high nicking parents with perfect restoration which could be one of the limitations in chilli.1) and red fruit yield per plant (9. Variance between cytoplasms was found to be significant for days to flowering.7) than hybrids based on sterile cytoplasm. 6). plant spread.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era EVALUATION OF ISONUCLEAR ALL OPLASMIC HYBRIDS IN CHILLI (Capsicum annuum L) Nanda. Mohan Rao. Bangalore. green fruit yield per plant (7. Agriculture College. 1). fruit length. more number of hybrids which were based on sterile cytoplasm expressed significant sca effects in the desired direction compared to hybrids based on their fertile counterparts for days to flowering (18. plant height (14 8) plant spread (7. Significant mean sum of squares due to interaction between cytoplasm and male lines for all the traits studied was indicative of interaction of cytoplasm and the nucleus in the inheritance of these traits. S.5) and red fruit weight per plant (12. Information on the relative importance of general and specific combining abilities are also helpful in the analysis and interpretation of the genetic basis of important traits. three crosses (YRT-3xPR-15. on the basis of sca effects. Brassica juncea. Brassica napus. RLM-198xYRT-3. oil content and protein content were conducted with 9 parental diallel excluding reciprocals. parents KRV-tall and RLM-198 for seed yield/plant. It has higher yield potential and is suitable for sole cropping as well as intercropping.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era COMBINING ABILITY STUDIES FOR QUALITY TRAITS IN INDIAN MUSTARD Mahak Singh1 and R. undertaken to gather such informations in Indian mustard regarding seed yield and its component traits. PR-15 and varuna for oil content and KR-5610 and RLM-198 for protein content were found good general combiners.Azad University of Agriculture & Technology Kanpur. out of 36 crosses only eight crosses (KR5610xPR-15. 36 F’IS. Among the different state. RLM198. KR-5610. Department of Genetics and Plant Breeding. C. YRT-3. Two crosses (YRT-3xPR-15 and Varuna x YRT-3) for 1000-seed weight.. KRV-tallxT6342. KRV-Tall. Varuna. YRT-3. KR-1467. 36Ff2 s and 9 parents viz. 1000 seed weight.K. Brassica campestris. On the basis of gca effects. The mustard oil is preferred in the kitchen in entire northern belt of the country. General combining ability and specific combining ability variances were highly significant for almost all the traits. T6342. Varuna. There are several species of rape seed-mustard viz. Kalyanpur 1. Not only oil but fat free meal is an important source of protein.07 million tonnes. Kanpur. Uttar Pradesh is one of the leading state covering an area of 1. Genetical studies on seed yield/ plant. T-6342. VarunaxYRT-3. The present study was therefore. The above study suggested that these lines/crosses can be successfully utilized for improving particular traits in Indian mustard.208 002 (UP) 256 . RK1467xT6342 and Varunax RLM 198) for oil content and only one cross (KR5610 x PR-15) for protein content were the best crosses on the basis of specific combining ability effects. KRV-tall. Fat free meal is an important ingredient not only for internal consumption but also a good source of protein for export and earning of foreign exchange.S.12 million hectares with the production of 1.Dixit ABSTRACT Indian mustard (Brassica juncea) is an important oilseed crop and important source of edible oil in the country. selection of parents plays a crucial role and combining ability analysis serves as a very handy tool for the selection of parents.) Czern and Coss] namely. KRV-tall and PR-15 for 1000 seed weight. Introduction Rapeseed-mustard are important oil seeds crops and are next to groundnut in the country. RK1467. RC781 and PR-15 were evaluated in Randomized Complete Block Design with three replications at Oilseed Research Farm. In planning of an efficient breeding programme in any crop. Brassica carinata and Brassica nigra but Indian mustard [Brassica juncea (L. RLM198. KRV-tall. However. Varuna. RK1467x T6342. The F1’s were grown at Oilseed Research Farm. Materials and Methods Nine strains of Indian mustard [Brassica juncea (L. Kalyanpur. Varuna x RLM-198 and KR5610xKRV-tall) were significant for seed yield/plant. KR5610.) Czern and Coss] is widely cultivated. RC-781 and PR-15 were crossed in a diallel fashion (excluding reciprocal crosses) to obtain 36 F1 hybrids. YRT-3xPR-15. e. Data were recorded on 5 competitive plants in each of parents and F1s and 20 plants in F2’s for each replication selected at random in all the three replications. 9 parents. length of main raceme. Parents RC-781. and protein content analysis was done in cake. The parents were maintained by selfing. The results are presented in Table-1. on the basis of gca effects in F1 and F2 generations are presented in table 3. Parents Varuna. All treatments were given equal doses of fertilizers @ 80 kg N. The oil was removed and residue left was taken for protein analysis. KRV-Tall and PR-15 for 1000-seed weight and . Recommended agronomic practices were followed for raising a good crop.R. method IV used for diallel analysis. The average degree of dominance expressed as (s 2 s/s 2 g) suggested over dominance for all the traits in both the generations except primary branches and yield per plant in both the generations and protein content in F1 which indicated no dominance. RLM-198.M. General combining ability is primarily a function of additive gene action and additive x additive inter action whereas specific combining ability is due to non-allelic gene interaction. 40 kg P2O5 and 40 kg K2O per hectare with two irrigations. Based on this. The parents and F1s were grown in one row and F2’s in four rows of fivemeter length and 45 cm apart and 15 cm distance from plant to plants within a row was maintained by thinning. It is revealed from the table that the parents which had good per se performance were also good general combiners for yield and its main yield components. RC-781 for number of siliquae on main raceme. at physiological maturity. Ranking of desirable parents in order of merit. Results and Discussion Combining ability studies help in selection of best combiners and provide opportunity for the use of these combiners in hybridization programme.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era of C. promising combiners for earlines are YRT-3 and KRV-Tall and for dwarfhess PR-15 and Varuna as they had desirable gca effects. RC-781 for secondary branches. The findings were in conformity with findings of Singh and Srivastava (1986) and Jain et al.Azad University of Agriculture and Technology. KRV-Tall and RLM-198 for yield per plant appeared to be good general combiners. (1988). The protein analysis was done by biuret method of Williams (1961). Days to maturity were recorded by counting the days from seedling to turning of the plant yellowish i. RC-781. 36 Ffs and 36 F2’s were grown in a randomized complete block design with three replications in rabi. The ratio of s2g/s2s were less than unity for all the characters in both the generations except for number of secondary branches. number of siliquae on main raceme and oil content in F1 generation.S. Data were analyzed for randomized complete block design and mean squares due to general combining ability (GCA) and specific combining ability (SCA) was calculated by Griffing’s (1956) model I. Varuna and PR-15 for primary branches. Kanpur to obtain F2 progenies. Spraying of Ekatin and Dithane M-45 was done for protecting the crop from aphids and Alternaria blight respectively. The analysis of variance for general combining ability 257 was found significant for all the characters in both the generations except 1000-seed weight in F2 generation. The experimental material comprising eightyone viz. General Combining Ability The estimate of gca effects of the parents for all the characters are presented in table 2. The estimate of variance due to gca and sca indicated that magnitude of s2s was higher than s2g for all the traits in both the generation. RK-1467 and KR 5610 for length of main raceme. The yield per plant was found to be controlled by non-additive gene effects. PR-15 and T-6342 for early maturity.. The oil content was estimated by N. The findings were in conformity with findings of Dixit et al (1983). Therefore. RK-1467 x T. It is obvious from the data that the ranking of crosses based on the mean performance and sca effects was not always . Hence.6342. eight best crosses were composited to form a new heterotic group for grain yield. RLM-198 x YRT-3. RLM-198 x YRT-3. Keeping these facts in view. YRT-3 x PR-15.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era KRV-Tall. YRT-3 x PR-15. these crosses are expected to throw transgressive segregants in the later generations. high sca effects of crosses alone will not lead to much improvement unless it is coupled with high per se performance. However. 6342. The reciprocal recurrent selection will be most suitable breeding procedure for mopping up the desirable additive gene actions through selection of desirable segregants. 1972). Poor inbred parents although lacked the additive effects of the good inbred yet they were highly responsible to heterozygosity in the way of non-additive effects (Darrah and Hallauer. In general. RK-1467 x T. Breeding methods such as biparental mating followed by reciprocal recurrent selection may increase frequency of genetic recombination and hasten the rate of genetic improvement. Varuna x RLM-198 and KR-5610 x KRV-Tall) apart from having high sca effects and per se performance for various yield components also had both the parents as good general combiners. The specific combining ability is the important parameter for judging the specific combinations for exploiting it through heterosis breeding. Therefore. selection of crosses for further breeding programme may be based on higher values of both of these parameters. Formation of a new heterotic group It has now become established that there is a good association between sca effects and mean performance of crosses. The good and promising cross combiners for seed yield are presented in table 5. Specific Combining Ability Effects The estimates of sca effects of crosses for all the characters are presented in table 4. Crosses involving high x high and high x low combiners may give rise transgressive segregants in the next generation (Langhum. PR-15 and Varuna for oil content were most desirable combiners in both the generations. In the present investigation crosses (KR 5610 x PR-15. These crosses involved all the three possible combinations between the parents of high and low gca effects i. KR 5610 and RLM-198 are good combiners for protein content. From practical point of view. Thakral and Singh (1995) and Sachan et al. A perusal of the table indicated that out of 36 crosses only eight crosses KR-5610 x PR-15.e. Varuna x YRT-3. for harnessing the maximum yield potential. (1996). high x high. Varuna x RLM198 and KR-5610 x KRV-Tall had desirable specific combining ability effects for yield and the same crosses had desirable sca effects in F2 generation also. However.6243. These lines may be utilized for producing the intermating population in order to get desirable recombinants of Indian mustard. 1961). a certain degree of heterozygosity should be maintained in the population. These lines can be successfully utilized for improving particular characters for which improvement is desired because these parents had high general combining ability effects and thus has fixable components of variance like additive and additive x additive epitasis. a few crosses appeared to have high mean value but non-significant sca effects and vice-versa. high x low and low x low. Varuna x YRT-3. KRV-Tall x T. T-6342. Mass selection with concurrent random mating would be another breeding methodology for breaking the bottle neck of seed and oil yield in Indian mustard. Varuna. KRV-Tall x T-6342. additive and nonadditive type of gene action were predominant 258 in the population for all the traits. 53 : 776-778.K. Tiwari. This new group of crosses justifies the development of commercial hybrids in Indian mustard. Biol. 276-378. Jain.R. The determination of protein in whole wheat meal and flour by the biuret procedure.N. Genetic effect estimates from generation mean in four diallel set of maize in breeds. A. 12 : 615-621.K. Food.A. Crop Sci. Sachan. Dixit. Sci. 12: 74-82. J. CD. P. Combining ability for yield components and oil content over saline environment in Indian mustard.. Williams. B. Concept of general and specific combing ability in relation to diallel crossing systems.S. and Srivastava. (1996). Sci. Indian J. Kushwaha. Crop Sci. 48: 117-119.12: 59-60. (1995). Genetics of Quantitative traits in Indian mustard. and Hallauer.J. 1 : 52-57. A. (1988). Singh. J. J.N.Farm Sci. N.P. however. 259 .C. R. R. Sci. and Hirve. (1961). D. Srivastava.6: 31-35. K.. Combining ability studies in Indian rapeseed. 9 : 463-493. V. A. there was a significant association between these two criteria of ranking. Thakral. In order to exploit hybrid vigour at commercial level attempts should be made to convert high heterotic parents into cytoplasmic male sterile lines and search for fertility restorer lines in the germplasm to develop mustard hybrids. (1956).L. Genet. (1972). (1983). H. (1986). and Singh. Combining ability for yield and its components in Indian mustard. Indian J.C. REFERENCES Darrah. and Srivastava. Farm Sci. S.K. and Singh.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era the same.Oilseeds Res. Agric.N. Langhum. (1961). ‘ Griffing. Australian J. A. Combining ability for quality character in Indian mustard.S. Agric. P.N. The high-low method of improvement. A. L. Prasad. 43 7.52 0.54** 7.20 0.f GeneDays Plant ration to flowering height Second National Plant Breeding Congress 2006 gca 88 sca 36 Error 88 260 V2g V2s (V2gs/V2gf5 F1 F2 F1 F2 F1 F2 F1 F2 F1 F2 F1 F2 7.16 0.83** 0.39 0.01 8. Primary Secondary branches branches Length of main raceme No.22 3.39 7.90** 0.00 0.36 0.01 0. ANOVA for combining ability for eleven characters in a 9 parent diallel in [Brassica juncea (L.20** 45.32 0.13 0.18 0.41 7.40** 0.11 7.00 2.24** 7.71 Plant Breeding in Post Genomics Era * significant at 5 per cent level ** significant at 1 per cent level .45 0.51** 5.42 5.92 17.18** 8.02 0.94** 16.66** 0.66** 1.76 2.37 0.74** 57.78 * 3.58** 0.08 2.00 0.00 0.12 0.01 10.56** 8.28 0.21 0.23** 5.62 6.81** 3.92 18.62** 10.15** 0.86 8.17 4.46 19.18** 11.68* 0.11 1.88 0.03 0.49 6.91 0.01 0.07 0.21** 35.23** 0.55 5.24 2.14 0.60 10.70** 0.90 4.51 0.12 0.00** 39.44 0.07 0.60 0.12 6.00 0.54 1.55 3.01 0.58** 6.93 0.23 2.84 35.87** 18.99 1.Table 1.62 14.11 0.13** 5.21 0.45 0.40 0.10 5.65 4.74 6.27** 7.17** 0.) Czern and Coss].23 0.11 0.61* 1.33** 0.25 0.99 5.14 0.20 0.00 9.29** 0.79** 14.32** 12.43 0.47 0.19** 0.17 0.56 38. of siliquaon main raceme Days to maturity Yield/ plant 1000-seed Oil weight content in (g) (%) Protein content (%) Source of variation d.14 7.00 6.18 15.24 3.06 0.32** 0.94** 0.61 8.01 0.79 1.87** 15.13 0.83** 2.19 4.02 0. 21 0.05** 1.60 KR-5610 1.17 0.04" -1.12 — — -0.14** 0.17" 0.75" 0.11 0.07 0.17" -0.69** YRT-3 -0.79" -2.35 0.15** -0.05 0.19** -0.75* 0.07 0.20" 0.11 — — — — — — -0.24 028 -0.05" 1.37* 0.14 1.35*” 0.52** 1.23 — — 028* — — — — F1 F2 F1 VARUNA 0.74" 0.01 002 0.22" 0.09 0.03 0.84** -0.12" -0.41 0.31" -0.76" -0.59" — -0.23 0.02 — — — -0.34 — -0.28** 2.16 0.45" -0.44" T-6342 -0.04 0.98** 0.71" -0 08 -2.62" -0.11 0.14** -0.49** -0.04 — — 0.15" -0.05 2.07 -1.01 -1.07 -0 88" -0.33" -0.88** -0.07" — -0.51** 0.03 -0.30 * significant at 5 per cent level Plant Breeding in Post Genomics Era ** significant at 1 per cent level .22** 1. Estimates of gca effects of parents for eleven characters in a 9 parent diallel cross in [Brassica juncea (L.34 0.67"* KRV-Tall -0.85** -0.00" 0.02 0.40"* 1.04** -1.28" 1.14** 261 RtM-198 0.72" 0.16 0.09 0.21"* -1.88** 1.80** 0.20 SE (gi-gj) 0.12 0.26 -0.14" .12 1.00" PR-15 -1.51 -0.68 1.00** -0.0.15" SE (gi) 0.69** -0.26 0.05 2.04 0.12" 0.29" 0.11 — — F2 F1 F2 Fraceme2.09** 1.28" -0.08 0. Primary branches F1 1 2 Parents Days to flowering F2 0.30 0.03** -1.02 -0.17 0.25 -0.34 -0.23 0.51 — — 0.05" -0.40" R.17 0.05 -0.1 1** 1.33 0.36* -1.07 0.15 -0.54" 1.88 0.06 0.12 0.64"* -1.79" 1.25 0.40** — — 0.32" 0.06 0.71" — 0.19 0.28 0.21" 0.16 0.30 CDat l% 0.01 -0.08" 1.Table 2.30" 0.17 -0.17 — — — 0.01 — — -0.32** -0. F 1 F1 F2 F1 F2 F1 F2 F1 Plant height main raceme F F F2 0.C-781 -0.17" — -0.09" -0.06 0.95** -1.) Czern and Coss].72" -1.53" 1.0 78** 0.14" 0.26" — — 0.06 0.12** -2.24 0.20*’ -0.38** -0.45 0.57" 1.31 0.18 0.07 0.74** 0.51 CD at 5% 0.45** 0.20 0.05** -1.36" — — 002 — — — — Secondary branches Length of main No.05 -0.10 0.15 — — -0.02** -1 18** 2.32" 0.19** -0.22** -0.17 -0.18** -0.99** 0.17 Second National Plant Breeding Congress 2006 RK-1467 0.15 0.46 0.42** -0.10 0.10" 0.54" -2. of siliqua on Days to maturity Yield/plant 1000-seed weight Oil content (%) F1 Protein content F2 0.10" -0.17" .76" — — 0 15 0.32** -1.68** -4.22 -0.36*” 006 -0.19** -0.18*”” 0.71" 0.40" 0.03 -1.65** 0.43 0.19 0.04** 2.14" -0.62" -0.01 0.12 0.10 0.02 1.49" -0.33** 0.62" -0.33" — — — — 0.15 4.05 0.56" 1.16 0.30 -2.49** 0.|0 0.16* 0.28 0.96" -1.19" -0.18 -0.03 — — 0. 46 53.90 166.13 164. Ranking of desirable parents in order of merit.93 3. F2 and in both F1 and F2 F1 F2 In both F1 & F2 Days to flowering PR-15 RC781 YRT-3 KRV-Tall T-6342 PR 15 Varuna T6342 RLM198 KRVTall RK1467 RC781 Varuna PR-15 YRT3 RK 1467 RC781 Varuna RLM 198 YRT3 RC781R K1467 KR5610 YRT3 Varuna RC781R K1467 KR5610 Varuna T6342 Varuna KR5610 T6342 RLM 198 PR 15 RK1467 KRVTall YRT3 Varuna PR 15 PR-15 Varuna RK1467 KR5610 YRT-3 KR5610 RC781 Varuna PR-15 KRV-Tall RK 1467 RC781 KR5610 KRVTall PR 15 RK 1467 RC781 KR5610 KRV-Tall PR 15 KR5610 RK781 RK 1467 PR-15 KRV-Tall RLM 198 T6342 YRT3 PR 15 RC781 RK1467 RC 781 KRV Tall Varuna YRT3 PR 15 T6342 Varuna KRV-Tall YRT3 Varuna KR5610 RC781 PR-15 YRT3 KR5610 PR 15 RLM 198 KRVTall RC781 KRV-Tall PR-15 YRT-3 KR5610 RK1467 PR 15 KRV-Tall Varuna T6342 RC781 T6342 RLM 198 YRT3 PR 15 KR5610 59.43 33.80 60.36 53.23 30.66 127.90 121.86 63. on the basis of gca effects in F1 and F2 generations for eleven characters in a 9 x 9diallel cross of [Brassica juncea (L.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 3.76 55. Characters Best parents based on Best parents based on per se performanceon gca effects F1 F2 F1 F2 Best common parents in F1.23 59.00 262 RC781 YRT3 KRV-Tall RK1467 KRVTall YRT3 Varuna YRT3 KRVTall Plant height (cm) PR-15 T6342 Varuna KRV-Tall P7R-15 Varuna YRT-3 PR-15 Varuna Number of primary branches RC781 Varuna PR-15 YRT3 KR5610 RC781 Varuna PR-15 RC781 Varuna PR-15 Number of secondary branches RC781 RLM 198 RC781 KR5610 KRVTall PR-15 RC781 Length of main raceme (cm) RK 1467 KR5610 YRT3 RK 1467 KR5610 KRVTall PR 15 RK1467 KR5610 Number of siliquae on main raceme RC781 Varuna T6342 RC781PR 15KRVTall RC781 Days to maturity RLM 198 PR-15 T6342 RLM 198 R6342 YRT3 PR 15 RLM 198 PR 15 T6342 .66 29.60 12.80 165.56 0.93 152.76 29.46 63.06 4.) Czern and Coss].86 56.53 10.10 10.50 12.33 3.30 4.26 10.90 30.66 125.90 4.50 172.33 121.66 123. 36 2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Characters Best parents based Best parents based on per se performanceon on gca effects F1 F2 KRV Tall RC781 RK 1467 RLM 198 Varuna KRV Tall Varuna RL ml98 RK 1467 PR 15 Varuna KR5610 KRV-Tall T6342 PR 15 T6342 PR 15 RLM 198 KR5610 Varuna F1 Varuna PR 15 RLM 198 RC7 81 KRV Tall PR 15 RLM 198 KR5610 KRV-TaU Varuna PR 15 T6342 KRV Tall KR5610 Varuna RC781 Varuna PR 15 KR5610 RLM 198 F2 9.93 40.36 9.40 31.43 3.73 3.5610 KRV-Tall T6342 PR-15 PR-15 RLM 198 KR5610 Varuna KRV-Tall T6342 PR15 Varuna KR5610 Varuna KR5610 RLM 198 Protein content (%) 263 . F2 and in both F1 and F2 F1 RC 781 KRV Tall RLM 198 PR 15 F2 KRV Tall RC 781 RLM 198 Varuna In both F1 & F 2 RC 781 KRV Tall RLM 198 Yield per plant (g) RK 1467 RC781 PR 15 KRV Tall RLM 198 Varuna KR 5610 KRV Tall RK 1467 PR 15 KRV Tall T6342 Varuna PR 15 KR5610 Varuna T 6342 KR5610 RC781 RLM 198 1000-seed weight (g) Varuna KR 5610 KRV Tall PR-15 KRV Tall Varuna RLM 198 PR-15 Varuna KRV-TaU PR-15 Oil content (%) KRV-TaU T6342 PR-15 Varuna KR5610 Varuna KR5610 RC781 RLM 198 Varuna KR.50 32.80 3.36 11.93 39.63 14.16 40.20 32.60 32.76 38.70 3.80 Best common parents in F1.20 40.56 32.26 14. 26 0.62" 0.26 -2.80* 2.38** 6.10** 2.29 0.23" 0.30** -1.67" 0.54" 1.01 0.88" -3.75" -0.17** 0.07** 0.87"* -3.77** -0.72** 0.01 0.15** -1.49 -3.86" 0.30" -3.65" -1.18* -0.58 0.93" 0.38 -0.24* 0.71 9.39 -0.21 0.48 0.78" 2.71** -0.10 -0.92 3.86" -0.37** 1.68" -0.01 -0.41 0.69** -1.21 -0.42 .22** 2.81" 3.59"* Varuna xRLM 198 -0.34* 1.11" -4.70** 2.53** -0.69" -0.88** -3.55** 1.13 -0.29* -2.25" -0.58 1.53 2.75"* 4.11" 2.39 0.78" -3.30 -0.23" -0.41 0.44" VarunaxT-6342 1.47** -1.14 4.44** 1.19* -0.20 -1.05 0.23" 0.09 1.46 9.39 0.97" -3.14* -0.26" 0.21" -0.15 2.35" 0.01" -0.71" KR5610xPR-l5 1.22" 2.05 0.09 -0.68" -0.29** 0.26" 1.46 -1.90" -2.39 -0.76** -0.27 -1.34** 0.10 -1.12" -0.13" 0.30 -0.26 0.16* 0.86** 1.46 -0.83" -2.16" 0.24 -0.55* KR56IOxRK-l467 -3.40" 3.00" 0.00** -2.78" -0.72" -1.39" 2.42** 0.04 0.90** -1.89** 3.27 -0.30" KR5610xT-6342 -1.26 -0.90" 1.25 0.02 -0.31 0.50* 0.98" -1.06" 3.89" 2.83** -1.30** 0.45 0.41"* -6.65* 0.61" 264 0.17 0.18* 3.12** 1.92" -2.03 0.45** 0.64* -0.88 3.18** -1.62" -2.97" 3.46" 2.26" 2.56 2.74** 1.92" 4.76* 5.07 5.80** 1.16 0.83** -3.61 3.95" -0.41** -6.30 6.22 6.73** 1.29** 0.23 0.18 -0.16 0.91** -0.46* -0.54 -0.24 1.41** -0.03" 0.06" 1.96" 5.15 -0.40 0. Estimates of sca effects of parents for eleven characters in a 9parent-diallel cross in [Brassica jundea (L.43" RKI467xT-6342 4.49 -0.75" -2.31 -0.08 0.54 1.08 -0.04" 1.91" -4.06 0.64** -0.37** 0.61** Varuna xRK-1467 4.94** 3.78" 0.77 0.17** 0.33** 0.65 0.06* 0.05 -2.51" -0.29** 2. -2.87** -0.80 1..31" -1.46" -0.16 0.13" 3.78" 1.52 2.02 -2.10" 0.94** 1.27** 2.76** 0.15 -0.60** -0.08 KR5610xRC-781 0.06** -1.54" 5.M-l98 2.42** 0.90** -0.25" 4.11 Varuna xKR 5610 -2.16" -1.01 -0.07 0.07** 0.29* 0.37** 0.74" 2.60" 0.68* Varuna xYRT -3 -3.01" 0.89 1.60" -4.06 -0.95** KR56IOxYRT-3 1.94" Varuna x PR-15 -0.14** -0.05 Varuna x KRV-Tall -1.19" -0.64" -0.93** 1.48" 2.54" -0.41** -2.93** 2.96 -2.60 KR56IOxRLM 198 -1.94 -4.50" 10.07 -0.59** .43 -0.57" -2.33" 0.14" 0.55 -1.80** -1.TabIe 4.69* -0.75* 2.86" 3.10" -9.85* 1.30" 4.42** -2.60** 0.14" 0.39** -0.51" -0.06 -0.95" 1.29" -0.68** 0.43* 6.05 -0.21" 2.) Czern and Coss].13** 1.16 0.54** -5.73** 1.35" 136** -0.46" -4.63** 2.38 0.57** -8.05 0.61* -1.45" 1.46 -1.23 0.75** 1.58" 5.06 0.37" -4.33* -0.38" -2.33" -1.65** 1.26 0.61" 4.26* -0.46** 0.94** 2.53 4.04** -2.45 0.10 -1.15* 1.75" 0.33 -0.25** -2.13" -6.19* Second National Plant Breeding Congress 2006 Varuna x RC 781 3.27* 7.26** -4.76 13.46" 0.35" -1.07 0.19** 0.77" 2.02" -2.23 -0.45" 2.98** 3.85** 0.28" 0.94** -0. 0.23* -1.01" -3.12 0.20 2.30" -2.45" 0.21** -0.45 -0.79** -4.97** 0.10 -0.83 7.19" Plant Breeding in Post Genomics Era RK [467xRl.37* -3.30** 0.12** -4.59" 0.74" -1.75** 1.57 4.73" 8.63" 0.46" -0.40 1.02 0.14" -6.21 — -0.98** -6.29" -1.61** 0.41 -0.69* 0.36" -0.44" -1.41** -0.08 0.45 -5.18 -0.90 -0.82" 0.63** 0.35" -0.14 0.63 0.27** -2.39** -2.48" -1.64 -0.56" 0.01 0.45" -0.16* 2.34" -0.71" -2.53" RK 1467xKRV-Tall 1.48" 3.15" -2.04 0.43 2.96" 4.18* KR5610xKRV-Tall 2.14" -0.62* -1. 52 0.38 0.95** 0.71** 1.98 1.37** 5.17 -1.14" KRV-TallxT6342 -2.01 0.49 0.23 1.05 1.60" -0.15 -1.89" 0.84** -2.20* -0.95* -1.11" -3.77** 0.47 0.30 1.37 0.61" -0.05 RC 781 x PR 15 0.48 0.28* 1.76 Plant Breeding in Post Genomics Era SE (sij-skl) ± 0.15 -1.89 0.35" 0.19* 0.48 -1.15** 2.15** 0.59** 7.34" 0.33" -3.61 0..98 -2.67 1.95** 0.54 0.08 0.72" -0.22 -0.36" -0.80* RKI467xYRT-3 5.01** RLI467xRC-78l 7.21" -0.72" RLM-l98xPR-l5 -2.23 -1.99** 1.99" 0.81" -0.01 3.74 0.95 0.19" -0.23 0.63** 15.47" 1.23 0.31** 1.19** 0.82 2.33 -2.62" -2.16" 1 -0.46 0.74** -0.24 -2.19" 2.02 0.12" -0.11 -0.08" -0.55 -0.06" 2.86** -3.97 0.27 0.18 0.52" -1.50 0.41" -3.23" -0.58" -3.33* -0.52** 0.55" 0.55" 0.05" 5.28 0.12 1.25* YRT 3 x PR 15 -0.72 0.28 -0.09 -0.39** 4.62" 0.55 0.29 2.27" -0.46" KRV-TallxRLM 198 -0.66" -0.49" 0.50 0.54 -1.68" 3.25 -0.35** -5.68 -0.11 0.25" 0.15 2.37" -0.95* -4.19 -0.73** 0.69** RLM 198xYRT-3 0.46 SE (sij-sik) ± 0.17" 3.51" 4.58 0.27" 3.18 -2.63" KRV-TallxPR-15 5.33" 1.10" -0.08" -2.37" -2.42 2.06** -1.30 0.33 -0.10"* -2.19** -0.26* -0.68* 0.56" 0.19 0.03 -0.67— -0.09" 0.18 -0.62** SE (sij) ± 0.68** -0.36 0.32" -4.92 T-6342xRC-78l -2.78" -1.60" 0.64** 10.72** 1.09 0.15 -0.05 -3.08 -3.57 -7.85** 0.16** -1.53** -0.98" 1.87 0.18* 0.22 0.12 -0.29** 1..43** -0.36 -1.17" 13.36" 4.RV-TallxYRT-3 1.45** 0.95 6. T-6342xYRT-3 0.02 -0.92 -0.63 0.35 -0.41** -0.16 -0.49 -0.40** -2.92 1.830.32" -2.20" -0.43 0.01 0.20 0.05 4.15 0.23— -3.05** 0.38 -2.04 -0.58 -2.61 0.12 -1.37" 3.19" -0.64 -0.88" -4.08 -0.72 .93** 0.08 -4.68 -0.08 0.90" T-6342xPR-15 -7.37" -4.14 0.06** 1.22 0.12 -0.07 0.95 0.41" -0.37 -1.49 0.79** 0.89" 265 res1.64 -0.06" -3.35 0.31 0.45 4.89" -0.62" -1.51* -0.18* -0.25** 0.12 0.06" 1.20** -5.61 -1.18" -2.13** 1.43 0.54" 5.48" 1.28** -0.71 0.48 1.43** -4.20 -3.96** 6.36" 0.85" 0.13 1. 0.54** -3.63 1.97** 3.29 0.12" -0.77 0.54** -0.95" Second National Plant Breeding Congress 2006 T-6342xRI.92" -4.14 0.20" 1.Table 4.17 2.63 -8.96" -1.38 0.51 0.81 0.33 1.58** 5.25" 0.08 0.77** -1.35 0.99* -4.88** 3.92** 3.27 0.17" -0.15* 0.76" 6.23— 3.08** -0.23 0.04 -0.75* 0.50" -1.24** 0.78 0.16 -0.88** -0.45 0.50 -0.33 -2.07 1.08*” 0.81" .38** -1.22 0.32** -9.26" -0.42** -0.74 -1.06** 1.36" RLM-l98xRC-78l -5.33 -0.69" -0.44 0.47** 3.26" 0.06" -3.01 -2.58" -0.14 0.36** 0.07 0.66" 1.66" 1.61" 1.79" 2.85* -0.65" 0.87" KRV-TaUxRC-781 -0.68 -0.98" YRT 3 x RC 781 -2.14 2.58** 1.24 1.36** 1.26* -0.21 0.04* -0.96" 3.98" -0.78" 3.28" -0.54 -0.58 0.48 -0.64** -3.45 -0.44** 1.14 -0.55" -0.31* 1.45 1.03 0.49* 1.63" 6.48 -1.30 -0.54" -2.31 0.36 0.29 -0.02 -2.87" -2.19" 1.29— -1.93" -4.30" -0.58 2.07 0.52 2.37 0.66 -5.30 -2.33 0.12 -2.15" -0.03** 0.73** -3.92** -3.40" K.58** -0.82 0.15 0.02 3.94" 2.62"* -0.33 0.30 0.19* 1.07 -0.84 0.11** -0.59" 1.60 -0.40" -0.28 -0.05" -2.77** -1.08 -3.58 -1.37 0.13 0.16 -3.12 -3.89 -0.28** -1.74" 5.58 RXI467XPR-I5 1.33 0.91" -4.34" -0.19 -3.58** -1.16** 0.81" 0.09 0.44" 9.61" -1.53 0.33" -0.91" 2.94 -3.50 1.26 0.35 0.23" -2.83 1.78 -0.09" 1 -0.78" -0.37 -0.77** -0.44" 0.01 0.22 -3.30** 2.73* -0.13** -1.07 0.66 0.97" 0.68 -2.01 0.41 -0.80" 0.06 -0.42 -0.36 0.33 l.52" 0. Contd.14 0.ll” 1.13 0.06 -0.M 198 -7.51 -2.10 -4.55 -2.53" 2.01" -0.46" -1.32 0.75— 0.27** -0.46** 1.37 0. 88** Varuna X RLM 198 1.15** 1.26** 13.72** 1.33** X PR 15 0.34** KR5610 XKRV-Tall 1.39** 3.26 0.28** -0.30 -0.03** 9.86** 13.00 -0.42** RK 1467 X T 6342 -0.06** 4.62** 0.32** 4.79** Second National Plant Breeding Congress 2006 YRT-3 X PR 15 -1.06 KR5610 3. Ranking of desirable crosses based on per se performance.30** 5.43 * significant at 5 per cent level Plant Breeding in Post Genomics Era ** significant at 1 per cent level .02 3.06 13.23** 0.60 -0.22** 13. of Days to 1000-seed siliqua maturity weight on main in(g) raceme gca of P1 gca of P2 Oil Protein content content (%) 0.12** 2.02 -2.06 10.37 0.21** 4.21** KRV-Tall X T 6342 1.10 -0.59** 13.46 -2.TabIe 5.33** 0.57** 0.36** 13.30** 15.26** 6.14 0.94** 2.62 2.37** 9.43 1.61 1.86** 0.90** 2.50 -0.03** 9. sca and gca effects in F1 generation for eleven characters in a 9 x 9 diallel cross of [Brassica juncea (L.33 -0.62** -0.46** Cross sca for yield 0.75** 5.18** 3.42** 0.32** 1.80** 2.41 2.21** 15.23 266 -1.55** RLM 198 X YRT3 1.68** Per se Performance No.29** 1.45** 4.54 1.06 VarunaX YRT-3 1.36** 0.58** -0.06** 5.63 -0.45** -5.26 0.) Days to flowering Plant height Primary Secondary Length of branches branches main raceme 0.42** -3.68** 16.63** -0. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era . Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TECHNICAL SESSION V IN VITRO BREEDING TOOLS IN GENETIC ENHANCEMENT OF CROPS . 3 . C. All the single copy lines. chitinase (PR-3) and b-1. Madurai 625021 267 .3-glucanase. Five T0 plants carried single T-DNA copies. A major limitation in the management of sheath blight disease is the lack of complete resistance in the known cultivars of rice. one had a head-to-head dimer and the remaining two had complex integration patterns. which were made homozygous.3-glucanase (PR-2) are efficient in the lysis of chitin and glucan polymers in the fungal cell wall.. one had two linked TDNA copies and a long-transfer event. Nine transgenic rice plants harbouring both the chitinase and b-1. two T1 plants of T0 line 57 (a head-to-head dimer) expressed chitinase constitutively but showed silencing of the b-1. Northern and western analysis of T1 plants of single copy lines showed constitutive expression and accumulation of chitinase and b-1. School of Biotechnology. Many plant genetic engineering efforts to develop fungal resistance involve PR (pathogenesis-related) protein genes.GLUCANASE GENERATES HIGH LEVELS OF SHEATH BLIGHT RESISTANCE IN HOMOZYGOUS TRANSGENIC RICE LINES Sridevi. Interestingly. 1. By combining the genetic analysis by segregation and molecular analysis by semi-quantitative Southern hybridization. Seven T0 lines showed a segregation pattern of 3:1. Madurai Kamaraj University. Veluthambi ABSTRACT Sheath blight disease caused by Rhizoctonia solani is the second major fungal disease in rice next to blast. Agrobacterium-mediated transformation of rice was performed using a binary vector (pNSP3). Among the PR proteins. G1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era COMBINED EXPRESSION OF CHITINASE AND Â-1.3-glucanase gene under CaMV 35S promoter. Parmeswari. a method was developed to achieve genetic separation of two unlinked transgenic loci and to identify homozygous transgenic lines in the T1 generation. showed 10-fold higher chitinase enzyme activity as compared to nontransgenic control rice plants. N. Sabapathy and K.3-glucanase genes were generated. Bioassay of homozygous T2 plants of three single copy transgenic lines against Rhizoctonia solani revealed a 60% reduction of sheath blight disease index.3-glucanase gene. harbouring rice chitinase (chi11) gene under maize ubiquitin promoter and tobacco b-1. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TRANSFORMATION OF THREE ANTIOXIDANT GENES FROM A HIGHLY SALT TOLERANT GRAY MANGROVE. These results reveal the importance of these three genes in abiotic stress responses. We studied the expression of these antioxidant genes in response to different abiotic stress factors like salt. Fer1 showed short-term induction while Sod1 transcript was found to be unaltered in response to NaCI stress.600 113 268 .) IN INDICA RICE Ajay Parida. the antioxidative enzymes (SOD. Chennai . mitochondria and peroxisomes. M. S. Cat1 and Fer1 mRNA levels were induced by iron. Prashanth. The transfer of electrons to molecular oxygen results in the production of reactive oxygen species (ROS). catalase (Cat1) and ferritin (Fer1) from Avicennia marina cDNA library. To investigate the functions of antioxidative enzymes in the abiotic stress responses in a mangrove plant. an osmoticummannitol and direct oxidative stress factor-hydrogen peroxide by mRNA expression analysis. R. Sivaprakash ABSTRACT Salinity is one of the major threats in decreasing crop productivity worldwide.N. A decrease in mRNA levels owas observed for Sod1. iron. (VIER H. It leads to a reduction in photosynthesis and the unused excess light energy results in over-reduction of molecular oxygen. Cat1.S. cytosol. Under high light and CO2 limiting conditions caused by environmental stress like salinity. Cat1 while Fer1 mRNA levels remained unaltered with osmotic stress treatment. and light stress. light stress and by direct H2O2 stress treatment. All the three genes have been cloned in binary constructs for transformation in indica rice using Agrobacterium and particle bombardment methods M. CAT and FER) play an important role in scavenging toxic radicals in different organelles of the plant such as chloroplasts. we isolated three cDNAs encoding cytosolic Cu/Zn SOD (Sod1). Sod1.Swaminathan Research Foundation. AVICENNIA MARINA FORSK. Jithesh and KR. Institute of Agri Biotechnology.0.S. This protocol can be further used to transfer many other useful genes in pigeonpea for genetic improvement.2.0. diseases and weeds. UAS Dharwad –580005 Coffee Board CRS.05.01.69 shoots per explant. Among different levels of cytokinin. Millsp) is one of the major grain legumes of tropics and subtropics.0. Agrobacterium strain EHA105 harboring pBIN bt1 plasmid with nptII as selectable marker.Kuruvinshetti ABSTRACT The present study was undertaken to standardize in vitro plant regeneration and Agrobacterium mediated transformation procedure for pigeonpea (Cajanus cajan L.N1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era IN VITRO GENETIC TRANSFORMATION FOR THE HELICOVERPA RESISTANCE USING CRY1 A(B) IN PIGEON PEA ( CAJANUS CAJAN L. where it provides a large proportion of the dietary protein requirements. Rooted plants were transferred to pots for acclimatization in the green house before sending to field . Elongation of shoot buds was achieved at reduced level of the cytokinins and among all the cytokinins tested TDZ (0. 1. and average of 3. CV MARUTI) Sandhyarani. Pigeonpea cv ICPL 8863 (Maruti). it is grown in an area of 4.2 lakh tonnes.05 mg/l) showed better response. compared to the overall productivity of Karnataka state (494 kg/ha) and the country (500 kg/ha).67 lakh hectares with a production of 0. Nutritionally they are richer in proteins than cereals. Introduction The importance of the grain legume is multipurpose as source of protein for both human and animal consumption.2 mg/l gave the good healthy roots. These were cultured on various levels of benzyl amino purine (BAP) viz.. it is grown in an area of 1. which confers kanamycin resistance was used. BAP 2 mg/l was found to be better for the multiple shoot and shoot bud induction .4 lakh hectares with a production of 2. PCR with nptII specific primer revealed that approx. especially in Gulbarga. In Karnataka. Inhibitory levels at different stages were used for selection of the transformants. The lower productivity of pigeonpea is mainly because of wilt disease and pod borer damage by lepidopteran insect Helicoverpa armigera which causes yield 1. In the northern part of Karnataka. 1.3 and 4 mg/l and thidiazuron (TDZ) 0. For transformation. However in Gulbarga so called redgram bowl of Karnataka. a popular variety of Karnataka is of medium duration and wilt resistant.CCRI. A direct regeneration protocol was employed using cotyledonary node (CN).Chikmagalur dist-577117 ssnishani@rediffmail. CNC was found to produce highest average of 1. 1999). pigeonpea or redgram production is threatened by many insects.57 lakh tonnes and an average productivity of 359 kg ha-1 which is very low (Singhal. However. Sumangala Bhat and M.5 mg/l. but highly susceptible to pod borer. half cotyledon with cotyledonary node (1/2 CNC) and cotyledon with cotyledonary node (CNC). cv Maruti). Initially kanamycin sensitivity of the control explants was tested at different growth stages. It also improves soil fertility by fixing atmospheric nitrogen. it is grown as a commercial crop. Sufficiently elongated shoots were rooted on the half strength of MS medium with various levels of IBA of which 0.4% transformants were obtained. Pigeonpea popularly known as redgram ( Cajanus cajan L.1.com 269 .5 buds per explant. Mukund Shiragur. Precultivation of the explants on MS with 2 mg/l BAP for two days prior to cocultivation resulted in increased transformation frequency. The seed germination medium consisted of half strength of mineral salts and vitamins of Murashige and Skoog (1962). 0.0. Because of its usefulness for human and animal consumption in Karnataka. High frequency in vitro regeneration compatible with gene delivery is a prerequisite for genetic transformation. 1984) for statistical analysis and analysed as factorial experiment.4. 1978). As in vitro regeneration in pigeonpea is highly genotype dependent . followed by 0. Shoots and shoot buds were subcultured on medium with lower levels of cytokinins for shoot elongation.6 to 63. Significance was determined by analysis of variance (ANOVA) using the randomized block design. 0. The seeds were surface sterilized in 70% ethanol. 1962) containing 3% sucrose.Bombay) and supplemented with either 6-benzyl amino purine (BAP) (1.0.1. 270 The culture medium used for direct shoot organogenesis consisted of MS basal medium (Murashige and Skoog. Attempts to obtain pest resistant genotypes of pigeonpea species by conventional breeding methods have not been successful because of the limited available genetic variation among cultivated species and presence of incompatibility with wild . Data given in percentages were subjected to arcsine(sin –1 p) transformation (Gomez and Gomez.7 supplementsd with 2 mg/l 6benzylaminopurine (BAP). India.6 per cent (Anon. 1997). 0. To promote rooting.. an attempt has been made to induce shoot buds and regeneration of complete plants from different explants of pigeon pea cv ICPL 8863 ( Maruti) and a genetic transformation protocol is described. cotyledonary nodes(CN).0mg /l) or Thidiazuron (TDZ)(0.1% aqueous mercuric chloride solution for 10 min and then rinsed five times with sterile distilled water.05. we were interested in biotechnological methods to improve this important variety.5 mg/l) at various concentrations .cm) for 15-20 min. Materials and methods Plant material Uniform seeds of pigeonpea cv ICPL-8863 (Maruti) were obtained from National seed project and Breeders Seed Project BSP. All media were adjusted to pH 5. Dharwad.0.5 mg /l. 1990). cotyledonary node with cotyledon (CNC) cotyledonary node with half cotyledon (1/2 CNC) were used as explants for regeneration. All the cultures were incubated at 25_+ 20 C with light intensity of ca 1000 lux provided by fluorescent tubes ( 7200 0 K) over a light/dark cycle of 16/8 hours.1 and 0.2.8% agar and supplemented with either naphthalene acetic acid (NAA) or Indole butyric acid (IBA) at 0.9 % agar (Hi media.9% agar pH 5.. Bacterial strain and vector The disarmed and hyper virulent .NSP unit University Of Agricultural Sciences. excised shoots were cultured on MS and half strength MS medium with 3% sucrose. pest resistant species ( Nene et al. Seeds were germinated in dark for six days.0. Karnataka. Each regeneration treatment had 20 replications and each replication with 2 cultures were arranged in a completely randomized block design. Differences between means were compared by Duncan’s multiple range test using MSTAT-C computer program (Michigan State University).0. With the advent of the genetic engineering techniques . they were cultured in test tubes/ culture bottles containing germination medium. Explants obtained with ½ MS with or without 2mg / l BAP were used in studies on shoot regeneration for 30 days. Thereafter. it is now possible to transfer the useful genes across species (Nayak et al. Shoot apices (ST).7 before autoclaving at 1210C (1kg/sq.01.0.3. 0. 3% sucrose and 0.2 and 0. Observations on cultures showing regeneration and number of shoot buds and shoots per responding culture were recorded after 3 weeks at each sub culture.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era losses to the extent of 46. This construct contains the cry1A(b) gene linked to the cauliflower mosaic virus (CaMV) 35 S promoter. 1989) To test the integration of npt II) gene in transformed plants. 100mM dNTP mix . and plant DNA was extracted according to Edwards et al.. explants were regenerated and shoots were transferred to selection medium after thorough washing with MS broth along with 100 mg l-1 kanamycin and cefotaxime ( 300 mg/l) and blotting with sterile blotting paper. 1993) harboring binary vector pBinBt1 was used for transformation experiments. Further. 25. Forward 51 GAG GCT ATT CGG CTA TGA CTG 31Reverse 51 ATC GGG AGG GGC GAT ACC GTA 31. experiment was conducted at 100 mg l-1. England). 75 and 100 mg l-1 concentration and lethal dosage was identified at different growth stages. PCR amplification of npt II gene was carried out using specific primers. Confirmation of the transformants using specific PCR To confirm the transformation. pAOcs terminator and neomycin phosphotransferase (npt II) gene under the control of nopaline synthase (nos) promoter and terminator. Six to eight days old seedlings were taken from in vitro germinated seeds for explant preparation. PCR was performed in 25 mL solution mix containing Taq pol 1U . (1999). 3.e. Single Agrobacterium colony was taken from the LB plate and inoculated into 100 ml LB liquid medium containing 100 mg l-1 kanamycin and was incubated on shaker for 48 hrs at 280Cand at 200rpm( Sambrook et al. 2. DNA was quantified using saranwrap method of quantification ( Sambrook et al. (1991).1989) and fresh culture was used for transformation. After cocultivation. 50ng of the template DNA in a Hybaid omn-E thermal cycler according to Geetha et al. 300 mg l-1 and 400 mg l1 cefotaxime along with control. (1989). plasmid DNA was extracted according to Sambrook et al. Cotyledonary nodes with cotyledon (CNC) were put on regeneration medium for preculturing for two days. Injury was made near the place of bud formation with a sterile scalpel blade and the following protocol was followed...2 per cent agarose gel using 1 x TAE buffer and amplified products were photographed using gel documentation system (UVI-Tec Cambridge. The resistant shoots obtained were separated and transferred individually to rooting medium (MS+0. 50. Separation of amplified products was done on 1.. Results and Discussion Regeneration Pulses in general are recalcitrant to regeneration under in vitro conditions and .1).2 mg l-1 IBA + 25 mg l-1 kanamycin).. The explants were taken out of bacterial suspension and 271 excess bacteria were blotted dry using sterile blotting paper. Precultured explants were immersed in Agrobacterium suspension for 15 minutes with gentle shaking. 1XTaq assay buffer.The Agrobacterium EHA 105 containing pBinBt1 culture was maintained on solid MSY medium containing 100 mg l-1 of kanamycin. and 4 in dark for cocultivation.3 M of each forward and reverse primer. to know the minimum level of cefotaxime that will completely eliminate the excess bacteria after cocultivation.. 0. Explants were placed on regeneration medium for different days i. 1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Agrobacterium tumefaciens strain EHA 105 (Hood et al. 200 mg l-1. npt II was used as a selectable marker (Fig. Transformation Kanamycin sensitivity test was carried out to find out the concentration of kanamycin required to be used for the selection of the transformed plants and was carried at 0. Subculturing was done at every 15 days on same medium to avoid escapes. Cocultivation was done just before the formation of shoot buds. A limited elongation and development of the shoot apex was observed and subsequently many axillary buds developed on this. both per cent explant responding (100%) and mean number of shoots (3. Bulged nodal region was seen in the later seedlings. when mean number of shoots elongated per explant was considered MS with 0. thick stout stem and bulged node region.47) and at higher levels of BAP. BAP was found to give better response to multiple shoot organogenesis.. Shivaprakash 272 et al.1 mg and 0. When CNC was cultured on MS+2 mg l-1 BAP. Explants derived from seedlings grown on plant growth regulator free medium produced very few shoots. 2mg l-1 BAP induced highest mean number of multiple shoot (1. In the present study. Thus there is a need to develop an efficient regeneration protocol for a given genotype. comparison was made between different levels of BAP and TDZ. MS supplemented with 0. There were no apparent deviations in either the rate or frequency of seed germination attributable to with or without growth regulator.. Superiority of BAP over Kinetin was also demonstrated by Geetha et al. In the present investigation. (1998). In the present investigation. On the other hand when shoot initial were cultured along with cotyledon. (1994) compared the relative effectiveness of cytokinins for multiple shoot formation and the order of effectiveness was BAP> Kinetin> Zeatin>Adenine in pigeonpea.(Fig A.05 mg l-1 TDZ was considered for shoot bud elongation in further experiments (Table2 and Fig e).225) per explants were higher (Table 1 and Fig b. 2001) Pigeonpea seeds germinated within six days and attained the explant extractable stage on both plant growth regulator free and BAP supplemented MS media. 1998).) Thus differences in the germination medium influences multiple shoot production from explants... When explants were detached from BAP treated seedlings and cultured on fresh regeneration medium (MS supplemented with BAP or TDZ) shoots were initiated 15 days after the incubation.05 mg l-1 TDZ was (5.2 mg l-1 BAP was found to be better in terms of per cent explant responding (94%).Geetha et al. In general lower levels of cytokinins in the medium supplemented with auxins enhances shoot elongation (Franklin et al. when shoot initials were cultured without cotyledon on elongation medium. MS medium was found more responsive for rooting (88%) but . Seedlings grown on BAP supplemented media showed poor root development with enlarged cotyledons. Zhong et al.c. Therefore MS+0.05 mg l-1) for shoot elongation. callus was observed at the cut end and shoot elongation was very slow. These findings are in agreement with previous investigations of Shivaprakash et al. Identification of most suitable growth regulator and its concentration is crucical for morphogenesis. This pretreatment with BAP during seed germination is also practiced in micropropagation of sugarbeet cultivars (Grieve et al.2 mg l-1) and 2 levels of TDZ (0.(Data not shown).01 mg and 0. Among the four different levels of BAP. 1997.d). (1994). 1998. However. shoot numbers decrease significantly. However. the growth of the seedlings was significantly altered in the presence of BAP.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era response is highly genotype specific. Further.0) and shoot buds (6.4) found better. but explants derived from seedlings germinated on half strength MS supplemented with 2 mg/l BAP produced more number of shoots and shoot buds. Thus in the present investigation seeds were germinated on half MS with 2mg/l BAP for further analysis. explant containing shootbuds were subcultured on MS supplemented with 2 levels of BAP (0. 1993 and Zhang et al. shoot elongation was faster and callus was not observed. in Maruti cultivar. Initially shoots and shoot buds derived from seedlings germinated on half strength MS were used. Therefore. tumefaciens. Arundhati (1999) reported increased frequency of transformation from 4 day cocultivated leaf discs (47. Transformation Development of Agrobacterium mediated in vitro transformation protocol required efficient regeneration protocol. In pigeonpea. Thus various levels of indole butyric acid (IBA) or naphthalene acetic acid (NAA) (0. Pre-culture of explants on regeneration medium prior to cocultivation . respectively.225 shoot buds. Repeated selection on kanamycin was done to eliminate escapes and resistant shoots were analysed further. The roots produced on MS supplemented with NAA were short. 200.5 mg l-1) were tried with MS basal (Table 3).4 shoot buds per explant. Coculviation period influences survivability of explants. The sensitivity to kanamycin differs with genotypes (Geetha et al. The test was conducted to know the effective lethal level of kanamycin on different explants during shoot bud initiation and further growth stages (Table 4).8%) over 2 day cocultivated leaf discs. Lawrence and Koundal..1. survival of cocultivated explants with Agrobacterium was maximum upto two days beyond which explants did not survive because of excessive growth of Agrobacterium. Among four levels of cefotaxime tested (100. 2001). The level of kanamycin was reduced according to growth stage of explant. This finding is in accordance with Geetha et al.2. In contrast to this when IBA was used in the medium roots were thin. who observed effective inhibition of Agrobacterium at 300 mg/l in all the explants. 0. 300 mg l-1 was the minimum level to control Agrobacterium effectively. This finding is in agreement with Geetha et al.2 mg l-1 IBA was found better in inducing roots (75% response with well developed roots and rootlets). In the present study shoots and shoot buds were transferred to selection media containing 50 mg l-1 kanamycin and 75 mg l-1 kanamycin.55 shoots and 3. 300 and 400 mg l-1) . Cocultivated CNC cultured on MS+2 mg l-1 BAP+300 mg l-1 cefotaxime produced mean number of 2. (1999) and Lawrence and Koundal (2001) who used selective rooting media (MS + 25 mg l-1 kanamycin + 0. 2001) and levels ranged from 25 to 100 mg l-1. modification in the standardized regeneration protocol is necessary. 0. This will allow 273 preferential growth of the transformed tissues containing nptII gene. Therefore. 1999. (1999). Trend of CNC producing more multiple shoots and shoot buds on MS+2 mg l-1 BAP remained same in both conditions. In view of this certain modification are usually made in the standardized regeneration medium to have efficient regeneration after cocultivation (Geetha et al. thick but per cent response was very low (25 to 35%). long and with many rootlets.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era shoots had less number of roots and no rootlets. 1999. this combination was chosen for cocultivation. However non cocultivated CNC produced mean number of 3. Among the various levels of IBA and NAA used 0.2 mg l-1 IBA) without cefotaxime. Although cefotaxime is supposed to be non toxic to plant tissues it inhibited root growth in the present study. In the present investigation. Superiority of IBA over NAA and IAA was also reported by Geetha et al. Lawrence and Koundal. In our laboratory it has been noticed that routine protocols standardized for multiple shoot regeneration in pigeonpea do not work as such when explants are cocultured with A.44 shoots and 6. The surviving shoots in the first step were subcultured on the same medium and elongated shoot buds were shifted to 50 mg l-1 kanamycin for second level of selection. The roots were often associated with the callus. Thus. (1998) and Lawrence and Koundal (2001). in the rooting media cefotaxime was eliminated. Arundhati (1999) and Lawrence and Koundal (2001). Coffee Board for their encouragement and critical evaluation of the manuscript. Agrobacterium mediated transformation of pigeonpea (Cajanus cajan L. In two cycles of subculture only two shoots survived and were transferred to rooting medium (MS + 0. Venkatachalam. Patancheru.. C. k).) by using leaf disks. K. S.196-211. Surviving shoots in first selection were selected once again in the second sub culture to avoid escapes Several technique are being used to confirm the presence of transgene viz. P.). In the present investigation preculturing of explants increased the survivability after cocultivation over direct cocultivated explants. P. Immuno blotting PCR etc. Johnstone. Leaf samples from these shoots were used for DNA extraction and PCR analysis. India.. International Chickpea and Pigeonpea Newsletter. K. Northern blotting. Dr. and Dr. 274 Jayarama DR Coffee Board.4% (Table 6). Lakshmisita. Southern blotting. 1996). MS supplemented with 0.. And in total tranformation efficiency is 1. N.) Millsp) Cv. Multiple shoot induction and regeneration of pigeonpea (Cajanus cajan (L. Shoots were selected on elongation medium at 75 mg l-1 kanamycin (Fig . Presence of the npt II specific band 700bp in transformants. Current Science. C..A. Edwards.A. V. Thompson.. The pulse pigeonpea. Explants after cocultivation were cultured on MS along with 2 mg l-1 BAP and 300 mg l-1 cefotaxime without kanamycin for 15 days. G. Geetha. Jeychandran. Such regenerated shoot and shootbuds were transferred to selection media viz.. Survived shoots were kept for rooting and DNA extracted from leaf sample at this stage was used for PCR analysis. Millsp. Current Science. G. REFERENCES Anonymous. 74: 936-937. Of these PCR based techniques with transgene specific primers are the easiest methods to detect the presence of transgene. 75 mg l-1 kanamycin and 300 mg l-1 cefotaxime for shootbuds and only 50 mg l-1 kanamycin for shoots in two sub cultures(Table 5 and Fig. Santharama.105 Arundhati. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. J). Preincubation for 24 hr was followed in pigeonpea (Geetha et al. Hyderabad..Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era may play an important role in transformation. 1998. Agrobacterium-mediated genetic transformation of pigeonpea (Cajanus cajan L. R. . L). Gomez. A. 6: 62-64. positive control and its absence in negative control and in untransformed plant confirmed the presence of transgene in the tested plants(Fig. Andhra Pradesh. Philippines. M. Geetha. High frequency induction of multiple shoots and plant regeneration from seedling explants of pigeonpea (Cajanus cajan L.. Lawrence and Koundal. 2001).Frequency of transformants was more among tested plants when selection started at bud initiation stage. G.. Plant Biotechnology. 75: 1036-1041. K. Nucleic Acids Research. pp. Statistical Procedures for Rice Research Workers.. Venkatachalam. HDB. 1999. chickpea (Kar et al.. Seed production officer Coffee Board. 1998. Melchias. Publication by International Rice Research Institute..2 mg l-1 BAP. 1984. Gomez.) and development of transgenic plants via direct organogenesis..2 mg l-1 IBA + 50 mg l-1 kanamycin) (Fig . 19: 1349 Franklin.. 1991. Vamban 1 from apical and axillary meristem. Mishra. Ignacimuthu. The authors thank Dr. International Crop Research Institute for Semi Arid Tropics. G. (66%) followed by only at elongation stage (50%). 1999. A. 1999. 16: 213-218.. 1978. Dot bloting. Manila. Lakshmisita. Prakash. N. I) (Table5). pp. In Annual Report for 1978-79. A. Agrobacterium helper plasmid for gene transfer to plants. J. 37: 305-310. V. Shivaprakash. 1996.. S. M. Transgenic Research. Nayak. Basu. CAB International.. Gartland. Das. Sen.. 275 .C. Z. Gelvin. United Kingdom. Second Edition. L .C. Sen.T.. 80: 1428-1432. 1994. Skoog. 1997.E.B... Sambrook.. N.L. Hoekema. 16: 32-37. Vikas Publishing House Private Limited. 2001 Agrobacterium tumefaciens mediated transformation of pigeonpea (Cajanus cajan L. S. Transgenic elite indica rice plant expressing cry1A(c) AC-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Seripophaga intertulou). V. 94: 2111-2116... Molecular Cloning A Laboratory Manual. Sheela. Plant Cell Reports. 2: 203-289. Thidiazuron –induced organogenis and somatic embryogenesis in sugarbeet ( Beta vulgaris. M . Dev. C.M. A. 13: 623-627. Maniatis. Fritsch.. N. 2001. N.B. M.. pp. Hood. P. D. 1989.120-130.. Micropropagation of commercially important sugarbeet cultivars.P. Ghosh.. Smith. A. 22: 15-18. In Proceedings of National Academy of Science. pp.R.. Sarin.S. K.. S. S. T. Zhong.10. Lawrence. and Slater.. Koundal.. E. A. Basu.. Ramakrishan. 12: 59-66. Cambridge. T. Elliot. P. D.. Physiologia Plantarum. D. Nayak.). Thomas.K. Regeneration of pigeonpea (Cajanus cajan) from cotyledonary node via multiple shoot formation. Plant Cell Reports.. S. Efficient transgenic plant regeneration through Agrobacterium mediated transformation of chickpea (Cicer arietinum L. Cold Spring. H.M.103-107 Singhal. Nene.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Grieve.K. Handbook of Indian Agriculture.K. Melchers. Johnson.. T. D.F. 15: 473479. 1997. Murashige. T..K.F. 1993.G.A. 1993. 1962. Pental. Y. F. E. L. Plant growth Reg. Chen. p.K. Hall. Kar.D. 1999. 1990. S. Boil-plant... Current Science. Millsp) and molecular analysis of regenerated plants...M.H. A revised medium for rapid growth and bioassays with tobacco cultures. Zhang. The Pigeonpea. Harbor Laboratory Press. Elliot. In vitro culture of petioles and intact leaves of sugarbeet ( Beta vulgaris) Plant growth Reg. Ghosh.L) In vitro cell. New Delhi. 0 92.225 2.01 mg l-1 12.286 b 3.175 1.0 Second National Plant Breeding Congress 2006 MS + 2.625 a 0.400 1.00 0.00 0.005 d 0.175 3.05 mg l-1 30.05 c 92.622 c 2.650 1.500 .175 6.900 1.22 a 0. Effect of various levels of BAP and TDZ on per cent response .0 1.424 b MS + 0.00 0.20 87.80 0.186 90.0 85.950 25.00 0.160 0.0 90.5 52.400 2.162 b CN ½CNC MS 0.850 1.07 0.69 a 0.225 1.0 TDZ 100.17 1.050 1.091 f 0.175 0.0 mg l-1 BAP 92.5 mg l-1 TDZ 0.0 mg l-1 BAP 100.0 mg l-1 BAP 0.2 25.50 d 25.050 10.750 0.87 d 0.075 1.00 0.0 97.37 0.625 cd 9.00 2.92 1.675 2.275 4.400 2.0 51.061 g 0.0 55.450 e 0.299 a 1.943 g MS + 0.007 fg Plant Breeding in Post Genomics Era Mean 94.330 0.0 92.1 mg l-1 TDZ 90.0 0.825 2.375 4.962 a MS + 3.073 f 0.088 f MS + 0. shoot and shoot bud differention from different explants in pigeonpea.0 56.697 c 1.00 0.470 0.05 0.0 95.361 b 1.40 1.938 0.315 0.5 3.425 2.48 10.70 1.325 1.575 2.311 e MS + 0.57 0.125 1.5 TDZ 92.230 d 0.250 25.62 cd MS + 4.0 1.00 b 10.0 30.5 1.5 52.000 0.Table 1.500 1.20 100.275 2.225 1.0 55.950 3.5 0.00 0.0 25.475 a 2.5 d 0.44 57.20 0.375 1.5 95.05 c 0.0 50. Shoots per explant(average) Mean Shoot tip CN ½ CNC CNC Mean Shoot tip CN ½CNC CNC Shoot buds per explant(average) Mean Per cent response CNC Media Shoot tip 97.63 0.087 c 0.225 2.0 95.0 75.00 0.0 80.375 1.070 1.5 0.00 1.475 1.62 1.562d 1.375 1.75 c 0.00 b 0.500 1.942 e 3.0 25.50 d 0.843 c MS + 1.5 58.90 1.975 1.0 65.74 d 33.0 7.411 e 276 0.225 1.0 mg l-1 BAP 0.0 87.500 2.00 0. 920 c 80.2 mg l BAP MS + 0.746 a Table 3.00 a 65.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 2.01 mg l-1TDZ MS + 0.500 b 5.00 87. Effect of lower levels of BAP or TDZ on shootbud elongation Media Average number of elongated shoots per explant Per Cent MS + 0.200 d 3.00 85.00 95. Effect of kanamycin on inhibition of growth at various stages Level of kanamycin (mg l-1) 0 25 50 75 100 Shoot bud Elongation Rooting +++ +++ +++ ++ + +++ +++ ++ + - +++ + - Figures are average of 20 explants in each treatment +++ No inhibition of growth + More inhibition of growth ++ Less inhibition of growth 277 .5 mg l-1 IBA MS + 0.00 c 35. Effect of different levels of IBA or NAA on rooting Media Half MS MS MS + 0.00 d 75.1 mg l-1 NAA MS + 0.2 mg l-1 NAA MS + 0.2 mg l-1 IBA MS + 0.05 mg l-1TDZ -1 3.85 e 88.50 4.1 mg l-1BAP MS + 0.1 mg l-1 IBA MS + 0.00 g 35.00 f 25.00 f Table 4.5 mg l-1 NAA Per cent respose 42.00 b 70. Conformation of the transformants using specific PCR Explants cultured 300 Selection at various stages Further elongation (Kan 50) Elongation (Kan 75) Shoot bud ( Kan 100) Control Putative transformants 2 nptII positive shoots rooted 2 Number of of growth 0 500 200 50 10 6 2 8 4 0 1 0 0 278 .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 5. Selection of putative transformants during shoot elongation on selective medium (MS + 0.2 mg l-1 + 300 mg l-1 cefotaxime + 75 mg l-1 kanamycin) Explants CNC Control CNC ½ CNC Control ½ CNC Cultured 96 (196) 10 (30) 108(250) 15 (20) Responded 17 2 7 0 shoots survived shoots survived After 30 days After 60 days 25 3 16 0 6 0 4 0 Figures in parenthesis show total shoot buds (visible) Table 6. germinated on half strength MS + 2 mg l-1 BAP b. half cotyledon with cotyledonary node d. Regeneration of Pigeonpea Legend of the Fig. Putative transformants selected during shoot elongation stage on MS + Kan75 + 0.b shoot tip.Putative transformant c.1 mg l-1 NAA d.Putative transformant c.0.1 mg l-1 e.Root initiation b. Shoot and shoot bud induction from CNC on MS media with different levels of BAP 30 days after culture a. cotyledon with cotyledonary node (CNC) C. marker Hind III digest. 279 . Rooting of putative transformants on MS + 0.0.01 mg l-1 c. MS basal b.05 mg l-1 30 days after incubation F.0. Hardened rooted plants H. Shoot bud induction from different explant on MS+ 2 mg l -1 BAP 30 days after culture a. Agarose gel electrophoresis showing nptII fragment in the transformed plants. c.05 mg l-1 d. Rooting of elongated shoots on different levels of IBA and NAA a. 1 (Regeneration of Pigeonpea) A. 0.Untransformed d.0. 0. Shoot bud elongation on MS media with TDZ 0.2 mg l-1 IBA b.0. 1 mg l-1 b. plasmid g. One week old seedlings a . 2 mg l-1 c 3mgl-1 d.Root elongated L. cotyledonary node.5 mg l-1 E.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Fig 1. Plants transferred to big pots I.5 mg l-1 IBA c.0. d untransformed plant e control plant f.Control K..Control J. germinated on half strength MS Shoot B.05 mg l-1 TDZ + cef300 30 days after incubation a and b.2 mg l-1 NAA e.2 mg l-1 IBA + Kan50 after 20 days after incubation a. a b c Transformed plants. 4 mg l-1 D Shoot and shoot bud induction on MS media with different levels of TDZ 30 days after incubation a. 0.5 mg l-1 NAA G. Putative transformants selected during shoot and shootbud initiation stage on MS + Kan100 + 2 mg l-1 BAP + Cef300 20 Days after incubation a and b. Seedlings raised from non-imbibed seed. 5. instead. For callus induction. 1. and a good source of dietary protein in the tropics and subtropics.0.) Josnamol Kurian. Studies on ontogeny of somatic embryos showed that the cells determined to become somatic embryos divided into spherical proembryos. NAA (1. casein hydrolysate 100mg/l and L-Glutamine 50mg/l. Suspension cultures of calli derived from10-day-old primary leaves of in vitro grown Cajanus cajan L. Application of 2. One of the major problems in pigeonpea cultivation is pod borer (Helicoverpa armigera) which causes extensive damage to the crop. 2. mature. The highest embryogenesis frequency was observed on MS+B5 medium supplemented with 2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era DIRECT ORGANOGENESIS AND SOMATIC EMBRYOGENESIS IN PIGEONPEA (CAJANUS CAJAN L. Attempts to obtain pest-resistant genotypes of pigeonpea by conventional breeding methods have given limited success due to narrow genetic variation. Millsp. 4-D 2mg/l. 4-D (0. in both imbibed and non-imbibed seeds. differentiated clusters of leafy structures appeared which suppressed further morphogenesis. 2. In direct organogenesis approach.0 mg/l) alone was found ideal. Seedlings developed from imbibed or non-imbibed decoated seeds exhibited stout seedlings but with stunted growth. aseptic seeds showed numerous green adventitious shoot initials from the swollen cotyledonary nodal region within 3 days of culturing. 2. and sexual incompatibility with wild relatives.0. 4-D (1. with seed coat intact.5mg/l). Coimbatore 641003 280 . TDZ (1. Attempts were made to develop protocols through somatic embryogenesis and organogenesis pathways.0. R Gnanam and A Manickam ABSTRACT Pigeonpea (Cajanus cajan L. 1. Subsequent divisions in the proembryo led to globular.0 mg/l). drastically affected the differentiation of shoot-buds. different combinations of hormones were tried with 2. imbibed seed with intact seed coat differentiated to form maximal adventitious shoot buds in the cytokininsupplemented medium. Maximum somatic embryogenesis was observed when this callus was transferred to MS liquid medium supplemented with reduced amount of 2. However. Tamil Nadu Agricultural University. (var.5. failed to produce multiple shoot-initials.0 mg/l). 4-D (2. K Ramakrishnan.) is an important grain legume crop. MILLSP. heart and torpedo-shaped somatic embryos.0 mg/l) etc. Vamban 2) produced somatic embryos. The availability of a reliable in vitro regeneration protocol is a pre-requisite for the application of most biotechnological techniques such as production of transgenic plants with suitable gene(s). 1. The presence of seed coat.5. The regenerated plants were transferred to green house condition. Out of the different levels of 2. After all the outer leaves were removed. The effect of various factors such as growth regulators. Bhabha Atomic research centre. Using conventional breeding techniques.0 mg/l and kinetin 0.4-D 2. Co 26. Two types of calli were identified after 15 days of inoculation.. The different hormonal combinations.0 mg/l and casein hydrolysate levels of 500 mg/l was found to be the best combination. To supplement these efforts. CO 26. MS medium with NAA 0. the explants were surface sterilized with 0.1% (v/v) HgCl2 for 2-3 min 281 . non-embryogenic unorganized callus. Young shoot was used as explants for plant regeneration by Devi and Sticklen (2001). CO 27 and COS 28) including both grain and fodder sorghum has been initiated. especially drought. iron. In vitro derived plants will be useful to generate somaclonal variation. Mumbai 400 085 al.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era SOMATIC EMBRYOGENESIS AND PLANT REGENERATION FROM IMMATURE INFLORESCENCE AND LEAF EXPLANTS OF SORGHUM CULTIVARS Kumaravadivel. The percentage regeneration efficiency of embryogenic calli from Co 27 was found to be greater (85%) than that of calli derived from other genotypes. The present investigation was therefore undertaken (i) to assess the comparative performance of the hormonal combination and levels. Wen et 1. M. For regeneration. (iii) to study the effect of activated charcoal and proline and (iv) to find out the genotype showing maximum frequency of callus induction and regeneration. In the present study. One was white.25. It is well adapted to a wide range of soil types and environmental conditions. The explants were collected from 60 – 70 day old plants. embryogenic nodular callus and another one was yellow. tissue culture in four sorghum cultivars (CO 25. Materials and Methods Selection of expla]nts and surface sterilization Immature inflorescence and young leaf of sorghum genotypes Co. Coimbatore 641 003 2. 1986). proline and type of genotypes are the critical factors that influence the in vitro plant regeneration. Co 27 and CoS 28 were used for callus induction and regeneration. the combination of 2.4 -D and kinetin used for callus induction. were also studied.5 mg/l was found to be suitable for callus induction. proline. in vitro response of immature inflorescence and young leaf in sorghum genotypes was evaluated. etc. (ii) to find out the suitable explant size and age.. High frequency plant regeneration from cultured tissues is a pre-requisite for successful application of in vitro culture for crop improvement. The callus induction frequency was up to 80% for immature inflorescence and was up to 86% for young leaf explant when cultured in vitro. the type of explants. Introduction Sorghum ‘the great millet’ is an important crop. charcoal. much progress has been made in developing superior cultivars (Smith and Bhaskaran.Umadevi1 and Susan Eapen2 ABSTRACT Sorghum is one of the important grain and fodder crops in many parts of the world. nitrogen source. which has a special agronomic importance because of its multi product and diversified usage as food. Tamil Nadu Agricultural University. (1991) and Cai and Butler (1990) used immature inflorescence as explants. The basal medium used for callus induction and regeneration was MS with different levels of auxins and cytokinins. BAP 2. feed and fuel. effect of activated charcoal. N1. compact.1 mg/l. 0. Different expants (young leaf and immature inflorescence) of genotypes viz. Co 25. In the present study. we have investigated the influence of proline on plant regeneration from immature inflorescence of two different genotypes of sorghum namely Co 26 and Co 27. absorbing phytotoxins released by the tissue in culture (Brettell et al. the MS medium was supplemented with a combination of 6benzylaminopurine (1. Result and Discussion Callus induction The immature inflorescence and young leaf segments showed a general expansion followed by appearance of visible callus within 10-15 days of culture (Table 1). of KNO3 and NH4NO3 in the basal MS medium.4-D (1. The differences in NH 4 + and NO 3 concentrations were obtained by changing the conc.5. Immature inflorescence was cultured on MS (four different levels) and ratios of NH4+ (370. In all sorghum genotypes. 4500 mg/l). 0. The immature inflorescence was collected from plants before the emergence of the inflorescence at the boot leaf stage. 0. Considering these effects. absorbing inhibitory substances in the media and 3. 2.4-D. the explants were cultured on MS medium with 2. 0. size and medium composition.4 and 0. The positive effect of activated charcoal includes: 1. Sorghum somaclones generally have a low establishment rate due to their underdeveloped root systems. Immature inflorescence was cultured on MS medium supplemented with 2 mg/l 2.0. 282 Effect of proline and nitrogen source The development of tissue culture protocols for embryogenic callus induction and plant regeneration is imperative for successful application of tissue culture technology for crop improvement.0 mg/l). 2g and 3g/l) were tried to find out the optimum concentration for callus induction and regeneration. The various levels of praline (1g. media have been developed for routine use with the incorporation of activated charcoal. Experiments conducted Effect of hormonal levels. Embryogenic callus formed after 25-40 days of culture.5 g/l) and double the doses of Fe-EDTA. The callus was creamy white and compact in the initial stage and became very nodular in later stage. The immature inflorescence was dissected and those less than 2 cm long were selected and cut into 3-5 mm. explants and genotypes Five different hormonal combinations were used for callus induction and three different hormonal combinations were tried for plant regeneration.1. Effect of activated charcoal and Fe – EDTA Activated charcoal is a well known absorption agent. Co 26. The surface sterilization steps were done aseptically.0 mg/l) and kinetin (1.5.0 and 4. ions with without organic nitrogen (proline 2 mg/ l). 0. For regeneration of plants.01 mg/l NAA and incubated in the light under a 16 h photoperiod under white fluorescent light. 1980) and 2. . The callus induction was very much dependent on age of immature inflorescence. Co 27 and CoS 28 were cultured for callus induction on Murashige and Skoog (1962) medium and incubated in darkness at 26oC for callus induction. 3.. 5-10 mm and 1015 mm segments. Nature of the embryogenic calli is highly dependent on explant age. 2.3. 1 mg/l kin with different concentrations of activated charcoal (0. 2. absorbing gases such as ethylene that is present in cultures.0. callus induction was found to be high with young leaf in all treatments.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and then rinsed thrice with sterile double distilled water. They were subcultured every two weeks and maintained at 26oC for callus induction. For initiation of callus.0 and 2.5 mg/l) + 0.2.. 1130 mg/l) and NO-3 (2500. Inflorescence of 10-15 mm produced non-embryogenic. Influence of inflorescence length on callus induction. MS medium with NAA (0. friable callus from the cut end of rachis. somatic embryogenesis and plant regeneration in sorghum Green plantlets were noticed after 20 – 25 ays Green plants were observed along with rooting No. callusing was extremely poor (Table 1). CO 27 were used as the source material. When inflorescence length varied between 5-10 mm.0 4.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era When the length of the inflorescence ranged from 3-5 mm. maximum callus was obtained.0 mg/l and 283 *** Excellent callus initiation ** Moderate callus initiation . The highest frequency of regeneration was obtained from Co 27 immature inflorescence (86%) than the other genotypes. Table 1. 1980). The rooted plantlets grew satisfactorily in soil in paper cups and also in glass house condition. The explant showed signs of callusing after 15 days after incubation on MS medium supplemented with 2.0 mg/l) and casein hydrolysate (500 mg/l) showed the highest per cent of shoot regeneration.culture enesis 3-5 5-10 10-15 *** ** 0 15-20 5 0 5 0 Immature inflorescence Complete plants Co 25 RGM 1 67 were derived Co 26 RGM 2 60 from compact Co 27 RGM 2 85 calli Co 28 RGM 1 75 Effect of charcoal and Fe-EDTA Immature inflorescence of sorghum varieties viz. Response of calli for regeneration in various combination of media Genotypes Explant 2.0 2. of Length of Intensity cultures Average of the showing number of callusing somatic plants/ inflorescence (mm) embryog.5 3.. Table 3.0 2.4-D 2. CO 26. embryoids turned green and produced a huge clump of shoots and roots.4-D and kin (0.% of Explants ration regenemedium ration Growth response CO 27 L I CO 28 L I Young leaf callus Co 25 RGM 1 67 Co 26 RGM 1 75 Co 27 Co 25 RGM 2 RGM 2 83 70 L – Young leaf I – Immature inflorescence Table 2.No callus initiation . Effect of various levels of 2.5 mg/l) on callus induction (%) Regeneration The experiments conducted to study the hormonal levels on regeneration are presented in Table 3. Forty out of 83 transplanted plants were transferred to field condition and regenerants were successfully established. Somatic embryogenis was strictly dependent on the age of the inflorescence and embryos were induced only when inflorescence length ranged from 5-10 mm. In the medium supplemented with BAP.1 mg/l).4-D (mg/l) 1..0 20 45 10 39 50 70 50 76 60 86 68 80 15 40 20 35 65 72 50 70 71 73 20 35 30 40 15 43 48 40 50 50 25 12 60 47 35 13 40 10 CO 25 L I CO 26 L I Regene. BAP (2. No somatic embryogenesis was observed when inflorescence was younger or older (Brettel et al. 2: 89-96. The maximum regeneration (80%) was observed both the genotypes of immature inflorescence calli. In vitro culture studies will enable the generation of somaclones. Effect of activated charcoal and Fe-EDTA on callus induction (%) Activated charcoal (g/l) Geno-Explant types Co 26 Immature inflorescence Co 27 inflorescence 0. Physiol. Embryogenesis and development of isolated barley microspore are influenced by the amount and composition of nitrogen sources in culture media. The increase in concentration of NH4+ (or) NO3. basic genetic studies. Compared with MS. and Cortz.. Genet. 1993). Journal of Plant Physiology. W. 1990.0 mg/l. Embryogenesis from cultured immature inflorescence of Sorghum bicolor. 20: 101-110.O r g a n i c Callus (mg/l) nitrogen induction g/l (%) (Proline) 2500 2500 4500 4500 1 1 2 2 25. J. This shows that both sources of inorganic nitrogen and optimal NH4+ : NO3. Plant. and Sticklen. In vitro studies enhance genetic diversity and helps in the development of transgenic plants.S. R. 2 mg/l BAP with 0.1 0. T. and Skoog. Wernicke. The effect of various factors viz. 142: 485-492.4 g/l activated charcoal and double dose of Fe-EDTA in CO 26 inflorescence explant (Table 4).42 45.. A. L. 1980.. The per cent of callus was maximum at 0. 2001. Murashige. treble the concentration of NH4+ (1130 mg/l) and the addition of organic nitrogen (proline 2 g/l) was more effective in stimulating embryogenic calli growth. 15: 473-497. E. Protoplasma. Cai. M.ratio for the induction and growth of embryogenic calli has also been shown in the tissue culture of other plant species (Mordhorst and Cortz.B. Regeneration was achieved by incubating calli on MS medium with 0. The above study clearly indicated the scope of in vitro culture in sorghum towards successful regeneration of plants and establishment in the 284 Brettell. explant and tannin exudation should be taken utmost care. A revised medium for rapid growth and bioassays with tissue cultures. genotype. P. Devi.T. and Thomas.3 0.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era kinetin 1. REFERENCES 50 72 80 88 66 60 80 83 80 60 50 85 Influence of nitrogen sources on callus induction We found that addition of amino acids to basal MS medium was more effective than increasing the concentration of inorganic nitrogen for embryogenic callus induction (Table 5). 1993. Cytol. the medium with double the concentration of NO3.5 Fe-EDTA Single dose 48 Double dose 86 Table 5. and Butler. in vitro selection and in vitro mutagenesis.P.02 29. The necessity of an optimal NH4+ : NO3. Plant Cell Tissue Organ Culture. Mordhorst.2 0. Culturing shoot tip clumps of Sorghum bicolor and optimal microprojectile bombardment parameters for transient expression.(4500 mg/l).in the media supplemented with organic nitrogen was also less effective. The addition of activated charcoal to the callus induction medium increased the percentage of callus in two genotypes.4 g/l activated charcoal. .42 51. Influence / Effect of nitrogen sources on callus induction (%) Medium NH4+ (mg/l) NO 3 .B. H. 1962.I. F. 104: 141-148. Table 4.ratio are important.58 MS 1 MS 2 MS 3 MS 4 370 370 1130 1130 field.4 0. Plant regeneration from embryogenic callus initiated from immature inflorescence of several high tannin sorghums.1 mg/l NAA. S. G. Vol.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Smith.2.) Y. S. Euphytic.. 52: 177-181. F.S. Sorensen.220-233. and Liang. Callus induction and plant regeneration from anther and inflorescence culture of sorghum. 285 . 1991. Moench).Bajaj (Berlin: Springer Verlag)..H. Barnett. 1986. In: Biotechnology in agriculture and forestry.L. pp. E. Sorghum (Sorghum bicolor K. Wen. R.H. F.P. and Bhaskaran. (ed. In the above three lines.71 and 2. ASD16. using a rice chitinase (chi11) gene.48.. Poovannan. KL-ASD16-4-1-1. no such lesions formed on the third day and small brownish lesions started appearing only on six DAI.T. Samiyappan. The present study suggested that these lines could be utilized as a resistance source against ShR pathogen in rice breeding programmes. Kalpana. Maruthasalam. In T2 generation. three homozygous lines viz. Tamil Nadu Agricultural University. Transgenic rice lines were generated using Agrobacterium-mediated transformation. R. KL-ASD16-5-2-1 and KL-ASD16-6-1-1 expressing chitinase were identified through western blotting analysis. These homozygous lines were evaluated for ShR resistance in T2 generation.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era ENGINEERING SHEATH ROT RESISTANCE IN RICE Rajesh. These brownish lesions enlarged in size and irregular extensive browning was observed within 12 D AI. A sudden and extensive browning was noticed only in transgenic plants whereas the characteristic oblong greyish lesions were produced in non-transgenic control plants without brownish lesions. S. Sudhakar and P.56). Coimbatore . KL-ASD16-4-1-1 performed better and gave an enhanced protection against ShR than the other two lines. A small lesion surrounding the brown border was observed after three days of inoculation (D AI) in non-transgenic ASD16 control plants. Among the three homozygous ASD16 lines tested.641 003 286 . K. The significant reduction of per cent sheath infection was observed in three homozygous lines (2. These lesions slowly spread and developed into characteristic large size oblong greyish lesions within 12 D AI. Balasubramanian ABSTRACT The study was aimed at engineering resistance against sheath rot (ShR) caused by Sarocladium oryzae Gams and Hawksworth in a local elite indica rice cultivar. D. 2.95) over non-transgenic control (18. K.. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era . Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TECHNICAL SESSION VI CONTRIBUTIONS OF GENOMIC TOOLS IN CROP IMPROVEMENT . Los Banos. Pizau(t) has been identified using e-landing and high-resolution mapping and bio-informatics tools.4031 Laguna. brown planthopper (BPH) and blast (Bl) disease of rice are a continuous threat to rice production due to changes in biotypes of BPH and pathotypes of Bl. The new BPH resistance gene. However. The plant breeders of the 21st century have to combine modern tools of biotechnology with conventional plant breeding tools to identify novel genes that can express broad spectrum of resistance to BPH and Bl. high yielding rice cultivars and have achieved food security in many countries of Asia. The breeding lines possessing resistance to BPH and Bl combining high yielding and superior grain quality traits would be valuable breeding materials for rice improvement. Philippines 287 . Bph18(t) has been tagged to STS marker through e-landing and high-resolution mapping approach using Nipponbare genome sequence information and BPH bioassay. We have developed advanced breeding lines using marker-assisted backcross (MAB) breeding. We have identified new sources of BPH resistance in the breeding line.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era MOLECULAR BREEDING FOR BROWN PLANTHOPPER (BPH) AND BLAST RESISTANCE IN RICE Kshirod K. Mackill ABSTRACT The last three decades of the twentieth century have made significant progress in developing semi dwarf. International Rice Research Institute. IR65482-7-216-1-2 and Bl resistance in the breeding line. IR654824-136-2-2 using the Korean biotype of BPH and pathotypes of Bl. Jena and David J. A major blast resistance gene. ABSTRACT QTL mapping has been a very popular activity among molecular biologists. There are innumerable quantitative trait loci (QTLs) reported for different traits on different chromosomes. H.E.560 065 288 . University of Agricultural Science. This is mind boggling to a breeder who is committed to improve the traits he handles. expressed sequence tags and candidate genes are being added to the databases. Hundreds of molecular maps are being developed in certain crops and thousands of markers being discovered or added.WHAT DO WE DO WITH THESE? Shashidhar. Several of simple sequence repeats. GKVK Campus.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era QUANTITATIVE TRAIT LOCI. Bangalore . DNA MARKERS AND CANDIDATE GENES . Hundreds of papers deal with this subject across crops and traits. The magnitude of situation is explored and analysed to propose a way out to maximize utility of all these new tools in biology and practical plant breeding. 70.K. Similarity indices estimated using STMS primers were lower than those estimated using isozymes. U. N. Selection percent was correlated with genetic similarity estimates of the parents.60 to 0.641 007 2. peroxidase and diaphorase. while 24 parents were analysed with 39 GenBank derived sugarcane specific sequence tagged microsatellite site (STMS) primers. Balasundaram1 and N. National Research Centre on Plant Biotechnology.. Natarajan1.Sugarcane Breeding Institute. IARI. STMS primers detected more amount of polymorphism to aid in sugarcane breeding and generated clear fingerprints for varietal distinction to serve as ideal markers for analysing the complex genome of sugarcane. G1. A higher proportion of combinations showed similarity index values between 0. 1. Forty nine parents were analysed for three isozyme systems viz. revealing the existence of moderate genetic diversity among the parents and explained the continuous success of varietal evolution in India utilizing the available variability. Coimbatore .S. Similarity indices could be more appropriately used to prevent close breeding by eliminating genetically close parental combinations.6033 based on STMS markers) demonstrated the usefulness of molecular marker based selection of parental combinations for deriving more number of elite types.6221 based on isozymes and -0. Cross performance quantified in terms of selection percent of progenies derived from 14 crosses involving 16 parents taken for isozyme analysis and 16 crosses involving 18 parents taken for STMS analysis was estimated based on three economically important traits in the first clonal stage.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era MICROSATELLITE AND ISOZYME BASED GENETIC DIVERSITY MEASURES FOR DECIDING PRODUCTIVE CROSS COMBINATIONS IN SUGARCANE IMPROVEMENT Hemaprabha. esterase. Observation of significant negative correlation (-0.Singh2 ABSTRACT Genetic diversity in sugarcane parental clones used directly in varietal improvement programmes was estimated based on microsatellites and isozyme markers. New Delhi 289 . 1987). DNA based markers have obvious advantages in maintaining genetic purity and identification process. scarabaeoides and C. Joshi Saha. It ranks second amongst the grain legumes in India. approaches like heterosis breeding and distant hybridization were attempted (Reddy and Faris. volubilis (Wanjari et al. (1995) showed that the unique sequence 1. In the present study a sequence characterized amplified region (SCAR) marker was developed for the identification of two A lines 288A and 67A derived from crosses between wild species C. derived from C. Mumbai 400085.. This SCAR marker can also be used as a marker for the diversification of the CMS genetic background in pigeonpea hybrid breeding programme.) is one of the important grain legume crops in the tropics and subtropics. Bhabha Atomic Research Centre. India. 1981). Introduction Pigeonpea (Cajanus cajan (L. 1993). cajanifolius (Saxena et al. Genetic and molecular methods have been used to study the differences in the organization and expression of the mitochondrial genes in the fertile / sterile phenotypes. 1997. Cytoplasmic male-sterility (CMS) is a maternally inherited trait with plants remaining fertile but with no viable pollen formation. (ii) A2 cytoplasm derived from C. heterosis is being exploited using the male sterility system based on cytoplasmic nuclear interactions.. sericeus respectively.com 290 . Trombay. Saxena and Kumar. Production of pigeonpea hybrids using genetic male sterile line poses the problem of rouging fertile plants from the female parent plots. Restriction fragment length polymorphism (RFLP) of the mitochondrial DNA (mt DNA) has been used as an efficient tool to look at rearrangements in the mt DNA of male sterile plants of many crop species (Boeshore et al. sericeus (Ariyanayagam et al. This results from incompatible nuclear mitochondrial interaction due to rearrangements in the mitochondrial genome (Lonsdale.G. The SCAR primers designed amplified a 400 bp amplicon from the male sterile lines and not from the B and R lines studied. Stable CMS lines have been reported in pigeonpea. maintaining the purity of the parental lines is a major problem in hybrid seed production.) MILLSP.) Millsp. 2001) and (iv) A4 cytoplasm. scarabaeoides (Tikka et al. a maintainer line (B line) and a restorer line (R line). Manjaya and T. However. A. Production of hybrids using a cytoplasmic male sterility (CMS) system involves the use of a male sterile line (A line).. Akagi et al. derived from C. Cytoplasmic male sterile (CMS) lines and availability of restorers would effectively circumvent these constraints and make a major impact on commercial hybrid seed production. In order to break the yield plateau and to incorporate resistance to biotic stresses. Gopalakrishna ABSTRACT To achieve breakthrough in pigeonpea productivity. J.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era SEQUENCE CHARACTERIZED AMPLIFIED REGION (SCAR) MARKER FOR THE IDENTIFICATION OF CYTOPLASMIC GENIC-MALE STERILE (CGMS) LINES IN PIGEONPEA ( CAJANUS CAJAN (L.. 2003). cloned and sequenced to convert it into a SCAR marker. 1983). A random amplified polymorphic DNA (RAPD) marker OPC11600 unique to A line was identified.. Nuclear Agriculture & Biotechnology Division. (iii) A3 cytoplasm derived from C. email: souf@scientist. 2005).J1. These are (i) A 1 cytoplasm.) Souframanien.. Bangalore. Mumbai. (1983) with little modifications. Amplification conditions were an initial denaturation at 940 C for 4 min and 45 cycles at 940 C for 1 min. The nucleic acids were precipitated by adding equal volume of isopropanol and ammonium acetate (2. Amplified products were separated on 1.. To the slurry. and S) and normal cytoplasm using primers corresponding to chimeric regions of mitochondrial DNA sequences (Liu et al.5 % agarose gel in 1X TBE buffer (100 mM TrisHCl. C.) and 0.5 ml microcentrifuge tube containing 50 ml TE buffer. 0. USA. The pellet was washed with 70 % ethanol. 290 A.01% gelatin. Further. Hamburg. air dried and dissolved in TE buffer. 1993. CA.) following instructions given in the manual. a sequence characterized amplification region (SCAR) marker was developed from RAPD marker OPC-11600 and was utilized to study the differences between the male sterile and fertile lines of pigeonpea. Gujarat Agricultural University.000 rpm for 20 min..5 units of Taq DNA polymerase (Bangalore Genei Pvt. The tube was incubated at 650 C for 10 min. purification and reamplification of RAPD fragments The selected A-line specific bands from 288A and 67A were excised from the agarose gel and transferred to a 1. TTR1 and TTR2 are the putative restorer lines maintained at NABTD. (2003) reported the ability of RAPD markers to differentiate male sterile lines derived from C. Chilled 5 M potassium acetate (500 ml) was added. 100 ml of 20 % SDS was added and was 291 incubated at 650 C for 15 min. India. pH 8.2 mM each of dNTP. Two seeds were crushed using a metal rod in the 500 mll extraction buffer (Tris-Hcl 100 mM. In the present study. Germany).3. 1995). EDTA 50 mM and NaCl 500 mM). After centrifugation at 10. 20 pmoles of RAPD primer (Operon Technologies Inc.B. Souframanien et al. The RFLP and RAPD (Random Amplified polymorphic DNA) analyses have been used to arrive at the phylogenetic relationships among the cultivated and wild species of pigeonpea (Nadimpalli et al. Dr. Almeda. Isolation. 1mM EDTA) . The contents of the tube were mixed by tapping and incubated on ice for 20 min. scarabaeoides and C. Wanjari. Gujarat India and Dr. 370 C for 1min. which was absent in the maintainer and restorer lines studied. the supernatant was transferred to another sterile eppendorf tube. K. the amplification product of 600bp amplified by primer OPC-11 was observed in both the cytoplasmic male sterile lines (288A and 67A). Ltd. In maize a single seed. 83 mM boric acid. DNA concentration was determined in a Hoefer DNA Fluorometer using Hoechst dye and the DNA samples were diluted to 25 ng l-1 for PCR amplification. The PCR product was purified using Geneispin gel extraction kit (Bangalore Genei Pvt. sericeus. 720 C for 2 min followed by 5 min at 720 C. BARC. 0.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era downstream from the mitochondrial atp6 gene was specifically amplified in the sterile cybrid plants by PCR in rice.5 mM MgCl2. Bangalore. Reamplification was carried out using 2 ml of the purified product as template in a 25 ml reaction volume containing 10 mM Tris-HCl (pH 8. PDKV.5 M) and centrifuged at 40 C for 20 min at 12. Ratnaparkhe et al.. DNA was extracted from seeds using the method described by Dellaporta et al. Tikka. Materials and methods Plant materials and DNA extraction The pigeonpea CMS lines 288 A. multiplex PCR protocol was utilized to differentiate three types of CMS (CMS-T. 2. 100 A and their respective maintainer (B) lines were obtained from Dr.3). 67 A. Pigeonpea seeds were soaked overnight at room temperature in distilled water.000 rpm. 50 mM KCl. Amplifications were performed in an Eppendorf Master cycler gradient (Eppendorf Netheler-Hinz GMBH. Akola India. Ltd. 2002). India). gov/blast). .ncbi. 1). Amplification condition was same as for SCAR amplification as described earlier. following the manufacturers instructions. For this reason it is advisable to convert RAPD markers into SCAR markers for reliability and reproducibility. SCAR primers were designed using the Primer 3 software (Rozen and Skaletsky 2000) using the following criteria: Length of 16-25 nucleotides with GC content of about 40%. SCARs have several advantages over RAPDs like high reproducibility resulting from longer primer. India). A set of forward and reverse primers (PMS2F and PMS2R) were designed based on the internal sequence of RAPD marker (OPC11600) derived from 67 A. The primers were synthesized by Board of Radiation and Isotope Technology (BRIT).nlm. The sequence of the SCAR primers were as follows: PMS2F 5’. dephosphorylated pUC 18 Sma I / BAP using SureClone ligation kit (Pharmacia Biotech. The thermocycler was programmed for an initial denaturation step of 940 C for 4 min followed by 35 cycles of 940 C for 30 sec. India. USA).5 g/ml ethidium bromide solution and viewed under UV light. ramping speed. The DNA sequences were used to search GenBank using BLAST analysis (http://www. RAPD markers need to be converted into simple SCAR markers for large-scale application in marker assisted breeding. 1993).nih. 2003). 720 C for 1 min and a final extension step at 720 C for 7 min.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era at 75 V. The Tm of the primers should be between 450 C and 650 C. SCAR amplification DNA sample extracted from male sterile and fertile lines were amplified essentially as described for the RAPD amplification except that 5 ìM of SCAR primer pair was used.. Multiplex PCR For amplifying the rDNA internal transcribed spacers (ITS) region primers were designed from 292 the conserved sequences of mungbean (Schiebel and Hemleben 1989). Ltd.. The gels were stained with 0. This involves the characterization of the linked RAPD marker and the design of locus specific primers (Paran and Michelmore. The cloned DNA samples were sequenced bidirectionally in an automated DNA sequencer (Applied Biosystems) using T7 and SP6 promoter specific primers (Bangalore Genei Pvt. The primer sequences were as follows: ITS1F (5’AAGTCGTAACAAGGTTTCCGTAG-3’) and ITS2R (5’-GTTAGTTTCTTTTCCTCC3’). These markers were cloned and sequenced to convert it to sequence characterized amplified region (SCAR) marker. Cloning and sequencing of the RAPD products The PCR products were cloned into a blunt ended.g. 640 C for 1 min. Mumbai.CATAGCCTTCTTCGCGGTAG-3’ and PMS2R 5’-GATCGTTGGTGAGGACCA TT-3’. template quality. The amplified products were analyzed as described earlier. Results and discussion In our earlier study RAPD marker OPC11600 was found to be unique to both CMS lines 288A and 67A. Bangalore. The size of the amplification products was determined in comparison to EcoR I and Hind III digested Lambda DNA. This primer pair amplified a fragment of 400 bp which was found to be polymorphic between all the A and B lines used in the present study (Fig. This marker was absent in the respective maintainer (B) lines and restorer (R) lines studied (Souframanien et al. RAPD is known to be more sensitive to reaction conditions (e. Multiplex PCR reactions were set up using ITS1F and ITS2R (to amplify the entire ITS region) along with SCAR primers. type of instrument used) than standard PCR performed with two longer specific primers. 1995). In addition to the chloroplast specific sequences. In the present study CMS lines were distinguished from their respective maintainer (B) line and putative restorer lines using the SCAR marker.. At the protein level. 1999) and maize (Liu et al. However..2% for both the markers. In earlier reports random presence of chloroplast DNA sequences are seen in mitochondrial DNA. A multiplex PCR assay combining two sets of primers in a single amplification reaction was applied to total seed DNA.. amplified DNA fragment specific to CMS lines in radish (Nahm et al. Genome rearrangements in the vicinity of the orfB gene was observed in carrot (Nakajima et al. While others have found non-nuclear genome specific markers... a 400 bp specific to male sterile (A) line and 600 bp from ITS region (Fig.. 1995). 1985). 2001). 1983). 1999). Search for homology between the two markers were carried out and found to be similar.. An extended random primer amplified region (ERPAR) marker was utilized to identify dominant male sterility gene in cabbage (Wang et al. sequence tagged sites (STS) primers were utilized to differentiate CMS cytoplasm from the fertile cytoplasm in carrots (Nakajima et al. 1999). Knowledge about the molecular structures and the mechanism underlying CMS increased considerably with the development of molecular 293 approaches. 2000). Mutations responsible for CMS have been shown to reside in the mitochondrial DNA (mt DNA) in many plant species (Schnable and Wise. Akagi et al.. In earlier study. DNA sequence homologies have also been detected between nuclear DNA and mitochondrial DNA (Kemble et al. At the DNA level both the markers showed significant homology with known sequences in Gene Bank. the homology of DNA and translated protein sequence showed significant homology with ATP synthase beta subunit of chloroplast. 1994). Similar results of RAPD marker unique to male sterile line which differentiated CMS line from their maintainer (B) lines was observed in rice (Ichii et al. 2003). The resulting duplex PCR amplified two bands. pigeonpea CMS lines were differentiated from their maintainer (B) lines using RAPD markers (Souframanien et al. . it is not yet clear in the present study whether the SCAR marker is associated with nuclear or extranuclear genomes. 2). The RAPD analysis of the male sterile line and maintainer line can find application for the practical identity of the two genomes and genomic stability of the male sterile parental partners (Wang et al. In earlier studies.. The full length nucleotide sequence of the two markers specific to male sterile (A) line 288A and 67 A was determined and deposited to Gene Bank. 2003).. 1998).. PCR amplification of the down stream region of atp6 carried out using both the fertile and sterile regenerated cybrid plants showed that atp6 was linked with CMS (Akagi et al. Primers based on 3’ region of the atp6 gene. (1995) showed that CMS plants can be selected rapidly and easily by PCR in an early stage of plant regeneration in rice. Genetic variation at DNA level is of great relevance in assessing the combining ability and exploiting maximum heterosis in pigeonpea (Ratnaparkhe et al. both the markers showed significant homology with ATP synthase beta subunit of chloroplast. The AT/(AT+GC) ratio was 58. 2005). ITS primer was tested as possible controls for multiplex PCR by amplifying them with specific primer pairs.. The conversion of a linked marker to SCAR has been applied successfully in a number of crops like radish (Murayama et al. in the present study. A few homology sequences have been reported to be present in all the three genomes (Whisson and Scott . Similarly. This may be attributed to various reasons.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era higher annealing temperature and possibility of changing dominant RAPD markers to codominant SCAR markers. P. Lee HJ. Mans. 1987. T. A. S..).P. 190: 459-467. and Laughman. Cytoplasmic male sterility: A molecular perspective.R.. A plant DNA mini-preparation: version II. Euphytica. Lifshitz. 85: 985-993. Theor Appl Genet. 90: 948-951. 1: 19–21. The maintenance of CMS lines is very tedious because of out crossing in pigeonpea. and Taketa.. Nakamura. and Zaveri . 25: 256-271. Liu. 49:115:115-121. S. 1995. SL.K.R. A PCR protocol for rapid determination of sterile cytoplasm types in maize. As a result pigeonpea hybrid breeding relies heavily on the phenotypic selection method. H. M. Yamagishi. Genetic fingerprinting of pigeonpea (Cajanus . 1995.. Ratnaparkhe. Lee SW. Nahm SH.. In addition. 1993. R. Genetic diagnosis of cytoplasmic male sterile cybrid plants of rice. Dellaporta. Ichii. R.R. 36: 216-223.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Currently there is no information available on the identification of pigeonpea CMS lines at the DNA level. O. 2002. S. V. Weingartner. S.L.P. and Izhar.J. and Kochert. 111:1191-1200. Ven Murthy. 1999. Lonsdale. J. Breeding Sci. Yamamoto. P. R. Hanson. REFERENCES Akagi. and Oka. 2003. Plant Mol Biol Rep.B.O. The identification of CMS lines will therefore be helpful in assessing both purity as well as stability of CMS lines. Phylogenetic relationships of the pigeonpea (Cajanus cajan) based on nuclear restriction fragment length polymorphisms...C. Nageshwar. 1983. Z. Gupta. Nadimpalli. M. Sequence homologies to episomal mitochondrial DNAs 294 in the maize nuclear genome. 2005 Development of a molecular marker specific to a novel CMS line in radish (Raphanus sativus L.. 129: 249-252.M. K. Theor Appl Genet.. Theor Appl Genet. and Terachi.G. T. Peter.S. Plant Physiol Biochem. Genome. the markers could serve as the starting point for the identification of genes involved with the regulation of male sterility. J. Muranaka. Ohara.. M. 1999. R. and Ranjekar. Harn CH. Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce. I. M... Crop Sci. Sawada. A.. 304:744-747. 1983.L. The availability of CMS in diverse genetic backgrounds holds the key to a successful commercial exploitation of hybrid pigeonpea. Gabay-Laughman . Cytoplasmic-genic male sterility in interspecific matings of Cajanus crop. Nature.J. Novel composition of mitochondrial genomes in Petunia somatic hybrids derived from cytoplasmic male sterile and fertile plants. Kemble. Murayama. M. C. Joo GY. Yang SG and Min BW.. Paran I and Michelmore RW. M. D..P. Y. and Kaeser. Crop Sci. R. H.. 99: 837-843. Characterization of CMS and maintainer lines in indica rice (Oryza sativa L.T. 35: 981-985. the SCAR marker developed in the present study will be useful in pigeonpea breeding. Phatak. Zhao. and Oeda. M.. Ariyanayagam.. Jarret.. Genetic variation of petaloid male –sterile cytoplasm of carrots revealed by sequence tagged sites (STSs). Mol Gen Genet.. D. 1983.L. Thus. U. 42: 566-569. 1993. and Hicks. Y. Identification of RAPD and SCAR markers linked to a restorer gene for Ogura cytoplasmic male sterility in radish (Raphanus sativus L) by bulked segregant analysis. 1993.S. Long. J. Theor Appl Genet.) based on RAPD marker analysis. G. Stamp. Hong. Boeshore. Nakajima. S. Wood .B... scarabaeoides (L.. Primer3 on the WWW for general users and for biologist programmers.D.) Millsp.L.) through wide hybridization. Saxena.A. 1989. S. p. 2005. Pigeonpea Newsl. Euphytica. and Chauhan..): identification and parentage determination by RAPD fingerprinting. 295 . Tikka. The molecular basis of cytoplasmic male sterility and fertility restoration.. M. Rafalaski. 2003. 17: 2852. K. NJ.. Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. 1994.. and Pawar.S..G. Souframanien. Rozen. 145: 289-294. P. N. S. R.B. S. and Wise.. Jhang..) Thouars.. Parmar. 3:175-180.J. Manapure. W. Z. B. Univ Res J. Kubelik. S. Wanjari.. 2000. Sun.) and wild relatives using RAPD markers. Kumar. Wang. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. K. A. 2003.M. 18: 6531 – 6535. 13: 170-174.J. K. 1990. Gujarat Agric. and Kumar.B. Plant Cell Rep. L. Williams.E..S. Manjaya . Schnable.) Millsp. H. 129: 293299. A cytoplasmic male sterile line in pigeo-npea. 1997. and Faris.. Wang. J. 1985. 1981. Theor Appl Genet. 1998. Y. N. Whisson. Manjaya. Trends Plant Sci. A cytoplasmic–nuclear male sterility system derived from a cross between Cajanus cajanifolius and Cajanus cajan. Euphytica. Nuclear and mitochondrial DNA have sequence homology with a chloroplast gene. Fang. J. P. J. and Shiying. 4: 267-273.. Srivastava. Hybrid rice (Oryza sativa L. D.N. Krishna. V. Patil. J. P. Nucl Acids Res. R. Castiglione. Humana Press. Schiebel. Ma.G.S. An extended random primer amplified region (ERPAR) marker linked to a dominant marker linked to dominant male sterility gene in cabbage (Brassica oleracea var. and Skaletsky.V. 2001. and Manish.. Y. 1:16-17.V.J. R. Huang.. 63: 225-229. Int. K.. 365-386.K.V. Random amplified polymorphic DNA analyses of cytoplasmic male sterile and fertile pigeonpea (Cajanus cajan (L. T. P.V. S. 2000. and Qu. and Scott.G. Euphytica. Ann Plant Physiol. F. Fu. R.. and Tingey. and Hemleben.B. D. S.. 91: 893-898. Livak..G. Totowa.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era cajan (L. Nucleotide Sequence of the 18s–25s spacer region from rDNA of mungbean. X. Yang.. A.. Ind.) Millsp. Zhuang.R. Development of cytoplasmic nuclear malesterility system in pigeonpea using C. L. R.).G.. 22: 160-162. In: Krawetz S.J. J..S. Liu. K. Saxena. Reddy.B. 14: 122-115. and Sala. D. J. capitata). Plant Mol Biol. Li. First record of cytoplasmicgenic male-sterility system in pigeonpea (Cajanus cajan (L.P. Cytoplasmic male–sterility in pigeonpea with cytoplasm from Cajanus volubilis. Sun. B. Nucl Acids Res. J Genet. 112: 267-273. maintainer (B) and restorer (R ) lines. Amplification profile of the male sterile (A) line specific marker obtained using the SCAR primer PMS2F and PMS2R in pigeonpea. Lane M – 100 bp ladder marker. Lanes are marked with respective male sterile (A). 296 67B M TTR2 67B 100A 100B M A A .2. Fig. Amplification profile of the male sterile (A) line specific marker obtained using the SCAR primer PMS2F and PMS2R and ITS primer ITS1F and ITS2R in pigeonpea.ë EcoRI Hind III double digest marker.1. fertile (B) restorer and (R ) lines. Lane M .Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TTR1 288A 288B 67A TTR2 100A 290A 100B 290B TTR1 288A 288B 67A Fig. Lanes are marked with respective male sterile (A). harknessii. which have played an important role in cotton improvement and Indian economy. Since 1965 in the world. convening nearly 9 million hectares of land and producing 240 Lac bales of cotton lint. H10. Katarki. CMS system is available and utilization of the system has become difficult because of non availability of genetic basis of fertility restoration. P. Cotton is an important fibre crop and India has the largest growing area in the global scenario. G. The primer OPD20 has produced three polymorphic fragments in restorer line (976R) when compared with the CMS line (JCMSK2).aridum. So far..Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era MOLECULAR TAGGING OF FERTILITY RESTORER GENE IN COTTON Amudha.H. harknessii (D2) cytoplasm and the genetics of CMS (D2) fertility restoration was studied by the RAPD analysis. J. T.Singh and B. F1 hybrid and F2 lines were amplified by using “Operon” primers. hirsutum X G. barbadense) hybrids. Nagpur. Suman.trilobum cytoplasms. about 50 hybrids by Government organizations and Private Seed Companies have been released in India. Dr. Cultivation of cotton hybrids has resulted in significant changes in quality and production. In this study. The fertility is restored by a single dominant gene (Rf). Hybrids have played an important role in cotton improvement and Indian economy. Now. several CMS lines have been developed with G. G. Introduction Cotton belongs to the genus Gossypium that is one among eight genera under tribe Gossypieae and family Malvaceae.e. two practically usable sources of cytoplasmic genic male sterility have been identified. The first source is wild diploid species i. C.B. India 297 . The Central Institute for Cotton Research.Balasubramani. G. harknessii which was identified in USA.Khadi ABSTRACT India is the pioneer country in the world for cultivation of hybrid cotton on commercial scale. Patel released the world’s first cotton hybrid H4 for common cultivation in 1970 for the Central zone and Varalaxmi in 1972 for the South zone by B. CSHH198.sturtianum and G. In cotton.Singh. The cytoplasmic genic male sterility is highly stable because it is not influenced by environmental factors. LHH 144. OPD 201000. These fragments will enable us to dissect the corresponding introgressed chromosomal segment carrying the fertility restorer gene. JKHY-1 and NHH-44 in intra hirsutum group and Varalaxmi.M. The three fragments are of 1100 bp. Since 1965 in the world. DNA from the male sterile line (JCMSK2) and restorer line (976R). G. Maharashtra. Cultivation of cotton hybrids has resulted in significant changes in quality and production. All the three RAPD markers identified could consistently distinguish between male sterile and fertile lines and they were tightly linked with Rf1 locus. F2 lines of the cross between the CMS and fertility restorer lines were amplified with random decamer primers. DCH-32 and TCHB-213 are interspecific (G. Cytoplasmic genic male sterility (CGMS) was first reported by Meyer (1975) and she has also identified a source for fertility restoration. cotton hybrids cover about 45% of total cotton area and contribute 55% to the national cotton production. These three polymorphic fragments were also observed in F2 lines which possessed fertility restoration gene (Rf1) in them. and OPD 20800. 1000 bp and 800 bp in size and designated as OPD 201100. In India cultivation of hybrids has made tremendous impact on cotton production. G. In India the most popular hybrids are H8. 100 mM dNTPs (Bangalore Genei Ltd. cytoplasmic male sterile line (JCMSK2) and restorer line (976R) and their F1 and F2 lines was isolated following the protocol of Paterson et al.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era second source is again a diploid species which was identified in India by Meshram et al. 1000bp and 800 bp sizes and designated as OPD201100. USA. with 10 primers the amplified products did not show any uniform amplification. F1 hybrid and F2 lines were used in the present investigation. These three polymorphic fragments were also found in F2 fertile lines being introgressed from R line restoring the fertility in them. Materials and Methods Plant materials: The cross between the CMS line and restorer line.5%(w/v) agarose gel electrophoresis and run in 1XTBE buffer. Zhang and Stewart (2001a). Nine primers amplified the products but smearing of the DNA fragments was seen.02 M MgCl2. the PCR reaction mixture contained 2 mI (12. (1994) i. USA. Bangalore.05 M KCl.. OPD 20. JCMSK2 (CMS) X 976R (Restorer).8% agarose gel electrophoresis before diluting the DNA to about 50-100 mg/ml for PCR analysis.e. Genomic DNA from fresh leaves of parents i. DNA isolation chemicals were obtained from Sigma. and oligonucleotide primers from Operon technology Alameda.e.e. 1. G. The quality and quantity of the DNA were checked by running on a 0. Zhang and Zhang (1995) reported male sterility and fertility restoration was controlled by single recessive gene. Nine primers did not amplify any of the DNA samples. OPD201000.5 ng) of DNA. Liu et al (2003). The amplified products were resolved on 1..0 unit of Taq DNA polymerase (Bangalore Genei Ltd. However. F1 hybrid and F2 lines was amplified by using “Operon” primers of OPA.. In the present study. California. Bangalore. stained with ethidium bromide and the gels were photographed. India) and amplified in Bio-Metra Thermal cycler for 45 cycles of 1 min at 940 C. Results and Discussion Fertility restoration gene could be linked with molecular markers using RAPD analysis. OPC. Weaver and Weaver (1977) studied the inheritance of pollen fertility restoration in cytoplasmic male sterile upland cotton and inferred that a single gene probably expressing partial dominance control fertility restoration. Zhang and Stewart (2004) reported that one dominant gene controls the CMS fertility restoration in cotton. Later. 0. Eleven primers could not produce scorable polymorphic bands whereas 20 primers produced monomorphic products. Polymerase Chain Reaction The DNA from the cytoplasmic male sterile line (JCMSK2) and restorer line (976R) and their F1 and F2 lines was used as a template for PCR amplifications. Mumbai. with an initial denaturation step of 4 min at 940 C and a final synthesis step of 10 min at 720 C and then held at 40 C. one primer OPD 20 could produce reproducible polymorphism among the CMS and restorer lines. 0. 0. Bangalore. For RAPD analysis. .. India and the DNAAmplification kit from Bangalore Genei Ltd. aridum (D4). Hi media Ltd. The three fragments are of 1100 bp. (1994). harknessii (D2) cytoplasm and the fertility restoration was studied by the RAPD analysis. OPD and OPF series... 1 min at 350 C and 2 min at 720 C. India). India. The primer OPD 20 has produced three polymorphic fragments in restorer line (976R) which were not produced in the CMS line (JCMSK2) as shown in Plate 1. F2 lines of the cross between the CMS and fertility restoring lines were also amplified with the same random decamer primer i. Out of 60 primers used. we have used G. DNA from the male sterile line (JCMSK2) and restorer line (976R).2 mM 298 primer.. This fragment will enable us to dissect the corresponding introgressed chromosomal segment carrying the fertility restorer gene. All the three RAPD markers identified could consistently distinguish between male sterile and fertile lines and they were tightly linked with Rf1 locus. Our results coincide with Zhang and Stewart (2004) who has developed molecular markers closely linked to the restorer genes of the two independent dominant restorer genes. Zhang et al. 1991). They could get 3:1 299 Mendelian ratio when restored F1 plants with D8 cytoplasm were pollinated by their reciprocal F1’s with normal cytoplasm. B and D8R lines in the CMSD8 system are designated as for A (rf2 rf2). D8R (Rf2 Rf2). at a distance of 2. (1999) experimented on molecular mapping of CMSD8 restoration and gene cloning specific to D8 restorer in cotton. pyramiding of restorer genes. Lan et al. (1991) and the segregation of the fertility restoration shows the expected dominant nature of the RAPD markers (Michelmore et al. (1994) reported RAPD marker linked to male fertility restorer gene for CMS associated with the cytoplasm of G. They reported that restorer gene Rf2 from the D8 restorer and the restorer gene Rf1 from the D2 restorer are tightly linked to their respective DNA markers and they have cloned 26 cDNA fragments specific to the D8 restorer.harknessii (D2) cytoplasm has been restored by the restorer gene in the F2 generation. (2003) reported one dominant gene that controls the CMS fertility restoration in cotton. RAPD markers have been used as alternatives to cumbersome grow out test (GOT) in the identification of parents and F1 hybrid cotton (Krishna. The parental analysis of the nuclear genome has revealed Mendelian inheritance for RAPD products reported by Welsh et al. extensive test crossing. These markers are restorer-specific and should be useful in markerbased selection for developing restorer parental lines and constructing a high-resolution linkage map containing Rf1.3 cM.. They reported two RAPD and three SSR markers closely linked to the Rf1 gene and located on the long arm of chromosome 4.. B (rf2 rf2).93 cM. harknessii Brandegee (D2 genome) and Rf2 from the D8 restorer line by Bulk segregant analysis. Zhang and Stewart (2001b) studied the inheritance and genetic relationships of the D8R and D2R genes and reported that the Rf1 gene of D2 functioned sporophytically and Rf2 gene of D8 gene gametophytically and these two genes were linked with an average genetic distance of 0. harknessii in Gossypium hirsutum L. They reported one STS marker UBC 188500 linked with the restorer gene Rf1 and two markers UBC 169700 and UBC 6591500 with Rf2. identification of plants with restorer genes at early seedling stage and germplasm lines by employing marker assisted selection. Molecular tagging of fertility restorer gene in restorer lines enables the transfer of the restorer gene to a variety with desirable agronomic background without involving a sterile cytoplasm. identification of closely linked markers would help in map based cloning of fertility restorer . development of restorers with normal cytoplasm. Rf1 from the D2 restorer line transferred from G. The inheritance of the restorer gene in the F2 was in 3:1 Mendelian inheritance as the G. Pillai and Amirthadevarathinam (1998) had observed the combining ability for economic traits using CMS system in cotton. Zhang and Stewart (2001a) reported that CMS-D8 restoration in cotton is conditioned by one dominant gene (Rf 2).Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era and OPD20800. Such procedure which is independent of environmental influence on restoration. They reported genotypes of A. Liu et al. 1998). The molecular markers identified in the present study will enable the development of the elite restoring lines in cotton by marker-assisted selection. Genet.. Molecular mapping of a fertility restorer gene in basmati rice using microsatellite markers. Paper presented in Hybrid crops workshop held at Pantnagar (UP) India. F. Pillai. California. M.3. Acad.. U. DNA based markers for identification of inbred and hybrids in cotton. CMSD8 restoration in cotton is conditioned by one dominant gene. to understand the molecular nature of fertility restorer gene (Gyan et al. B. Ghongade. T. Brubaker.. B.1975. Biol... A discussion of the inheritance of Dong-A genetic male sterility and its fertility maintaining line (MB) in Upland cotton. 66: 2327. Identification of molecular markers linked to the fertility restorer gene for CMS-D8. J. Liu. W. and Paterson A H.G. Honeycutt. and Stewart. p: 1 . Guo. F. SanDiego.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era gene. J. Meshram.18: 83-86. USA. genetics and cytology. Theo. Z. M.. M. M. Rep. and Zaman. W. H. Crop Sci. Zhu. R. and Turley.1994. J. Inheritance of pollen fertility restoration in cytoplasmic male sterile upland cotton.. T. J. and Kesseli. Town and country conference center. F. L. 44: 1209 . PKV Res. J. A.. Zhang. Singh. Male sterility from Gossypium harknessii. Heredity. REFERENCES Krishna. 18: 54-58. Jr. Zhang. D. Genetics. Abstract from International plant genome Conference. G. K. L. and Amirthadevarathinam. R. Genet. Combining ability for economic traits using CMS system in cotton. B . C. A rapid method for extraction of cotton (Gossypium spp. R. J. V.. A. A.2001. Indian J. 2004. Theor. X. J. Prabhu.1217. Inheritance and fine mapping of fertility restoration for cytoplasmic male sterility in Gossypium hirsutum L. M. Karnal. 41: 283 . 17: 30-33. M. V. F.. Molecular mapping of CMS-D8 restoration and gene expression specific to D8 restoration. T. and Zhang. and Weaver.. Development of male sterile system from various sources in cotton. Welsh. J. W. Stewart. RAPD tagging of male fertility restoration gene in cotton. 1995. Meyer. R. Singh.. Memphis. and Stewart. P a r e n t a g e determination in maize hybrids using the arbitrarily primed polymerase chain reaction(AP-PCR). Plant 300 Mol.. 2001). A.88: 9828-9832. p448. 1994. I. A. Beltwide Cotton Conf. W. 106: 461-469. S . McClelland. Michelmore. Crop Sci. T. Cook. D. J. Zhang. Hereditas-Beijing. 2001a. Natl. Appl. Z. 1994. K.61 : 348-349. Sci. Zhang. and Marawar. 1998.J. Crop Breeding. R. F.. 1998. Paterson. Zhang. genetics and cytology. 41: 289-294. and Stewart.) genomic DNA suitable for RFLP or PCR analysis.Identification of markers linked to disease resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregation population. M. 17: 497-499. and Wendel. V. 1977. 82: 473-476. B. Agricultural Science Digest.G. National Cotton Council. 1 9 9 1 . M. TN. . USA. Proc. J. 2003.288. Weaver. Zhang. J. Lan. J. C... Paran. T. Proc. Appl. Mohapatra. and S o b r a i . 11: 122-127. Gyan. L. J.1999.1991. R. Crop Breeding. P. T. H. 2001b. F. Inheritance and genetic relationships of the D8 and D2-2 restorer genes for cotton cytoplasmic male sterility. K. 5%.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Plate 1: Electrophoresis pattern of RAPD product amplified by primer OPD 20 resolved in agarose1. Lane 1: 100 bp marker Lane 2: J CMSK2 (CMS line) Lane 3: 976 R ( Restorer line) Lane 4: F1 hybrid ( J CMSK2 X 976 R) Lane 5 to 7: F2 lines( J CMSK2 X 976 R) Lane 8: Lambda (Eco RI & Hind III double digest) 301 . M. immediate effort towards the conservation of wild mulberry species is urgently needed and more so in case of M. but naturally occur in the vicinity of Himalayas and Northeastern states. alba. laevigata is available throughout India. M. Dandin ABSTRACT Wild species of the crop plants serve as sources for novel traits/genes in crop improvement programme. Hooker (1885) reported the distribution of four mulberry species in India. 135 were polymorphic (94. laevigata and M. RAPD analysis using ten informative arbitrary sequence decamer primers generated 143 discrete markers ranging from 3003400 bp.. 302 . Among them.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era ASSESSMENT OF GENETIC DIVERSITY AND INTERRELATIONSHIP AMONG WILD MULBERRY (MORUS LAEVIGATA AND M. In contrast.951 to 0. Mathi Thumilan.) is the only natural food source of the domesticated silkworm (Bombyx mori L. Nine collections of each of the two wild mulberry species from different geographical locations were assembled for assessment of DNA marker based genetic diversity.4 %) with an average of 14. India. viz. However. Based on the analysis of genetic and phenotypic variability of two wild species. Introduction Mulberry (Morus spp. V.422. indica. SERRATA) COLLECTIONS OF INDIA THROUGH DNA MARKER ANALYSIS Girish Naik . there is a need to reliably assess the genetic diversity existing in these wild mulberry populations for appropriate conservation measures. Mulberry is a group of tree species belongs to the family Moraceae. this species is introduced to Central India for its edible fruits and grown as shade trees in coffee/tea estates of South India.951 and Jowai (M. M. laevigata) and Bowali Farm (M. UPGMA clustering analysis based on combined DNA marker analysis separated these 18 collections into two distinct groups in accordance with their taxonomic status. serrata is restricted to foothills of Himalayas up to an elevation of 3000 m in North-Western India. laevigata has a wider distribution and occur through out the sub-Himalayan region to Andaman group of Islands. Two wild species of mulberry are known to occur naturally in India. B.. serrata) are truly wild in India.. The first two species are cultivated for silkworm rearing for the production of silk and widely grown in India. distributed in the temperate and subtropical regions of northern hemisphere. M.).422. Indo-Himalayan region along with Sino-Korean and Japan is considered to be the centers of origin of mulberry species (Mukherjee 1898. B.0%). serrata) were most distant with a least similarity of 0. laevigata also occurs naturally in the forest Central Sericultural Research and Training Institute.3 markers per primer. laevigata namely Jowai and Badodhi were closest with maximum similarity of 0. M. M. Bhaskar Roy and S. serrata through ex-situ and in-situ approach. The combined genetic analysis of RAPD and ISSR markers based on Dice similarity coefficient shows the wide genetic variability between the two wild species collections ranging from 0. The species is known to be frost tolerant. Hence. serrata. Of the two wild mulberry species. Morus laevigata and M. Sanchez 2000). M. Mysore – 570 008. The population of M. The ISSR screening carried out with four anchored primers which generated a total of 60 markers of which 51 were polymorphic (85. laevigata and M. serrata. M. According to Watt (1873) certain species of Morus (M. viz. Some collections of the species are resistant to termite/diseases and tolerant to salinity. The survival of both the species is under threat due to extensive deforestation and natural calamities. Hosur. (CSRTI).. Vijayan et al. M. 0. Mulberry Genomic DNA isolation. Due to environmental inconsistency and loss of natural habitats.1 mM of each dNTPs. laevigata collections of Andaman Island are saline tolerant (Chakraborti. The stock solution was diluted to uniform concentration of 10ng/ l for PCR amplification. geneticists and breeders because of its stability and easy generation of maximum information comparatively in a shorter period.S. Today. Bangalore) and 20ng of template DNA. The random primers (Table 2) were obtained from Operon Technologies Inc. (CSGRC). 50mM KCl. Bhattacharya and Ranade.5 U of Taq DNA polymerase (Genei. M. laevigata and M. PCR based markers such as RAPD’s (Williams et al. 2004). RAPD amplification PCR reactions were performed according to the protocols of Williams et al. In mulberry RAPD’s and ISSR’s have been proved successful in DNA fingerprinting of mulberry cultivars (Naik et al. . Vijayan and Chatterjee. DNA markers (Lerceteau et al. diversity and interrelationship which is very important from the point of view of their 303 utilization in crop improvement programme and conservation of these endangered species.2 ml PCR tube in PTC-200 DNA engine (MJ Research.8% agarose gel after staining with ethidium bromide solution. the species is under threat and therefore there is an urgent need to take up conservation measures both by in situ as well as ex situ approaches. Almeda.. laevigata show high phenotypic variability and interesting morphological traits. Mysore and Central Sericultural Germplasm Resources Center. purification and quantification Genomic DNA was isolated using Nucleon Phytopure Kit method (Amersham Biosciences.. This necessitates systematic studies pertaining to their distribution and diversity available in these two wild mulberry species. serrata is comparatively restricted in distribution and confined to foothills of Himalayas. M... 1990) and ISSR’s (Zietkiewicz et al. The PCR amplification was carried in a 0. U. 2. The present investigation is an attempt to study representative collections of two wild mulberry species of India for assessment of their genetic structure. UK). 1994) have the potential to screen large number of samples rapidly and provide a convenient and quick assessment of differences in the genetic composition of the related individuals and have largely overcome the problems that are associated with phenotype based grouping. assessment of genetic diversity and interrelationship among the cultivated forms and species (Awasthi et al. 1923). and are from geographically diverse source so as to represent the entire diversity available in these species. 2004. Morphological characterization has been widely employed for assessment of diversity and genetic relationship but is affected by environmental factors.. 0. 0. Materials and Methods Plant materials Nine collections each of wild mulberry – M.0 mM MgCl2.) with 20ìl reaction volumes containing 20mM Tris-HCl (pH 8. The list of the wild mulberry collections along their source and place of collection is shown in Table 1. 2002).4). USA.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era of Andaman group of Islands (Parkinson. These collections were originally obtained through exploration by the two Institutes. 1999) and termite resistant.A. serrata were assembled from the gene banks at Central Sericultural Research & Training Institute.860 C until further use in DNA isolation. 2001. The DNA was quantified on 0. The plant materials are collected from the field gene bank in the form of fresh young leaves and stored at . (1990). 2003.2 ìM primer.. 1997) have gained popularity among conservationists. 1979). Genetic distance (1-s) was calculated and a dendrogram was constructed 304 based on the similarity matrix data set by applying un-weighted pair group method of arithmetic averages (UPGMA). kit letter. All RAPD and ISSR reactions were performed twice and only reproducible bands in the range of 3500 to 300 bp were scored. where Nxy is the number of shared markers between ‘x’ and ‘y’ entries.3.2 ml PCR tube in PTC-200 DNA engine (MJ Research.). The complete amplification details are presented in Table 2. are from diverse origin and possibly represent the genetic diversity existing in the species. Amplification reactions were carried out by following cycle profiles: initial denaturation at 940 C for 5 min followed by 35 cycles at 940 C for 1min. 50 mM KCl. RAPD analysis The random primers amplified different genomic DNA segments of different wild mulberry collections and generated 143 markers in the size range of 400 – 3400 bp. 720 C for 2 min and a final 7 min extension at 720 C. ISSR Amplification The ISSR amplification was also carried out in a 0. DNA profiles generated by OPA-16 and OPC08 were shown in Fig. these two species are distinct and show significant diversity within the species.1. 1989) in 1x TAE. USA) with 20ìl reaction volume containing 20 mM Tris-HCl (pH 8.2ìM primer.1 mM each dNTPs. The number of markers obtained per primer ranging from 11 – 18 with an average of 14. Data analysis DNA banding patterns generated by RAPD and ISSR were scored as ‘1’ for the presence of marker and ‘0’ for the absence. Out of the .4%) and the rest 8 were monomorphic. PCR products were electrophoresed on 1. laevigata collections showed more variability in phenotypic traits and also adaptable to varied eco-climatic conditions. 1. stained in ethidium bromide and the gel image was recorded using the gel documentation system (Syngene. PCR products were electrophoresed on 2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Amplification reactions were carried out by following cycle profiles: initial denaturing cycle at 930C for 2 min followed by 40 cycles at 930 C for 1min. PCR amplification generated clear profiles (Fig. laevigata and seven M.0% agarose gel stained with ethidium bromide and the gel image was recorded using the gel documentation system (Syngene. However. ISSR analysis: A total of four ISSR primers belonging to UBC series (Table 3) were employed for screening the nine collections each of the two wild mulberry species. U. is naturally distributed in India. the primer number and its approximate size in base pairs. RAPD and ISSR markers were identified by the source of primers (OP for Operon and UBC for University of British Columbia). The ISSR primers (Table 3) were obtained from University of British Columbia. Nx is the total number of markers in ‘x’ entry and Ny is the total number of markers in ‘y’ entry (Nei and Li. These primers produced the amplification products in the size range of 400 – 2800 bp. Vancouver.5% agarose gel (Sambrook et al.5 mM MgCl2. Four M. 350 C for 1min. Dice similarity matrix was generated using the equation. Canada. 0. 720 C for 2 min and a final 5 min extension at 720 C. serrata species-specific RAPD markers have been identified (Table 4).K). M.K. Morphologically. 0. 2) in which number of markers amplified ranged from 819 with an average of 15 per primer.. Results Nine collections each of two wild species of mulberry. 480 C for 1min. U. A total of 135 markers were polymorphic (94. 0.5 U of Taq DNA polymerase (Genei.4). Bangalore) and 20ng of template DNA. s =2Nxy/ (Nx +Ny). 4%) in comparison with ISSR primers (85. DNA markers like RAPD and ISSR have become a handy tool for quick and reliable estimates of diversity for crop improvement and conservation programme in mulberry (Sharma et al. 51 were (85. serrata indicating a diverse genetic background of the former. As morphological traits are greatly influenced by the environment. When the collections of two species were compared simultaneously. serrata from different locations of India.894) obtained between Kothapura and Urgam-3 and minimum (0. laevigata and three M.4%). That is to say that the last two are the most diverse collections among all. the Dice coefficient of similarity among the M. 3). serrata) and Jowai (M. Jowai and Badodhi were closest with maximum similarity (95. heterogenous perennial tree species of wide phenotypic variability (Alizade et al. it is not possible to conserve the seeds under ex situ condition and are maintained in the vegetative form in the field gene bank. Based on the combined analysis of both marker systems.. serrata species-specific markers were found (Table 4) and two of the collection specific ISSR markers were identified. RAPD primers revealed more polymorphism (94. serrata.. 1994).. In case of M. serrata (Fig. laevigata). laevigata namely. it has been always problem to assess accurate genetic diversity information and interrelationship among mulberry species (Awasthi et al. 1970). 2000). 2004). UPGMA clustering based on both RAPD and ISSR marker data showed clear separation of collections into distinct species group’s viz. The percentage of polymorphism generated by ISSR primers was slightly less compared to that of RAPD (94. A total of two M.1%) and Jowai (M. laevigata collections. UPGMA clustering based on the RAPD and ISSR marker data separates the species into two distinct groups confirming their taxonomic status unambiguously and these two are geographically isolated and thriving in comparatively different habitat (Thormann et al..0%) polymorphic and the rest 9 were monomorphic. the collections of M.422).951) between Jowai and Badodhi and least (0. The mean genetic similarity was less in case of M.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era total of 60 markers generated..422) was observed in case of Bowali Farm (M. laevigata and M.613) in case of Lamia Bay and Dhar local. the maximum similarity 305 was (0.6) when both the primers were computed together. These variations between RAPD and ISSR may be due to the fact that the PCR profiles in the two marker assays originated from different repetitive and non-repetitive regions . M. laevigata) and B farm (M. Most of the primers used for DNA profiling of the wild mulberry collections generated high marker polymorphism and as many as six RAPD primers revealed 100% polymorphism. Due to high heterozygosity and dioecious nature of the species.serrata) were most distant (1-s=0. laevigata viz. laevigata collection was maximum (0.644) in case of Ramtura and Serrata. The present study has made an attempt to assess the genetic diversity among nine collections each of M. The average percentage polymorphism was (91. Jowai and Badodhi have high similarity coefficient value and minimum similarity (0. RAPD+ISSR analysis The combined genetic analysis of RAPD and ISSR markers based on Dice similarity coefficient showed the wide genetic variability among the collections of the two species. This conclusion is also supported by the large variability exhibited in morphological traits in the M. Discussion Mulberry is a cross pollinating.. laevigata collections compared to that of M.0%). The collections of M. laevigata and M. 15: 112-115.. 2004. 3: 1471– 2229 Chakraborti.Ltd. gives an insight into the broad genetic structure of these two wild species. E. DNA fingerprinting of guava (Psidium guajava L. Mulberry cultivation in coastal saline soil of West Bengal. Evaluation at the extent at genetic variability among Theobroma cacao accessions using RAPD and RFLP markers.. which are truly wild. S. J. J. Nagaraja.. Genetic Diversity and relationships in mulberry (genus Morus) as revealed by RAPD and ISSR marker assays. Mukherjee. Sathayanarayana. 23: 317 – 320. 2002. Hundova. Sarkar. D. S.K. . Thacker Spink & Co. S.D . 5: 1-9. OPC–101500. Bhattacharya.V. harbors some of the important genes for diseases (powdery mildew and leaf spot) and pest (termite) resistance (M.A.K. Li. UK. UBC–8101200.E. V. Molecular distinction among varieties of mulberry using RAPD and DAMD profiles. p: 298 Naik. 1993).G.. OPA–16650.K. Edited by Bishen Singh & Mahindra Pal Singh. W. BMC Genetics. Naik. 1898. P. A total of six M. The variation in the DNA content of the cell and chromosome at polyploidy forms of mulberry. UBC– 8112300 and UBC–8111450) and ten M.1999. L.... These two species. Indian J Genet. OPA-15650. Proc Natl Acad Sci. The PCR based techniques RAPD and ISSR are informative for evaluating the extent of genetic diversity as well as to determine the nature of genetic relationship between different species of Morus with polymorphism levels sufficient to establish informative profiles with relatively fewer primer sets. Flora of British India V. A Forest Flora of Andaman Islands. Ashford. serrata). 2002. Indian Gent... Kent..) with RAPD markers. Karihaloo. OPA–16550.. Dhera Dun 155 p. S.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era of the genome (Daiya et al. Mathematical model for studying genetic variation in terms of restriction endonucleases. Theor Appl Genet. Robert. 2002. Archak. Hooker. Petiard . UBC– 8111500 and UBC–812 1500) were identified between these two species which can be used for quick identification of the materials The present study even though has considered somewhat limited number of species samples. OPC–081600. 38: 5-7...) cultivars using RAPD markers. 2003). K. . saline tolerance (M. 1979. M. T. Ranade. K. Nagarajau. Thangavelu. India. REFERENCES Alizade. Nei. laevigata (OPA-071450. Calcutta. C. laevigata collections of Andaman Islands) and frost tolerance (M. Caryologia. 91-493 p. 95: 10 –19. M.G. Resou. 2001. A. J .1885. G. Handbook of Sericulture.. A. A. Kanginakudru.. Reev & Co. OPA–162800.. V. N. OPC–08750.L. The ISSR profiles generated by anchored primers revealed that these repeats are abundant in the Morus genome (Vijayan and Chatterjee.. Lerceteau.A.H. Parkinson. Indian silk. 62: 193–196. 1997. BMC plant Biology. N. serrata species-specific markers (OPA–092000. 306 Awasthi. Crouzillat. 1970.. laevigata collections).M. DNA fingerprinting of Mysore local and V-1 Cultivars of mulberry (Morus sp. 76: 5269-5273. OPC-052900. Daiya. The information generated from the study will be useful for further in depth analysis of these endangered species towards utilization in mulberry improvement and conservation programme. E. OPA– 12750. which can be exploited in mulberry improvement programme. 1923. Wu and Tanksley. Morus (L).G. The East House Book. Tingey.. 2000.C. K. Genome. No. serrata M. Awasthi. Fritsh. 1994. Uttaranchal Kothapura. serrata M. 4. World Animal Review 93 p. Periodical Experts.N. K. laevigata M. polymorphism and genetic mapping of microsatellites in rice. laevigata M. laevigata M..A. Uttaranchal Sirari. Table 1. L. 66-67 p. Madhya Pradesh Jowai. E.P.A.. 13. Camargo. 16. 1990. T. 17. ISSR profiling Genome finger printing by simple sequence of Indian cultivars of mulberry (Morus spp. J. Nucleic Acids Res... M.F. laevigata M.D. Assessment of genetic diversity in a Morus germplasm collection using fluorescencebased AFLP markers. 183. A. 88: 973-980. S. A Dictionary of economic products of India. Analysis of phylogenetic relationship among five mulberry (Morus) species using molecular markers. J.. 18: 6531-6535. Sharma. DNA polymorphism amplified by arbitrary primers are useful as genetic markers.S. New York. Genomics 20: 176Euphytica. Tivang. Uttaranchal Lanthura Farm.D. New Delhi. S. 8. 1993.K. Cold Spring Harbor. J.. serrata M. List of wild mulberry collections utilized in the study Sl. Sanchez. M. Doomar Nali. A. Comparison of RFLP and RAPD markers to estimating genetic relationships within and among cruciferous species. 1994.A. S. laevigata M. Vijayan. 101: 1049 – 1055. E.E.E. 2004. J. laevigata M. Rafalski. Theor Appl Genet. 2. serrata M. serrata M... Manipur Yercaud–2. Zietkiewicz. 1989. 2000. Rafalski. laevigata M. 7. 14. Karnataka Dhar Local (unlobed).G... Saravathi Tea Estate.. G. J. Species M. Kubelik . India. 6..V. Madhya Pradesh Nao Kurkul. Chatterjee. Molecular Cloning: A laboratory manual. Uttaranchal Bowali Farm. C. K. 1.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Sambrook.. Uttar Pradesh Dogrragao. A.Vol. 18. 131: 53-63. Andaman & Nicobar Is. 241: 225-235. Williams. Vijayan.) repeat (SSR-) anchored polymerase chain and its relevance to breeding programs. 47: 439 – 448. 11. 3. 1873. 9. Uttaranchal Ramtura. Andaman & Nicobar Is. reaction amplification. Uttaranchal 307 . Tamil Nadu Badodhi. serrata M. Uttar Pradesh Urgam-3. Mulberry an exceptional forage available almost worldwide. Cold Spring Harbor Laboratory Press.G..4.. Livak. Uttaranchal Mussori. P. Meghalaya Lamia Bay. T. 15. Osborn. Ferreira. D. laevigata M. serrata M. West Bengal Serrata. 10. Sharma. 5. Wu. laevigata M. R. serrata M. Maniatis. Labuda... Abundance.E. H.R. Theor Appl Genet. serrata Name of the collection/place Birds Foot. Srivastava. Machii. Thormann. Watt. Mol Gen Genet. 12. 2003. Tanksley. 3 84. UBC–8101200.0 100. 10. 7.0 94. OPA-15650. OPA– 07 OPA– 09 OPA– 10 OPA– 12 OPA– 15 OPA– 16 OPC– 05 OPC– 08 OPC– 09 OPC– 10 -gaaacgggtg-gggtaacgcc-gtgatcgcag-tcggcgatag-ttccgaaccc-agccagcgaa-gatgaccgcc-tggaccggtg-ctcaccgtcc-tgtctgggtgTotal 15 11 14 11 12 18 18 17 12 15 143 100. 4. List of random primers used in the study along with marker polymorphism Sl. No 1 2 Name of the species M.810 UBC. UBC–8111500. 4. 8. UBC–8111450 OPA–092000.812 -agagagagagagagagt-gagagagagagagagat-gagagagagagagagac-gagagagagagagagaaTotal 18 15 19 08 60 3 1 3 2 09 15 14 16 06 51 83.9 100.807 UBC.3 93. Name of the primer Sequence (5’-3’) Total no. of polymorphic markers 15 11 13 11 08 16 18 16 12 15 135 % of polymorphism 1.0 85. List of ISSR primers used in the study along with marker polymorphism Sl.0 92.2 75. 6. of of markers monopolymorphic morphic markers markers % of polymorphism 1. No. laevigata M. 2. 3. UBC. serrata Species-specific markers OPA-071450.0 66. of monomorphic markers 0 0 1 0 4 2 0 1 0 0 08 Total no. List of species-specific markers identified Sl. of Total no.811 UBC. UBC–8121500 308 .9 100. 2. 9.0 100.4 Table 3.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 2.0 94. No. Total no. OPA–16650.0 Table 4. OPA–12750. OPC–101500.7 88.1 100. UBC–8112300. OPC–081600. OPA–162800. Name of the primer Sequence (5’-3’) Total no. of markers Total no. OPA–16550. 3. OPC–08750. OPC-052900. 5. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 309 . Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era USE OF SSR MARKERS FOR THE IDENTIFICATION OF INTERSPECIFIC AND INTERGENERIC HYBRIDS OF SACCHARUM Vijayan Nair, N., A. Selvi, S. Suresh Ramraj and K. Sundaravel Pandian ABSTRACT The use of the wild species and the related genera of Saccharum in sugarcane varietal improvement have been well recognised. Genetic improvement in Sugarcane has been initially brought about through interspecific hybridization involving the cultivated (S.officinarum and S.barberi) and the wild species (S.spontaneum and S.robustum) of Saccharum. Saccharum is crossable with several of the related genera and intergeneric hybrids of Saccharum with Erianthus, Miscanthus, Narenga and Sclerostachya had been produced in the past. The wild species of Saccharum and the related genera are considered to be potential sources for genes conferring high productivity and resistance to biotic and abiotic stresses. Consequently considerable efforts are being made to introgress the genes of importance from the wild sources to sugarcane through interspecific and intergeneric hybridisation. Though there are no crossability barriers among the different species of Saccharum and also between Saccharum and the related genera, interspecific and intergeneric crosses are relatively difficult to perform and very often it is difficult to distinguish the true hybrids from the selfs among the progeny arising from such crosses. The hybrids largely resemble the sugarcane parent in gross morphology and it will be practically difficult to distinguish the hybrids based on their morphological attributes. In this context, the use of species and genus-specific molecular markers have been found to be useful in identifying genuine hybrids among the progeny of interspecific and intergeneric hybrids of Saccharum. In the present study, the potential of SSR markers to identify genuine hybrids of Saccharum from interspecific and intergeneric crosses was examined. Fifty putative hybrids from S.robustum x Erianthus and S.officinarum x Erianthus crosses, 30 progenies from S.robustum x S.spontaneum crosses, one progeny each from Sclerostachya x S.officinarum and Sclerostachya x S.spontaneum crosses were screened using 10 sugarcane and 5 Sorghum microsatellite markers. Parental polymorphism was studied with respect to the markers generated and compared with that of the progenies. Forty six of the Saccharum x Erianthus progenies showed markers specific to Erianthus, confirming their hybridity. Among the 30 progenies of S.robustum x S.spontaneum, 21 showed markers specific to the spontaneum parent and were found to be genuine hybrids. The hybridity of the Sclerostachya x S.officinarum hybrid was also confirmed based on the presence of the markers representing both parents. The study clearly establishes the potential application of SSR markers in the identification of interspecific and intergeneric hybrids of Saccharum. Introduction Sugarcane, a highly heterozygous polyploid plant with an estimated genome size of 10,000 Mbp, remains the most complex and least characterized of the crop plants. Modern sugarcane cultivars (Saccharum spp. 2n = 110 - 130) have been evolved through interspecific hybridisations involving Saccharum officinarum L. and Saccharum spontaneum L. Only few parental clones have been used in the original crosses and recent studies indicate a narrow genetic base of the present day cultivars. Genetic improvement of this complex crop is principally through introgression of wild species and related genera, grouped under the Saccharum complex (Daniels et al., 1975). Biotechnology Laboratory, Crop Improvement Division, Sugarcane Breeding Institute, Coimbatore. 310 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era The Saccharum complex constituted by five genera viz., Saccharum L., Erianthus Sect Ripidium Henrad, Sclerostachya A.Camus, Narenga Bor and Miscanthus Andress form a closely related inbreeding group. Different species of Saccharum include three cultivated species viz., S. officinarum L., S. barberi Jeswiet, S. sinense Roxb. and the wild species of S. spontaneum L., S. robustum Brandes and Jeswiet ex Grassl and S. edule Hassk. Different species of Saccharum are intercrossable and they are also crossable with other genera of Saccharum complex. Saccharum officinarum, the noble cane, is rich in sucrose but poor in yield and also lacks adaptability to adverse environment. In contrast the wild species are important sources for productivity and adaptability though they lack sucrose. The progress in sugarcane improvement had been achieved by introgressing the genes contributing high productivity and adaptability into the genetic background of Saccharum officinarum. Several interspecific and intergeneric hybridisations involving Saccharum and other genera had been carried out in the past (Bremer 1961, Price, 1968a, Price 1968b, Li et al., 1948, Janakiammal, 1941). Selfing is common in sugarcane crosses and it is particularly so in interspecific and intergeneric combination. As the hybrids and selfs are similar in morphology (Gill and Grassl, 1986) it becomes difficult to identify the genuine hybrids among the progenies of such crosses. Molecular markers have been found to be useful in this context. Different types of markers, like the 5S-rDNA spacers (D’Hont et al., 1995, Pan et al., 2001), AFLPs (Selvi et al, 2006), RAPDs (Nair et al., 2004) and microsatellites (Pan et al., 2004) that are specific to individual species and genera of Saccharum complex have been developed for characterising intergeneric and interspecific hybrids of Saccharum. The present study was carried out 311 with the objective of developing microsatellite markers and to assess their suitability in identifying intergeneric and interspecific hybrids of Saccharum. Materials and methods A set of intergeneric and interspecific hybrids from crosses involving S. officinarum X Erianthus, Erianthus X S. officinarum, S. robustum X Erianthus, Erianthus X S. robustum, Sclerostachya X S. officinarum, Sclerostachya X S. spontaneum, S. robustum X S. spontaneum formed the material for the study. The details of the hybrids and their parentages are listed in Table 1. DNA extraction and microsatellite amplification DNA was extracted from the young leaves of the plants grown in field as per Walbot et al. (1988), and quantified on 0.8% agarose gels. Ten microsatellite primers developed from genomic libraries of sugarcane (Rossi et al., 2003) and five sorghum microsatellite primers (Brown et al., 1996) were used for the study (Table 2). PCR reactions were conducted on a PTC 100 programmable thermal cycler (MJ Research, Inc). Amplifications were carried out in a 15l reaction mixture containing, 20 ng of DNA, 1.5 mM dNTPs, 10mM Tris- HCl (pH 9.0 at 25°C), 1.5mM MgCl2, 50mM KCl, 0.01% gelatin, 10ng each of forward and reverse primers, 1 unit of Taq DNA polymerase (Bangalore Genei) with an overlay of one drop of mineral oil. The thermal cycler was programmed for initial denaturation of 94OC for 5 min, followed by 30 cycles of 94OC for 1min, 54OC for 1 min, 72OC for 1 min with a final primer extension at 720C for 5min. Five l of the amplified product was loaded on a 5% polyacrylamide gel and electrophoresed in 1X TBE buffer at 150 V for 2 hrs. The gels were silver stained (Sanguinetti et al., 1994) and documented in Syngene bio imaging using the Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Gene snap software. Identification of species and genus specific markers In cross combinations involving Saccharum X Erianthus and Saccharum X Sclerostachya the Saccharum derivation of the progenies is never in doubt, since all of them resemble Saccharum in gross morphology. The hybrids in these crosses have to be differentiated based on the presence of Erianthus or Saccharum characteristics. Two sets of DNA bulks were constituted for initial screening of the two genus. Erianthus bulks was constituted by DNA from five clones of Erianthus spp while Saccharum bulks was constituted by DNA from five clones of S. robustum and five clones of S. officinarum. The two sets of bulks were screened with 10 Sugarcane and 5 Sorghum microsatellite primers. Primers showing bulk specific amplifications with respect to Erianthus were further confirmed on individual DNAs that constituted the DNA bulks. Details of the primers used are listed in table 2. For identifying Sclerostachya specific markers initially two sets of DNA bulks were constituted. DNA from five clones of Sclerostachya formed the bulk DNA of the genus while DNA from two clones of S. officinarum and two clones of S. spontaneum formed the bulk DNA of Saccharum. These DNA bulks were amplified with 10 sugarcane microsatellite primers. Primers that amplified Sclerostachya specific fragments in the bulks were validated on the individuals that constituted the respective bulks. Result and Discussion Genus and species specific markers To identify Erianthus specific markers three DNA bulks were constituted with five individuals each of Erianthus, S. officinarum and S. robustum. Ten sugarcane microsatellite primers and five Sorghum microsatellite primers were used to screen the bulks. Of the fifteen primers 312 used all of them amplified the S. officinarum and S. spontaneum bulks whereas only four primers Viz., Sb6-57, Sb6-84, MSSCIR43 and MSSCIR57 amplified the Erianthus bulks. Complex profiles were observed in the Saccharum bulks whereas Erianthus amplified lesser number of fragments. An average of 7.02 and 7.20 fragments per primer was observed in S. officinarum and S. robustum whereas Erianthus amplified an average of 1.75 fragments per primer. Similar results were obtained in earlier studies where EST derived sugarcane and maize microsatellite primers were found to amplify lesser number of fragments, that too monomorphic, in Erianthus compared to Saccharum (Cordeiro et al., 2001, Selvi et al., 2003). The bulk profiles of the two Saccharum species were compared with the Erianthus bulks to identify markers specific to the genus. A single primer Sb6-84 amplified a marker of the size 140 bp that was present in Erianthus and absent in the Saccharum bulks. The Erianthus specific marker was further validated in the bulk individuals. The five clones of Erianthus that were used to constitute the bulks showed the presence of the fragment whereas the Saccharum clones did not amplify the marker confirming its specificity to Erianthus (Fig.1). Several Erianthus specific markers have been identified using low and medium copy repeat sequences (Besse and McIntyre 1998), Satellite DNA sequence (Alix et al., 1998), 5S rDNA spacers (Besse et al .,1996, Piperidis et al., 2000), Inter-Alu sequences (Alix et al., 1999), maize microsatellites (Selvi et al., 2003), RAPD and ISSR markers (Nair et al., 2004) and AFLP markers (Selvi et al., 2006). In order to identify markers specific to the genus Sclerostachya ten sugarcane microsatellite primers were used to screen the DNA bulks of Scelrostachya, S. officinarum and S. spontaneum. Unlike in Erianthus all the primers used showed amplifications in Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Sclerostachya. The total number of fragments amplified in Sclerostachya was 52 with an average of 5.2 fragments per primer. S. officinarum and S. spontaneum amplified a total of 63 and 51 fragments with an average of 6.3 and 5.1 fragments per primer respectively. Among the related genera Sclerostachya, Narenga and Miscanthus are closely related to Saccharum and they form a monophyletic group (Sobral et al., 1994 and Nair et al., 1999). Erianthus is considered to be highly divergent from this group. This could explain for the complete cross transferability of sugarcane microsatellites in Sclerostachya, when compared to 20% cross transferability in Erianthus. Of the ten primers used to screen the bulks, a single primer MSSCIR-57 amplified a fragment of 100 bp length that was specific to Sclerostachya. In addition, the same primer also amplified a 50 bp fragment specific to both Saccharum sp and absent in Sclerostachya. Validation of these markers on individuals that constituted the respective bulks showed that they are specific to the respective genera. Identification of genus and species specific markers would greatly facilitate the identification of interspecific and intergeneric hybrids and could be effectively used in the introgression of wild species in sugarcane improvement program. (Alix et al., 1999 and Nair et al., 2004). Characterization of Intergeneric hybrids Fifty putative intergeneric hybrids viz., 26 S. officinarum X Erianthus hybrids, 12 S. robustum X Erianthus hybrids, 3 Erianthus X S. officinarum hybrids and 9 Erianthus X S. robustum hybrids were screened along with their respective parents using the primer Sb6-84. Of the fifty putative hybrids, 46 hybrids amplified the Erianthus specific fragment of 140 bp. A set of eight Erianthus X S. robustum hybrids amplifying the Erianthus specific fragment is shown in Fig. 2. Four hybrids from the S. officinarum X Erianthus cross did not amplify 313 the Erianthus fragment and they could be selfs. In an early study of four Saccharum X Erianthus hybrids using RAPD markers, it was reported that no single primer can effectively identify all the Saccharum X Erianthus hybrids (Nair et al., 2004). In the present study, it was found that a single microsatellite primer could identify 46 out of 50 suspected hybrids, and this could be used as a more efficient marker for identifying intergeneric hybrids of Saccharum. Intergeneric hybrids, one each from Sclerostachya X S. officinarum and Sclerostachya X S. spontaneum crosses were screened with sugarcane microsatellite primer MSSCIR 57 which showed Sclerostachya specific amplification in the bulk DNA. The Sclerostachya X S. officinarum hybrid was morphologically closer to sugarcane and hence its S. officinarum origin was not in doubt. This hybrid amplified a Sclerostachya specific fragment of 100 bp and a 50 bp fragment of S. officinarum thus confirming its hybridity (Fig. 3). The progeny from Sclerostachya X S. officinarum cross, amplified a 50 bp fragment from S. spontaneum. Since S. spontaneum is the male parent in this cross the presence of Saccharum specific fragment in the hybrid confirmed its hybridity. Characterisation of interspecific hybrids Thirty interspecific hybrids developed from a cross between S. robustum and S. spontaneum (PIR 00 1188 X IND 99 904) were screened with ten sugarcane microsatellite primer and two sorghum microsatellite primers (Sb1-10 and Sb6-84). The primer MSSCIR 66 identified a 750 bp fragment in S. spontaneum (IND 99 904) and three fragments of 400 bp, 350 bp and 250 bp in S. robustum (PIR 00 1188). Of the two sorghum microsatellite primers used Sb1-10 amplified a 700 bp fragment in S. spontaneum (IND 99 904) and four fragments of sizes 500, 450, 400 and 300 bp in S. robustum (PIR00 1188). Both these Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era primers were used to screen the thrity hybrids along with the parents. Primer MSSCIR 66 amplified the S. spontaneum specific fragment (750 bp) in 21 hybrids. Since S. robustum was used as the female parent in the cross, the presence of S. spontaneum (male parent) fragments in 21 progenies indicate that they are genuine hybrids. The primer Sb1-10 amplified the S. spontaneum specific fragment 700 bp) only in 9 clones and has less specificity. Pan et al., (2004) used RAPD markers in characterizing hybrids involving S. spontaneum and showed that 37.5% and 52.1% of the progenies from two crosses inherited the S. spontaneum specific markers. The present study reveals the potential use of microsatellite markers in the characterization of intergeneric and interspecific hybrids of Saccharum. These markers could identify 92% of the hybrids involving Erianthus, both the hybrids of Sclerostachya and 70% of the hybrids involving S. robustum X S. spontaneum. Evidently microsatellite markers can be effectively used in monitoring the introgression of wild species and related genera in sugarcane improvement. Acknowledgements This research was carried out with the financial support from the Department of Biotechnology, Government of India, which is gratefully acknowledged. Thanks are due to Director, Sugarcane Breeding Institute for providing the facilities. REFERENCES Alix, K., Baurens, F.C., Paulet, F., Glaszmann, J.C. & D’Hont, A. 1998. Isolation and characterization of a satellite DNA family in the Saccharum complex. Genome 41: 854-864. Alix, K., Paulet, F., Glaszmann, J.C., D’Hont, A. 1999. Inter-Alu like sequences in Saccharum complex. Theor Appl Genet. 314 99: 962-968. Besse, P.M.c., Intyre, C.L., Berding, N. 1996. Ribosomal DNA variations in Erianthus, a wild sugarcane relative (Andropogonae - Saccharinae). Theor Appl Genet. 92: 733-743. Besse, P.M.c., Intyre, C. L. 1998. Isolation and characterization of repeated DNA sequences from Erianthus spp. (Saccharinae : Andropogonae). Genome. 41: 408-416. Bremer, G. 1961. Problems in breeding and cytology of sugarcane.II.The sugarcane breeding from a cytological viewpoint. Euphytica. 10: 121-243. Brown, S.M., Hopkins, M.S., Mitchell, S.E., Senior, M.L.,Wang, T.Y., Duncan, R.R., Gonzalez-Candelas, F., Kresovich, S. 1996. Multiple methods for the identification of polymorphic simple sequence repeats (SSRs) in sorghum [sorghum bicolor (L.) Moench]. Theor Appl Genet. 96: 190-198. Cordeiro, G.M, Casu R, McIntyre C.L, Manners, J.M, Henry R.J. 2001. Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to Erianthus and sorghum. Plant Science. 160: 1115-1123 Daniels, J., Smith, P., Paton, N., Williams, C.A. 1975. The origin of the genus Saccharum. Sugarcane Breed. Newsl. 36: 24-39 D’Hont ,A., Rao, P.S., Feldman, P., Grivet, L., Islam-Faridi, N., Taylor, P. & Glaszmann, J.C. (1995). Identification and characterization of sugarcane intergeneric hybrids, Saccharum officinarum X Erianthus arundinaceus, with molecular markers and DNA in situ hybridization. Theor. Appl. Genet. 91: 320-326. Gill, B.S., Grassl, C.O. 1986. Pathways of genetic transfer in intergeneric hybrids of sugarcane. Sugar cane. 2-7 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Janaki Ammal, E.K. 1941. Intergeneric hybrids of Saccharum. J. genet. 41: 217-253 Li H, W., Loh, C.S., Lee, C.L. 1948. Cytological studies of sugarcane and its relatives. I. Hybrids between Saccharum offici narum, Miscanthus japonicus and Saccharum spontaneum. Bot. Bull.Acad.sin.(Taipei). 2: 147-160. Nair, N.V., Nair, S., Sreenivasan, T.V. & Mohan, M. 1999. Analysis of genetic diversity and phylogeny in Saccharum and related genera using RAPD markers. Genetic Resources and Crop Evolution. 46: 73-79. Nair, N.V., Selvi, A., Sreenivasan, T.V., Pushpalatha, K.N., Sheji Mary, 2004. Charecterization of intergeneric hybrids of Saccharum using molecular markers. Genetic resourses and crop evolution. 17. Pan, Y.B., Burner, D.M., Wei, Q. 2001. Developing species-specific DNA markers to assist in sugarcane breeding. Proc.int.soc.Sugar cane Technol. 24: 337342 Pan Y.B, Burner D.M, Wei Q, Cordeiro G.M, Legendre B.L, Henry R.J. 2004. New Saccharum hybrids in S.spontaneum cytoplasm developed through a combination of conventional and molecular breeding approaches. Plant Genetic Resources. 2: 131-139. Piperidis, G., Christopher, M.J., Carroll, B.J., Berding, N., D’Hont, A. 2000. Molecular contribution to selection of intergeneric hybrids between sugarcane and the wild species Erianthus arundinaceus. Genome 43: 1033-1037. Price, S., 1968a. Chromosome transmission of Saccharum robustum in interspecific crosses. J.Hered. 59: 245-247. Price, S., 1968 b. Cytology of Chinese and north Indian sugarcanes. Econ.Bot. 22:155-164. Rossi, P., Araujo, P.G., Paulet, F., Garsmeur, Dias, V.M., Chen, H., Van sluys, M.A., D’Hont, A. 2003. Genomic distribution and charecterization of EST-derived resistance gene analogs (RGAs) in sugarcane. Mol Gen Genomics. 269: 406-419 Sanguinetti, C.J., Dias Neto, E., Simpson, A.J.G. 1994. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. Biotechniques.17: 915-202. Selvi ,A., Nair, N.V., Balasundaram, N., ohapatra, T. 2003. Evaluation of maize microsatellite markers for genetic diversity analysis and fingerprinting in sugarcane. Genome. 46: 394 - 403. Selvi, A., Nair, N., Noyer, J.L., Singh, N.K., Balasundaram, N., Bansal, K.C., Koundal, K.R. and Mohapatra, T. 2006. AFLP analysis of the phenetic organization and genetic diversity in the sugarcane complex, Saccharum and Erianthus. Genetic resources and crop evolution. In press. Sobral, B.W.S., Braga, D.P.V., Lahood, E.S., Keim, P. 1994. Phylogenetic analysis of chloroplast restriction enzyme site mutations in the Saccharinae Griseb. subtribe of the Andropogoneae Dumort. tribe. Theor. Appl. Genet. 87: 843-853. Walbot, V.1988. Preparation of DNA from single rice seedlings. Rice Genet.News.5: 149-151 315 Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Table 1. Details of the Hybrids used in the study Intergeneric / Interspecific Crosses S.robustum X Erianthus Erianthus X S.robustum Parentage PIR 00 1188 X IK 76 91 IND 90 772 X PIR 98 937 IND 90 772 X PIR 00 1044 IND 90 776X PIR 00 1044 IND 90 776 X PIR 96 435 PIO 96 443 X ERI 2385 PIO 98 297 X IK 76 91 PIO98 1115 X IK 76 93 PIO 96 436 X IK 76 91 PIO 88 1715 X IMP 1547 CoC 671 X IMP 1547 Co 7201 X IK 76 91 CoC 671 X IK 76 91 Co 87009 X IK 76 48 Gu 98 1640 X IK 76 91 IND 90 776 X PIO 96 435 IND 90 828 X PIO 00 847 Sclerostachya X PIO 00 444 Sclerostachya X IND 99 904 PIR 00 1188 X IND 99 904 No of hybrids 12 4 2 2 1 1 1 2 7 1 7 2 2 1 1 1 1 1 1 30 S.officinarum X Erianthus Erianthus X S.officinarum Sclerostachya X S.officinarum Sclerostachya X S.spontaneum S.robustum X S.spontaneum Table 2. Details of the microsatellite primers used in the study Primer Name Sugarcane Microsatellite primers MSSCIR 43 MSSCIR 44 MSSCIR 50 MSSCIR 57 MSSCIR 58 MSSCIR 61 MSSCIR 63 MSSCIR 66 MSSCIR 68 MSSCIR 71 Sb1-10 Sb4 -32 Sb5-236 Sb6-57 Sb6-84 ATTCAACGATTTTCACGAGAACCTAGCAATTTACAAGAG TCCCTCCTCATCACTCTGAAAATAAGCACCAAAAGC GGTCCTCTACTTTGCTTTATGTCCAATGAGCCTAATCTAT CTTCTTCTTCTCCTGGTAATGATCGGTAATATAATGGC CTCACTCAGGCACAAGAATTGGGGTCTAACAATCAACT CCCCATTTCTCCGTTACCGCCACCACCAACCTCATCTCC AGACCATGTTTGCTACGGTCACTAATCGGGAGAGACG AGGTGATTTAGCAGCATACACAAATAAACCCAATGA CGTCTCTATGCACCCTATCGCCTTCTTTTGTTTTCCTC GATTGGATTTGTGATGTAACCTTCCTGATTTCTGATT GTGCCGCTTTGCTCGCATGCTATGTTGTTTGCTTCTCCCTTCTC CTCGGCGGTTAGCACAGTCACGCCCATAGACAGACAGCAAAGCC GCCAAGAGAAACACAAACAAAGCAATGTATTTAGGCAACAACACA ACAGGGCTTTAGGGAAATCGCCATCACCGTCGGCATCT CGCTCTCGGGATGAATGATAACGGACCACTAACAAATGATT 316 Sequences Sorghum microsatellite primers Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 317 . IND 01 1100. Lanes 2-6 . Figure:2 Caption: Erianthus specific fragment amplified by primer Sb6-84 in 8 of the Eriathus X S. Legends: Lanes 1-5 . spontaneum (IND 99 904. SES 228.robustum hybrids. Lanes 8&9 . NG 76-436. spontaneum hybrid. Lanes 10&11. Figure:3 Caption: Sclerostachya specific fragment amplified by primer MSSCIR 57 in Sclerostachya and in Sclerostachya X S.S. Lanes 3-10 . SES 240. Tofuna fal). The arrow indicates Erianthus specific fragment of 140bp amplified by primer Sb6-84 in the Erianthus parents and in Eriathus X S. robustum hybrids. Sclerostachya 3. Lane 7 .officinarum (PIO 00 444. NG 77-24.S. The arrow indicates Eriathus specific fragment of 140bp size amplified by primer Sb6-84 in individuals consituting the Erianthus bulk. Sclerostachya 2.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Figure :1 Caption: Erianthus specific fragment (marked with arrow) amplified by Primer Sb6-84 Legend: Lane 1. IND 99 928). The arrow indicates Sclerostachya specific fragment of 100bp amplified by primer MSSCIR 57 in Sclerostachya and Sclerostachya X S. PIR 00 1044). robustum hybrids Legends: Lanes 1&2 . Lanes 7-11 . Lane 6 .Sclerostachya (Sclerostachya 1. IJ 76 327).Sclerostachya X S.robustum clones (NG 77-23. IND 90 776).officinarum hybrid. officinarum hybrid.Erianthus parents (IND 90 772. Lanes 11&12 . robustum parents (PIR 98 937. IJ 76-414). NG 77-57.officinarum hybrid 318 . SES 342.S.S. IND 01 1096).Sclerostachya X S.Eriathus clones (SES 003.Eriathus X S.20 bp ladder. plant height over IR64 (female parent of the introgression line) but showed lower performance than Azucena (donor for QTL for all these traits). The 2 and 3 QTL pyramids were evaluated under aerobic and anaerobic conditions in the field and under non-stress (well-watered) and stress (50% FC) conditions. root volume. expansins. 2. Gandhi Krishi Vigyan Kendra. However. The 3 QTL pyramid in a preliminary investigation with single plant performance showed no significant change in field performance in grain yield. four QTLs were pyramided on 1. Bangalore . Under each of the location.560 065 319 . tiller number. while some are present in more than one QTL regions. Some genes are unique to certain QTL regions. auxin responsive proteins. The sequences indicated that the region harbour a host of genes that confer drought tolerance and disease resistance. 7 and 9 chromosomes. with less number of panicles and are late in maturity. MYB transcription factors. protein kinases. University of Agricultural Science. dehydrins. the pyramids showed significant increase in root length. ROOTS AND PLANT CHARACTERS UNDER SUBMERGED. osmotins and water stress induced WS118 proteins. The results indicated a variety of interaction effects between the QTLs that have been pyramided. root thickness. Initial analyses confirm the genes identified through the in silico analyses. The increase in plant height. There is a significant delay in flowering in the pyramids under submerged conditions with significant increase in grain yield. calcium dependant phosphokinase and a host of hypothetical proteins.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era QTL PYRAMIDING FOR RICE ROOT MORPHOLOGICAL TRAITS AND ITS EFFECT ON GRAIN YIELD. Important genes identified in the QTL regions are C-Repeat Binding Factors. QTL specific genes have been identified. There is also a significant increase in root length and thickness under low moisture stress in the pyramids and varying levels of effect on grain yield per plant. Grace Arul Selvi and Pavana J Hiremath ABSTRACT In this study. the plants are high tillering. AEROBIC AND DROUGHT SITUATIONS Shailaja Hittalmani. 14-3-3 proteins. The method of RNA differential display was also done to identify the genes though the genomics approach. number of panicles per plant with no increase in dry matter accumulation indicated the partitioning of the biomass towards the below ground parts. The genes identified include di-acyl glycerol kinase. S-adenosyl methyl synthetase. The mRNAs of a QTL introgression line upon stress induction were cloned and sequenced between the flanking markers. We are in the process of applying various genomic tools to associate the components of phenotype with specific genotypes. S Geethanjali. Tamil Nadu Agricultural University. Coimbatore .THE BEST AND REST WITH REFERENCE TO BROWN PLANT HOPPER RESISTANCE AND NITROGEN UPTAKE IN RICE Maheswaran.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era TRACING QUANTITATIVE TRAIT LOCI . These homozygous lines are available for field evaluation by the rice breeders. P Meenakshisundaram. A total of 247 RILs (F9) was subject to phenotyping to assess the level resistance to BPH. T Elaiyabharathi. The ongoing genetic map construction involving the 247 RILs of Basmati370/ASD16 using the available simple sequence repeat loci gave clear indication that a saturated genetic map could be possible very soon.641 003 320 . Shanmugasundaram. grain yield and nitrogen uptake. Malarvizhi and K . Govindaraj. rice remains as a model plant for many of the molecular biological studies. grain yield. All the screening experiments to assess the level of resistance to BPH were conducted under greenhouse conditions.Arumugachamy.Gunathilagaraj ABSTRACT In plants. P.P Kadirvel. resistance to planthoppers and grain quality parameters. The initial work on QTL mapping for resistance to brown planthopper (BPH) and nitrogen uptake involving the doubled haploid population of IR64/Azucena resulted in the detection of several genomic regions associated with these complex traits. a mapping population of recombinant inbred lines (RILs) involving Basamti370 (more towards japonica) and ASD16 (indica) was developed. biomass and nitrogen uptake was carried out under field conditions with two different nitrogen regimes.M. The population of RILs available with us is with enormous variation for many of the yield and yield components. next to Arabidopsis. Based on the success we had with IR64/Azucena population. S . S. P. Senthilvel. K K Vinod. The wealth of information generated from these two model plants is enormous. P. Our attempts to establish ways and means to understand the variation for various component and correlated parameters with resistance to BPH and nitrogen uptake indicated that a better resolution is needed in understanding the biology of phenotypic parameters.. Tracing quantitative trait loci (QTLs) governing several complex traits was achieved with the availability of saturated genetic maps of DNA markers in rice. The phenotyping for various agronomic traits. Santa Ram from Central Coffee Research Institute presented how wild species of coffee can be utilized for transferring durable resistance to leaf rust caused by Hemileia vastatrix. Chickpea and Pigeonpea. He also touched upon the utilization on wild species for various novel characters like vertical resistance to several diseases and pests. The cultivated species Coffea arabica which is a tetraploid is susceptible to this disease but the diploid species are resistant. Upadhyaya Dr. he stressed the need for making core collections which should represent maximum diversity of the base collection. S. Dr. Hence.D. Subramaniam on “Biodiversity in Rice” many useful information on the collection and conservation of germplasm at the National and International level was presented. He also emphasized the need for mini core collections when the number in the core collection exceeds thousand. J. He emphasized to bestow more efforts in continuing the good work of conservation of particularly land races for enhancing biodiversity in rice. Upadhyaya from ICRISAT in his lead paper entitled “Enhanced utilization of genetic resources in crop improvement” stressed the importance of germplasm conservation and utilization for all the crop plants. photo period insensitivity. M. Pearl Millet.D. He presented the details of mini core collections made by his group in crops like Groundnut. drought resistance and tolerance to certain adverse soil conditions into cultivated rice. Kadambavanasundaram Dr.R. In the first oral presentation by Dr. In the second oral paper Dr. A. H. H.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era SECOND NATIONAL PLANT BREEDING CONGRESS PLANT BREEDING IN POST GENOMICS ERA Thursday 2. M. The International germplasm collections are very huge and the numbers are intimidating at the utilization point of view. The authors have developed many 321 . March 2006 Technical Session I – Evaluation and utilization of Crop Biodiversity Chair Co-Chair Rapporteurs : : : Dr. early maturity.Kannan Bapu Dr. He also highlighted the use of molecular markers such as SSRs in germplasm characterization. Ganesh Ram One lead paper and six oral presentations were made during the technical session one. The third oral presentation was made by Dr. liberica possessing many resistant genes. Based on his study involving eight families of intervarietal crosses using biometrical estmates. In this study. S. Ph. Dr. Their group had collected 1600 germplasm accession of cassava.D. Dr. He stressed the importance of transferring high grain number per panical from land races for developing high yielding varieties in rice. Preetha. These lines were also test verified for their agronomic suitability in the farmers field. the 150 accessions could be grouped into robust. suggested early generation family selection followed by individual plant selection would improve efficiency of selection. Ms. P. Coimbatore described the “Characterization of cotton (Gossypium hirsutum) genotypes and evaluation of genetic divergence”. 322 . Based on the Mahalanobis D2 analysis. Breeding implications of different plant types were highlighted. semi-compact and compact types of Gossypium hirsutum and studied each group for yield components and quality attributes. consisting of both indigenous and exotic lines. Many selections with desirable attributes have been made by this group with durable resistance and will be useful for crop improvement in coffee. Sugarcane Breeding Institute on “Interfamily variation and family selection in intervarietal crosses in sugarcane under excess water stress conditions”. scholar from Centre for Plant Breeding and Genetics. semi-compact and compact with 67.. Trivandrum. They have isolated Cassava Mosaic Disease tolerant accessions and characterized them for morphological and biochemical characters. she grouped 150 genotypes into three morpho types in cotton viz. P. Chandrasekaran narrated the development of high yielding rice varieties suitable for Kerala using the land races Thavalakannan. Govindaraj. 66 and 17 accessions respectively. Pillai from Central Tuber Crops Research Institute. robust. Tamil Nadu Agricultural University. They have identified high tuber yielding accessions with high amylose as well as with high amylopectine content for various purposes. Santha V.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era arabicoids using species like C. Elevation of the subject considerably during undergraduate higher level with introduction of quantitative genetics as full paper. He highlighted the salient aspects of Mendelian genetics. Funding may be provided by ICAR for the identified centres. It is high time to strengthen germplasm collections and characterize them all in the crops. 3. quantitative genetics and molecular genetics. Arunachalam Dr. 1. Nadarajan Dr. probability and elements of mathematics as full paper in undergraduate lower level is a must in view of recent development of science such as bioinformatics. Arunachalam initiated the proceedings with his lead paper on “ Quantitative Genetics – where are we today?”. Free exchange of core and mini core collections from CGIAR network to ICAR institutes and SAUs may be promoted. M. V. With anguish he expressed that quantitative genetics is becoming a vanishing field. cotton.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Recommendations 1. Arumugachamy The chairman Dr. rice. 2. Five papers dealt with the inheritance and gene action and two were on variability analysis. V. 2. maize and sugarcane. blackgram. 323 . Different centres may be identified for explorations and characterization. Stephen Durairaj Dr. All the available germplasm accessions have to be characterized for novel traits to promote their utility in crop improvement. Technical Session II – Quantitative Genetics and analysis of genotype x environment interaction Chair Co-Chair Rapporteurs : : : Dr. 4. A separate Department of Plant Genetic resources has to be established in all the SAUs. The lead paper was followed by seven oral presentations one each on coconut. The following are the recommendations emerged out of the session discussions. Introduction of basic statistics. S. N. and two in cotton. Senior Scientist. Wellington focussed on the utilization of wild relatives of Sunflower.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 3. coffee. pre breeding programmes being undertaken and its extension to other crops. Amala Joseph Prabakaran. New analytical methods should be justified by sufficient theories. 8. Mendelian. Vaidyanathan Dr. Open evaluation of students performance 6. A. molecular and participatory approaches should be integrated in Plant breeding process to realize better results from crop improvement programs. Elevation of the subject on quantitative genetics to higher level with new analytical tools and field oriented practical examples as full paper at M. Modern teaching aids like teleconferencing may be utilized purposefully. 7.Sc. Kumar The subject of erstwhile interest cytogenetics. Gopalan Dr. to teach and interact with the students. P. 324 . with sufficient allocation of funds 5. Dalmir Singh Dr. He suggested altering the ploidy utilizing the colchiploid route and generation of dihaploids as probable methods to achieve to objectives. creation of alien lines having the wild genome. M. Encouraging teachers to move across institutions for capacity building. level. sugarcane and wide crosses in Vigna sp. Technical Session III Utilization of ploidy breeding in crop improvement Chair Co-Chair Rapporteurs : : : Dr. Identification of a School of Cytogenetics to retouch the science to exploit the rich gene pool for the benefit of farming. General recommendations: 1. IARI – RS. Enlist the experts on quantitative genetics across institutions. The lead speaker Dr. its utilization in improving the crop productivity had been discussed during this session mostly by the emerging scientists which leaves a hope of this grey area of science to come back in picture. The other two lead presentations were on the creation and utilization of higher ploids in wheat and cotton and the utilization of wild species in introgression programme. There was a total of six oral presentations of one paper each in safflower. 4. Public Institutions should be more active in the transgene technology.S. 325 . He explained the advantages of transgenic hybrid cotton in enhancing the yield and effective bollworm control.S.perennis cytoplasm and the performance of CMS based hybrids in chillies in comparison with normal cytoplasm.R. identification of restorer in rice for O. Public Institutes should concentrate more on basic research including new gene identification and functional analysis. Balasundaram Dr.Ravikesavan The first lead paper was presented by Dr.Muralidharan Dr. 3.K.R.R. 2. J. Sree Rangasamy. Hyderabad on transgene technology in cotton. S. Transgenic cotton technology should be extended to varieties also along with hybrids. N. presented a paper on the expression of brix in tomato inter varietal hybrids. Narayanan. The following are the recommendations emerged out of session discussions 1. Agri Genetics Limited. Extending provisions for employing retired cytogeneticists in the academic programmes.V. 5. Amalgamation of the field of cytogenetics with the tissue culture in the identified centres to focus on the post fertilization barriers in wide hybridization attempts and for the rescue of embryos. Technical Session IV – Hybrid Breeding in Crops Chair Co-Chair Rapporteurs : : : Dr. identification of inbreds and restorers in sunflower.barbadense need to be also developed for getting extra long staple varieties. He expressed that brix showed a continuous variation in tomato. Sree Rangasamy Dr. Transgenics in varieties of G. Utilization of molecular cytogenetics to understand the present day biotechnological concepts. 4. The second lead paper by Dr.S. Conservation of wild species in the crops of interest and establishing the series of aneuploids in the field crops at the identified centres. 3. The lead papers were followed by four oral presentations on the development of male sterile lines having resistance to wilt in castor. He elucidated the different kinds of gene action governing brix in the inter-varetial hybrids.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 2. M.Maheswaran Dr. The ferritin gene that he has cloned can be introduced into crop plants in various bio-fortification programmes. Dr.N. N. Active genetic enhancement of parental lines is advocated to develop value added hybrids in field and vegetable crops.Gnanam Dr. SAUs and private sector.R. Josna Mol Kurian used leaf explants for callus induction and established both organogenesis and somatic embryogenesis in pigeon pea.Veluthambi Dr. The molecular analysis to detect single event homozygous lines presented by him should be very helpful in detecting right transgenics and their utility in crop breeding.T. Sandyarani has standardized the protocol for multiple shoot production in pigeon pea. Veluthambi presented the lead paper on combined expression of chitinase and 1-3glucanase in rice resulting in enhanced level of resistance to sheath blight. The following are the general recommendations emanating from the discussions. Ms. Suitable in vitro regeneration protocols with quantitative data should be established and the established protocols should be validated for routine adoptation by the scientists. The regenerants exhibited variations for many agronomic traits indicating the possibilities of using them in sorghum breeding. Avicennia.Rajesh presented the details of pyramiding genes involving transgenics. plants with Xa21+ gna and tlp + gna could be developed. Ajay Parida reported the cloning of a number of useful genes from the mangrove plant. The genes can be used by other groups to engineer crop plant for achieving drought and salt tolerance. Both these works should be helpful for transformation in pigeon pea.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era 4.K. 326 .Ajay Parida Dr. Dr. She found that cotyledonary nodes with cotyledons as suitable explants. The regeneration of plantlets was possible from the calli of both inflorescence and leaf. tlp and gna were used for crossing. 5. Isolating homozygous progenies for both the combinations of genes will have value in rice breeding. Technical Session V -In vitro breeding tools in genetic enhancement of crops Chair Co-Chair Rapporteurs : : : Dr. Dr. There should be an effective linkage between National Institutes. Using the transgenics of ASD16 for Xa21. Kumaravadivel used immature inflorescences and young leaves of sorghum for callus induction. Soframanian The session had one lead paper presented by Dr. x x x The transition from linked markers to gene based markers with respect to major agronomic traits will hasten up the advantages aimed through marker assisted breeding. K. Jena on molecular breeding for BPH and blast resistance in rice followed by seven oral presentations. x The marker assisted breeding for resistance against major biotic and abiotic stress can be achieved with more precision if the information generated through structural genomics can be well complimented with the on-line database information available in the public domain. Technical Session VI – Contributions of genomic tools to crop improvement Chair Co-Chair Rapporteurs : : : Dr. Molecular tagging of traits should be taken up with repeatable markers. Jena Dr. P. Robin Dr. validating and applying the results obtained through QTL analysis. S. K. Wherever possible. There should not be any compromise on the phenotyping as this forms the most significant basis for mapping. 327 . the genetic analysis of transgenics should be done using a large segregating population and association of transgenes with phenotypes should be established. K. molecular tagging fertility restoration gene in cotton and development of DNA markers linked to cytolplasmic genic male sterility in pigeon pea. two on diversity and interspecific hybrid identification in sugarcane.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era When the genes to be introduced in crop systems for specific traits are made available. their positive and negative effects should also be indicated. Two papers were presented on rice molecular breeding. objectives and approaches. The oral presentations had a wide coverage of crops. one each on diversity among mulberry species studied through DNA markers. Shanmuga sundaram Dr. All the oral presentations generated in-depth discussions on the papers and the following recommendations crystallized at the end.K. The validation of QTLs or genes through candidate gene analysis should be perused by utilizing the bioinformatics tools available. x To maximize the benefits out of biotechnological tools. The markers identified through fine characterization of traits such as BPH and blast resistance in rice. a synergy with the basic knowledge of genetics and applied breeding programmes should be encouraged. 328 . fertility restoration in cotton and CGMS in pigeon should be further validated in the breeders’ populations with broad genetic base.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era x x x Marker diversity analysis for predicting the genetic gain from the hybridization may be a forward step while dealing with crops with germplasm of narrow genetic basis. V. N. P. Nagarajan Dr. Sivasamy Members Dr. Maheswaran Members Dr. Surendran Dr. Vijayakumar Dr. K. Manivannan Food Committee Convenor Dr. Veerabadhiran Dr. Maheswaran Dr. Muralidharan Members Dr. Ramasamy Dr. T. Thiruvengedam Accommodation and Transport Committee Convenor Dr. A. AR.K. K. Amala Balu Programme Committee Convenor Dr.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era VARIOUS COMMITTEES Organizing Committee Chairman Dr. Gopalan Dr. Thiyagarajan Members Dr. Rajarathinam Dr. M. S. Iyanar 329 . P. P. Vinod Mrs. V. G. N. N. Balasundaram Dr. Kumaravadivel Dr. S. N. M. P.M. Manonmani Dr. K. Mohanasundaram Dr. Raveendran Secretary Dr. Rajarathinam Dr. Rangasamy Dr. K. J. S. M. M.R. Muthiah Dr. Ravikesavan Dr. C. Govindaraj Dr. Shanmugasundaram Dr. Ganeshram Finance Committee Convenor Dr. P. S. R. K. Thiyagarajan Dr. Kumar Dr. Ganeshamoorthy Dr. S. P. AR. Arumugachamy Dr. Muthiah Members Dr. Geethanjali Dr. N. K. Vaidyanathan Dr. M. S.S. Kannan Bapu Dr. Kumar Dr. S. Sivakumar Dr. Vindhiya varman Dr.R. P. Vaithilingam Mrs. S. Nadarajan Dr. Gnanam Dr. Nirmalakumari Dr.Ganesh Ram Dr. B. M.K. Kadambavanasundaram Dr.Vinod 330 . Subbalakshmi Members Dr. Kalaimagal Dr. K. P. M. R. A. Robin Dr. B. A.R. John Joel Members Dr. T. P.R. Sree Rangasamy Dr. Sundaravelpandian Mr. D. Raveendran Members Dr. L. M.S.Kannan Bapu Dr. Meenakumari Publication Committee Convenor Dr. J. J. Ramalingam Dr. S. Arunprabhu Media and Publicity Committee Convenor Dr. Shanmuganathan Mr. Ganeshram Dr. K. P. N. J. A. B. T. Vijendra Das Members Dr.D. Kannan Bapu Members Dr. Babu Dr. S. M. Paramathma Dr. S. Senguttuvel Poster Session Committee Convenor Dr. Rajeswari Mr. Selvi Dr.Kumar Dr. C. M.Sumathi Dr.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Registration and Reception Committee Convenor Dr. S. Kalamani Dr. Sumathi Editorial Committee Convenor Dr. 2nd Floor. Kompally Quthbullapur Mandal Secunderabad – 500 014 2. Coimbatore – 41 7. Rasi Seeds (P) Ltd. 9. JK Agri Genetics Ltd. & Sons Complex 38. Balaji Paper Stores Unit No. Krishidhan Seeds Ltd.N. Idhayam Food Products Viruthunagar. Pudur.Nagar. Varun Towers Begumpet. Maruthamalai Main Road P.M. Tapadia Terracos Adalat Road Aurangabad – 431 001 6. Hyderabad – 500 016 4.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era LIST OF SPONSORS 1. Salem – 636 102 5. M/s. 273. Nuziveedu Seeds Ltd. M/s. Ajeet Seeds Ltd. 1-10-177. Sri Sai Scientific Company K. M/s. Maharashtra 3.58 SIDCO Industrial Estate Kurichi Coimbatore – 21. 8. # 38 Burkit Road T. M/s. Pelican Instruments Private Limited 2nd Floor. M/s. Chennai – 600 017. M/s. Bhokardan Road Ghanewadi Jalna. Kamarajanar Road Attur. M/s. 183. 4th Floor. The society thank the above contributors 331 . Senior Scientist. Ms. Professor. Associate Professor (Entomology). CPBG. Devaraja Achar A. Student. Coimbatore. Bhagyalakshmi K. Coimbatore. Scholar. Student. TNAU. Ph. Sr.). Taramani. Coimbatore. Univ. JNKVV. Department of Plant Breeding and Genetics..D. Dr.Station. 5A. Dr. Dr. Prabhakaran. Dr. Arulselvi S. Thiruvallur. Department of Forage Crops. Ph. CPBG. Chennai. Coimbatore. CPBG. Scholar. Ms. Valparai. Scholar. Student. Bhavanisagar. Meerut – 250110 (UP). Babu Shareef. Dr.V. CPBG. Coimbatore. Indian Agricultural Research Institute.V. Aslin Joshi J. Ph. National Research Centre for Sorghum. Department of Millets. Dr.D. Anand Agrl. MSSRF. AC & RI Maduari. Amala J. Anantharaju P. Scientist (Sr. Sugarcane Breeding Institute. Coimbatore. Principal Scientist (Breeding). Scholar. Coimbatore. Ashok Kumar K. Alarmelu S. Arutchenthil. Madurai. Dr. Karaikal. Coimbatore. Student. Anand. Scientist. Anil Sirohi. TNAU. National Reseach Centre on Rapeseed Mustard. CPBG. Dr.D. Ezhil maran K. Coimbatore. CPBG. Coimbatore. Ms. Abdel Mahmoud Osman. TNAU.Tea Research Instiutte.N. Coimbatore. Professor (PB&G). Senior Plant Breeder. Chennai. Indore. Chitra K. TNAU. Univercity of Agricultural Sciences. Research Associate. TNAU.D. Former Dean (Retd. Bharathi A. Bala Ravi. Sugarcane Breeding Institute. Sugarcane Breeding Institute. Student. Directorate of Rice Research. CRD Menon Colony. Mr. Associate Professor. Chennai. Agricultural Research Station. Syngenta India Limited. CPBG. Rice Research Station. CPBG. Aananthi M. Dr. Coimbatore. Dr. TNAU.. HC & RI. Professor. Senior Research Fellow. 332 .Res. Department of Cotton. Bangalore. IARI. Coimbatore. Coimbatore. Dr.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era LIST OF REGISTERED PARTICIPANTS Ms. Asish K. Erode. Coimbatore.Res. Ph. Coimbatore. Ms. Central Institute for Cotton Research. Mr. Arunachalam V. Amala Balu P. Mr. Chandrasekharan P. Student. Agricultural College and Research Institute. Hyderabad. Wellington. CPBG. Sugarcane Breeding Institute. TNAU. Associate Professor. Trichy. Student. Asokan G. Student. Amudha J. Coimbatore. Nadia. TNAU. Department of Plant Breeding and Genetics. ADAC & RI. Associate Professor. Dr. Sr. Anbumalarmathi J. Nagpur. Arun Kant Holkar. Elangovan M. Coimbatore. Coimbatore. Arvindbhai Desaibhai Patel. Mr. Research scholarbidhan chandra krishi viswavidyalaya. Anand. Mr. Babu C. scale). SSRF. Division of Ornamental Crops. Mr.D. Coimbatore. Ashok Nagar. Dr. TNAU. Mr. TNAU. Dr. Ganesan K. Mr. Palakkad. Dr. Assistant Professor (PB&G).D. Assoc. Ms. PB&G Kothaneth House. UPASI . Akila T. UAS. Dr. Chandirakala R. PG hostel. Senior Research Fellow. Doncia. Mr. Binodh. Banumathy S. Dr. CHITRA S. Dr. TNAU. Balasaraswathi R. TNAU. Anup Kumar Misra.S. Biju Sidharthan. Mr. CPBG. SVBP Univ Agrl & Tech. Bangalore. Scientist (Senior Scale). Main Veg. Dr. TNAU. Ms. Student.CPBG. Bangalore. Dalmir Singh. Asst. Arun Prabhu D. Dr. Dr. Coimbatore. Scholar. Principal Scientist. Dr.Scientist. TNAU. CPBG. Thendral Nagar. Coimbatore. Madurai. Taramani. Bentur J. Ms. Aduthurai. CPBG. Jabalpur.Scientist. Senior Research Fellow. Arumugachamy S. Dr. Department of Rice. Balasundaram N. Student. Baskaran D. Dr. CPBG. TNAU. Dhanalakshmi. Coimbatore. Ph. Coimbatore. Assistant Professor. Asish Patel. of GPB. Dr. Eradasappa E. Amudha K. Dept. PG Student. 108c. Ganapathy S. Dr. Student. Hessarghatta lake. Dr. Department of Rice. TNAU. Dr. TNAU. Dhananjaya M. Anirban Maji. Ms. ARS. Scholar. Associate Professor. Dr. Scientist. Chennai. Ajay Parida M. Dr. Ph. MSSRF. Ms. Teaching Assistant (PBG). Chandra Gupta. Hyderabad. Scientist(Biotechnology). New Delhi. Ms. M. Student. Coimbatore. Department of Plant Breeding and Genetics. Ms. Dr. TamilNadu Rice Research Institute. student. Dr. Abirami S. Ph.M.D. . Coimbatore. Karthika R. Coimbatore. TNAU. Dr. Agricultural Research Station. Jethabhai Ambalal Patel. Dr. Dr. Centre for Plant Breeding and Genetics. Ms. Scholar. Iyanar K. 5/147 A.). Virudhachalam Dr. Gangappa E. Lecturer. Dept. Mr. A. Jathish P. Gupta R. Mr. Dr. Dr. Dr. Department of Genetics and Plant Breeding. Annamalai Nagar – 608 002. Gnanam R. of Millets. Dr. Annamalai University. Selvam Seeds (P) Ltd. Student. Student. Kammili Anjani. KanchanaraniPhD. CPBG. Dr. Dr. Jayashree P. Assistant Professor. Mr. Centre for Plant Breeding and Genetics. Student. Dr. Mr. Mr. Dept. Ms. Dr. Professor (Genetics) . Gnanamalar R. Assistant Professor. Sugarcane Breeding Institute. Professor (Retd. Centre for Plant Breeding and Genetics. Coimbatore. PG Student. Dr. Professor. AC & RI. Kalaiyarasi R. Dr. Anand Agricultural University. Gokulakrishnan J. Dr. Coimbatore. IndhuBala M. Associate Research Scientist. Dr. Palakkad. Ph. Bidhan Chandra Krishi Viswavidyalaya. Centre for Plant Breeding and Genetics. Tiruvallur. Coimbatore. Department of Cotton. Scientist S2. Immanuel Selvaraj C. Professor. Nadia. Gnanasoundari A. Student. Dr. TNAU. Kannan S. Gunasekaran M. Dept. Senior Scientist (Breeding). Rubber Research Institute.D. HC&RI. AC &RI. Dean. Senior Research Fellow. Coimbotore. Ilavarasu S. Mr. Aduthurai. Scholar. Professor cum CPO. Coimbatore. Department of Millets.CPBG. Kerala. Madurai. Dr. Student. Dr. Kanpur . TNAU.). SRF. Ms. Asociate Professor. Dr. TNAU. Coimbatore. ADAC&RI. of Plant Breeding and Genetics. Bangalore. GPB. Dr. Gupta C. TNAU.Regional Agricultural Research Station. Department of Oilseeds. P. Govindaraj P. toRRS). Coimbatore. Dr. Dr. UAS. Hyderabad. Kanpur. University of Agricultural Sciences. Coimbatore. Coimbatore. ADAC&RI. Geethanjali S. Department of Genetics and Plant Breeding. Jagadeesan S. Coimbatore. Ms. Student. TNAU. Coimbotore. 29 Attur. Coimbatore. Trichy. Gireesh T. Centre for Plant Molecular Biology. Dr. Faculty of Agrl. Kalmeshwer Gouda Patil. Dr. Ph. Dr. Hemant Kumar Yadav. Kanala Basha. Jiji Joseph Assistant Professor . Dr. Coimbatore. No. Kanti Kumar Pradhan Professor. Ms. Coimbatore. Regional Agricultural Research Station. Sugarcane Breeding Institute. Rubber Research Institute of India. Coimbatore. Ananthapur. Associate Professor. TNAU. Lucknow. TNAU. Associate Professor.Centre for Plant Breeding and Genetics. Smt Hima Bindu K. Ms. Immanuel Selavaraj. Gayathri S. Gnanasekaran M. TNAU. Ms. National Botanical Research Institite. Anand. SRF. Bangalore. Madurai. Scientist. Coimbatore. Assistant Professor.Coimbatore. Madurai. Mr. Anand. Jeyaprakash P. CPBG. Gupta. Coimbatore . TNAU.K. CPBG. Coimbatore. Associate Professor (PB&G). TamilNadu Rice Research Institute.B. CPMB. Haribhai Ramsangbhai Kher. Directorate of Oilseeds Research. Hemalatha P. Associate Professor. Kadirvel P . Orissa. Dr. Indumathi T. Kadambavanasundaram M. Dr. Dr. PhD Scholar. Mr. Mr. Barwale Foundation Jalna. Coimbatore. Kottayam – 9. John Joel. Department of PB&G AC&RI.P. Indian Institute of Horticultural Research. Geetha S. Coimbatore. Cuddalore Main Road (Opp. Dr. Jebaraj S. Dr. Anand Agricultural University. Assistant professor. Student. Associate Research Scientist. Dr. Ms. Associate Professor. Coimbatore. Juliet Hepziba S. PG Student. Josnamol Kurian. Bangalore. Bangalore. Student. Hari Ramakrishnan.R. Ganesh Ram S. Sajjanar. Maharastra. Sri Krishnadevaraya University. Coimbatore. S Ph. Research Associate. Coimbatore. Division of Botany.D. Managing Director. CPBG. Gowri M. Department of Pulses. Kandasamy G Professor (Retd. Paramakudi. Assistant Professor. Tamil Nadu Agricultural University. Department of Forage Crops. Assistant Breeder (Sorghum). Senior Scientist (Plant Breeding). 333 . P. Kannan Bapu J. Trichy. Dr.D. CSAUA & T. Ms.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Dr. Student. Madurai. Gopalan A.R. Hemaprabha G. Senior Scientist. CPBG. Ganesamurthy K. Research Scholar.of Genetics. Kalaimagal T. Assistant Professor (Bio Technology). Centre for Plant Breeding and Genetics. Dr. Student. Assistant Professor. Scientist (SS). Department of Cotton. Govindaraj M. Mahadevamurthy M. Dr. Mukeshbhai Jerajbhai. Meerut. Karaikal. Coimbatore. Professor (Biotechnology). Directorate of Oilseeds Research. Saxena Technical Assistant. I Ph. Plant Breeding. Professor and Head (Pulses).S. Meenakshisundaram P. Ltd. Centre for Plant Molecular Biology. Dr. Viswavidyalayakalyani. Anand . Coimbatore. Srinagar. Associate Professor. University. Professor (Oilseeds). Institute. Student. Kulkarni R. Kota Suneetha Student. Dr. Mr. 102. Dr NaemIARI. Student. Victory Apartments. Hebbal. Coimbatore. Dr. CPBG. Neeraj. Teaching Assistant (Plant Breeding). Dr.D. University of Agricultural Sciences. Dr. UP 224 229. Central Sericultural Research And Training Institute. Bangalore. Dr Murugan E. Madurai. Manjunatha Y. Scholar Centre for Plant Moleculaar Biology. Soghum Improvement Project. Research Advisor . Coimbatore. Dr. Nasim Ali. TNAU.Coimbatore. Consultant Mansanto Research Center. Kumarcanj. Murugan A. Kumaravadivel N. Station. TNAU. Student. Dr Mohanraj K. Pajancoa. Madurai. Department of Pulses. Central Potato Research. Ms. Manjunath S. Patel Senior Research. of Kashmir. Dr Manonmani S. NPRC. Professor. Dr. Dr. Ph. Research Scholar. Maheswaran M. Mr. Mr. TNAU. Institute Campus. GKVK. Forest College And Research Institute. Junior Research fellow. Mr. CPBG. Coimbatore. CPBG. Mr. Mathi Thumilan B.R. Dr. Manoharan V. ASSISTANT PROFESSOR. College of Agriculture.S. Malini N. Nirmalakumari A. Professor. Jena Senior Scientist (Plant Breeding). Asst. Dr Mukesh Kumar. Krishnan V. Gudalur. Nagarajan R. Ph. CPBG. International Rice Research. Ph. H. Dr Manimaran R. Hort PG Hostel. Function Lead. Indore. TNAU. Professor. CPBG. Nadarajan N. Mr. Felicon Equipments. Professot (PB&G). Ms. TNAU. TNAU. Ph. CPBG. Coimbatore. C/o Department of Forage Crops. Department of Plant Breeding and Genetics. Anand. Wellington. Assistant Professor. Agri College & Research Institute. GKVK. Professor and Head (Rice). Bangalore. UAS. Agricultural Officer. Biotech Product Support Monsanto Research Center. Kumarakurubaran. Dr. CPMB. Murugan R. TamilNadu Agri. Associate Proffessor. Lalit Kumar Upadhayay. Hybrid Rice Evaluation Centre. Coimbatore. Lal Ahamed Mohammad. Department of Millets.No. Dr. Teaching Assistant. Bangalore. MDUA & Tech. Bangalore. Mr. Associate Professor. Mr.D. Mr. Kingshuk Poddar. Dr. Department of Plant Molecular Biology and Biotechnology. Coimbatore. Coimbatore. Dr Narayanan S. Departmant of Rice. Dept. University of Agricultural Sciences and Technology. Manivannan N. TNAU. Vamban. Nanda C. Coimbatore.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Dr. Coimbatore. Dr. Sopore. Dr. Mohanasundram K. Faizabad. Ms.S. Assistant Main Vegetable Research Station. Dr. Associate Professor.D. Md. Senior Scientist. Dr. CPBG. Mr. Patil Student. Directorate of Rice Research. Coimbatore. Department of Pulses. Ms.JK Agri Genetics LtdFlat No. of Genetics Bidhan Chandra Krishi. 334 . Coimbatore. TNAU. University of Agricultural Sciences. Senior Scientist (Plant Breeding). Scholar (I year). Manjunatha K.D. Coimbatore. Assistant Professor. Oilseeds Research. Dr. Dr Muralidharan V. Sugarcane Breeding Institute. Mohd Nisarkhan. Khadi B. MCICR. Mysore. Dr. 33-63. Coimbatore. Tamil Nadu Agricultural University. Kshirod K. Hyderabad. Dr. SUAS. Coimbatore. Secunderabad. Dr. Coimbatore.Agricultural University. PAJANCOA & RI. Dr Muthiah A. Associate Professor. Malarvizhi D. Deparment of Plant Breeding and Genetics. Kumari Vinodana. Latha . Senior Research Fellow. Student. Assistant Professor. Scholar (PBG). Coimbatore. Dept. Student. Om Prakash Varma. Muthuramu S. Final Year MSc Student University of Agricultural Sciences Bangalore. TNAU. Nagarajan P. CPBG. Mr. CPBG. Dr. Ms. Bangalore. Associate Professor. Sher-e-Kashmir.D. Coimbatore. CPBG.R Assistant Professor. Hyderabad. Mohan K. Nagpur. Bangalore. Mr. Student. Bangalore. TNAU. Principal Scientist (Breeding). Coimbatore. Mr. Lavanya C. Kumar M. Bangalore Bangalore. Pandiyan M. of Genetics & Plant Breeding. Pushpa R. Kanpur. VFAO. Bhavani Sagar. Mr. Raveendran T. Assistant Professor.Tamil Nadu. Ms. Coimbatore.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Dr Paramasivam K. Mother Teresa Hostel. Ms. CPBG. Sakthi A. TNAU. VC. Ms. Dr. Rizwana Banu M. Aduthurai. AC & RI. Assistant Professor. Dr. Coimbatore. KAU. Coimbatore.R. Rubber Research Institute of India. Dr. Student. Coimbatore. V. Department of Agricultural Botany. Dr. Coimbatore. Dr Raja Rathnam S. Ms. Mr. University of Agrl. Raja Srinivas Student. Central Tuber Crops Research Institute. CPBG. Rama Prashat G. Coimbatore. Tamil Nadu Agricultural University Erode. Coffee Research Station. 224. Saravanan K. Teaching Assistant (PBG). Parthiban S. TNAU. Mr. Ms. Coimbatore. Kerala. Tamil Nadu Agricultural University. Coimbatore. Santhanam. Ravikesavan R. Bangalore. Bangalore. CPBG. Coimbatore. Kottayam. TNAU Coimbatore. Lecturer.Founder Chairman. Ms. Senior Scientist (Plant Breeding). Dr. Dr. Dr. Santa Ram A.V.P. Dr Ramana M. Prabhakara Rao G. Reader. Senior Research Fellow. Coimbatore. Mr. TNAU. Tamilnadu Agricultural University. Sabesan T. Professor and Head Department of Plant Breeding and Genetics. Coimbatore. Agricultural Research Station. Rice Research Institute. Salem. Sahi V. Saraswathy R. Department of Agricultural Botany.Muthusamy. Senior Research Fellow. TNAU. CPBG. Student. Senior Research Fellow. Dr.R. Sciences. Raja Raja Cholan. Student.) DRR. Santha V. CPBG. Mr. Annamalai Nagar. TNAU. Dr. Assistant Professor. Regional Agricultural Research Station. Associate Professor. Principal Scientist (Retd. Shobana. Ms Parvathi G.Coffee Research Station. Ms Praveena M.G. Botanist Germplasm Division. Department of Rice. Santha Lakshmi S. Aduthurai. TNAU. Solapur. Scholar Centre for Plant Breeding and Genetics Coimbatore. Professor. Prabhu R. Mr Ram Naresh JRF. Dr. Rasi Seeds. Coimbatore. Coimbatore. TNAU. Senior Scientist (Plant Breeding). Anand. Associate Professor and Head Horticultural Research Station. Student. Scientist. Junior Research Fellow. Karaikal. PG Student. Sandhyarani Nishani. Dr Peter K. Dr. Hyderabad. TNAU. Saravanan N. Senior Scientist Centre on Rabi Sorghum (NRCS). Praveen Mahendrakar. Patil F BAnand. Dr. Mrs. Mandya. Ph. NMR Foundation for R&D. Prasada Rao U. D/o A. Ms Premalatha N. Madurai. TNAU. Dr. Directorate of Oilseeds Research. PPG Educational Institutions Campus. Santha S. 335 . Coimbatore. CPBG. TNAU. Rajeswari S. Vice-Chancellor. SRF. Mrs. Mr. Dr. Ms. PG Hostel Bangalore.Trivandrum. Department of Forages. Dr. Premlatha M. Mr. CPBG. CPBG. Coimbatore. Preetha S.A. Centre for Plant Molecular Biology. Director Centre for Plant Breeding and Genetics. Vice-Chancellor. NH 9 Byepass Road. Associate Professor (Cotton) CPBG. Ramaswamy C. IIi Central Coffee Research Institute. Research Assistant. Ramaswamy N. Consultant. Perumbarai. Managing Director. Department of Rice. Tamilnadu Agricultural University. Bhavani Sagar. TNAU.S.G. Faculty of Agriculture. Dr. Coimbatore. Mr Rajesh Student.V. Ranganatha A. Karasur. Ravishankar C. Faculty of Agriculture. Central Coffee Research Institute.D. Dr Rangaiah S. FARM . Dr. University of Agricultural Sciences. Annamalai Nagar. Division of Botany. of Cotton. Senior Research Fellow Department of Rice Coimbatore. Coimbatore. Dr. Mr. Breeder. PG Student. Prabhakar. Centre for Plant Breeding and Genetics. Tamil Nadu.A. Coimbatore. Dr. Hyderabad. Dr. Pushpam R. Rashmi J. Nehru Nagar. Student. CPMB. Mr Ramaswamy M. Dr. Dept. Guntur. Sai Ram Felicon Equipments. M. Plant Breeding and Genetics. Punitha D. Agricultural University. Coimbatore. Research Associate. NMRFRD Prof. Mr. Associate Professor. Dr. ZARS. Ms Rajalakshmi S. Student. Assistant Professor. TNAU.R. Rajamanickam C. Coimbatore. Teaching Assistant (Hort) Horticultural Research Station Perumbarai. Rice Research Institute. CPBG. Head. Robin S. Pillai Principal. Dr. Dept. Central Sericultural Research And Training Institute. Coimbatore. Professor. Coimbatore. Hyderabad. Shrivastava D. Senior Research Fellow. Sudhir Shukla Senior Scientist. Coimbatore. Coimbatore.C. Srinivasan Street. Selvi B. Stephen Durairaj M. Ph. Sudhagar D. Prof. Dr. Banglaore. Dr. CPBG. Student. Subha L. Singh P. Dr.K. GKVK. Mysore. student. Dr. Genetics and Plant Breeding. Research Associate. Junior Research fellow. Sarkar H. Senguttuvel P. Dr. Sumathi T.G. CPBG. TNAU Coimbatore. HeadBidhan. Shanthi P.Department of Cotton. Sree Rangaswamy S. TNAU.M. Student. Dr. Senthil R. Subramanian M. Assam Jorhat. Scientific Officer . TNAU. Sobhakumari V. Lam Guntur. Dr. Madurai. MC Farm Nandyal R. Coimbatore. Mr. Department of Cotton. Student. Coimbatore. Coimbatore. Coimbatore. Regional Agricultural Research Station. Professor (Retd. Dr.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Mr. Professor and Head Department of Millets.Coimbatore. CPBG. Assam Agricultural University. Sathyanarayana A. Mr.V. Sudhakaran M. 1Dr. Dr. TNAU. Crop improvement Section. Ms. Senior Scientist (Plant Biotechnology). CARDS. Sheela Mary. Department of millets. Dr. Student. CPBG. Selva Kumar R. CPBG. Professor (Retd). Ms. Dr. Coimbatore. CPBG. Research Fellow. Department of Plant Breeding and Genetics. Technical Assistant. Saravanan R. Ms. Senior Breeder121.DNABTD. Oil seeds Section. CPBG. Dr. Agricultural College. Student. Coimbatore. Shobhana V. Coimbatore. Student. Sivasamy N. Mr. Mr. Sukumar M. Department of Plant Breeding and Genetics. Madurai. of Agrl. Subba Rao L. Ms. Dr. Coimbatore. Dr. Senior Research Fellow. Veenus Building.K. Shanthi R. Shanmugasundaram P. Mr. Bhabha Atomic Research Centre. Sr. Mr. Lucknow. Centre for Plant Molecular Biology. Dr. Coimbotore. Sidhartha Mishra. Sugarcane Breeding Institute. Senior Scientist. Shailaja Hittalmani. Shimna Bhaskaran. No. Department of Genetics & Plant Breeding.). TNAU. Director (Retd. Rajaji Street. Sheeba A. Kanpur. Senthil Kumar K. Kushwaha. Sugarcane Breeding Institute. Bangalore. 336 . Coimbatore. CPBG. Associate Professor. Shanmugam T. Student. Senior Research Fellow. Coimbatore. CPBG. Tamil Nadu Agri. Sugarcane Breeding Institute. Selvaraju K. Ms. Mr. Student. Annamalai University. Dr. Central Sericultural Research And Training Institute. Professor and Head Department of Cotton. Directorate of Rice Research. Senthil Kumar P. Madurai. Associate Professor. Dr. Coimbatore. Coimbatore.D.R. Annamalai University. Mysore. Monsant o Research Centre. Centre for Plant Molecualr Biology. Sumathi P. National Botanical Research Institute.S. Professor. Ms. University. Ph. Dr. TNAU. Dr. Directorate of Research. Chandra Krishi Viswavidyalaya. HC&RIP. Centre for Plant Breeding and Genetics. Annamalai nagar – 608 002. Mr. CPBG. Shanmuganathan M. TNAU. Junior Research Fellow. Nadia. Ms. CPBG.D. Scientist. & Technology. Ms. Hyderabad. Dr.K. Associate Professor. S. Sivakumar. Jorhat-13.D Student. Sr. Dr. TNAU. Sharmila V. Madyapradesh. Dr. Coimbatore. Dr. SRFCPBG. Dr. Sumathi K. Coimbatore. Senior Scientist. Mr. Dr. Sharanappa S. Plot #9. Mumbai. eriyakulam. Coimbatore. Shivbachan S. Bangalore. Coimbatore. Ms. Dr.). Shobha Rani N. Senthil Kumar N. 25. Saravanan S. CPBG. Railway Station Road Salem (Dt) Ms. Principal Scientist. Associate Professor. Senior Research Fellow. Scientist (SS). Senthur Xerox. Botany. TNAU. Azad University of Agric. Centre for Plant Molecular Biology. Senior Lecturer in GPB.P. Associate Professor. Subba Rao M. Coimbatore. Chidambaram. SRF. Student. Faculty of Agriculture. Dr. TNAU. Coimbatore. Sunayana Rathi. Coimbatore. Directorate of Rice Research. University of Agricultural Sciences.R. Trivandrum. Sivakumar S. Selva Rani E. Reader in Genetics and Plant BreedingFaculty of agriculture. Souframanien J. Department of Pulses. JNKVV. TNAU. Assistant Professor. TNAU. Sridhis Nivas. Selvi A. Jabalpur.S. Madurai. M. Tamil Nadu Agricultural University. Suresh R. Veeresh Gowda Student. CPBG. Kelamangalam Road. Thiagarajan C. Vindhyavarman P. Plant Breeder Centre for Plant Breeding and Genetics. Dr. Dr. Coimbatore. Suvendu Mondal. Department of Plant Breeding and Genetics. CPBG. Student. Coimbatore. CP Rasi Seeds. Coimbatore.V. Professor Soil & Water Management. Tamil Nadu Agricultural University. Sunil Kumar B. CPBG. SRF Centre for Plant Breeding and Genetics. TNAU. Student. Viswanath S. Coimbatore. Uma Maheswari D. in the Department of Genetics Bidhan. Coimbatore. Dr. Professor and HeadDepartment of Forage Crops. CPBG. Velmurugan M. Vijaya Kumar L. Vengadessan Ph. Mumbai. Wilson D. Thiyagu K. Botany Section. Upadhyaaya H. College Of Agriculture. Dr. Student. Mr. Student Room. UAS. Tamilarasi P. Vellayani Kerala Agri. Anand. Dr. Student . Mr. Tirthartha Chattopadhyay Final Year Student. Ms. Ms. Centre for Plant Breeding and Genetics. Mr. Botany. Professor. Dr. HC&RI Coimbatore. Vetriventhan M. Dr. Vijendra Das L. Student. Yogeesh.G.Nagapattinam. TNAU. Coimbatore. Research Institute. Sundaravel pandian K. Coimbatore.K. Uma Devi M. National Research Centre for Sorghum. Scientific Officer. Mr.K. TNAU. Research Fellow. Hyderabad. Thangapandian R. Nagpur (MS). Mr. Ms. Bangalore.Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era Mr. Thati Srinivas Scientist (Plant Breeding). Yazhini student. Hyderabad. CPBG. Coimbatore. Coimbatore. Vivekanandan P. Vaithilingam R. Dr. Departmant of Rice. Madurai Dr. Thiyagarajan K. Coimbatore. Dr. Veerabhdran P. Dr. Mr. GKVK.N. DICRISAT. Yogameenakshi Student. Mr. Coimbatore. Coimbatore. Bhabha Atomic Research Centre. Tirthankar Biswas Research Scholar. Dr. Vengadesan V. 305. Venkata Sadasiva Rao K. Vijayaraghavan V. # 180. Tamaraiselvan Student. Vijayakumar G. of Genetics and Plant Breeding. Dr. Mr. NAARM. CPBG. Mr. L. Dr. Dr. Madurai. Dr. Student. Mr.D scholar. Coimbatore. Mr. Bangalore. Dr. Patencheru. Research Scholar. College of Agriculture.Centre for Plant Breeding and Genetics. TNAU. Annamalainagar. Professor and Head Department of Oilseeds. Acharya N. Madurai. Vinod K. Dr. Coimbatore.M. Mr. Umakanth A. Mr. Student. AP. Thangaraj K. Scientist (Senior Scale). Dr. Professor Dept of Rice. Vijayan Nair N. Former Director of Publications. Associate Professor. Lecturer. Mr. Bangalore University. Pearl Millet building. Veluthambi K. Gawande Assistant Professor of Agrl. Hyderabad. Dharward. Annamalai University.(Agriculture). 337 . Suresh Ramalingam Senior. Dr. SPIC Ltd. TNAU. Research Scholar Gujarat Agricultural University. Thanga Hemavathy A.P. Mr. PhD Scholar. Professor CPBG. Coimbatore. Teaching Assistant Department of Agrl.Sc. Coimbatore. Vinothini S. College of Agriculture. Yadla Suneetha. Botany. SRFCPMB. Ms. Krishi Vigyan Kendra. Student. Hosur. TNAU. Thiruvengedam V. Tiwari S. Senior Research Fellow.Coimbatore. Dr. PG student. Coimbatore. Dr. Department of Genetics Bidhan Chandra Krishi Viswavidyalaya Nadia. Department of Plant Breeding and Genetics. University Thiruvananthapuram. Umashankar P. Dr. Assistant Professor (Genetics). TNAU. Breeder. TNAU. ICRISAT. Sikkal. Coimbatore Dr. Department of Millets. TNAU. coimbatore. Centre for Plant Breeding and Genetics. PG Hostel. Coimbatore. CPBG Coimbatore. Director Sugarcane Breeding Institute. Coimbatore. Dept. TNAU. Professor and Head. Ms.S RF Department of Pulses. Ranga Agricultural University. Salem. Director. Coimbatore. Mr. Mr. Chandra Krishi Viswavidyalaya Nadia. Second National Plant Breeding Congress 2006 Plant Breeding in Post Genomics Era . 641 003. India.Jointly organized by Indian Society of Plant Breeders & Tamil Nadu Agricultural University Coimbatore . .