Genomics 72, 153–157 (2001) doi:10.1006/geno.2001.6450, available online at http://www.idealibrary.com on
Genomic Organization, Physical Mapping, and Involvement in Yq Microdeletions of the VCY2 (BPY 2) Gene Liborio Stuppia,* ,† Valentina Gatta,* Isabella Fogh,‡ Anna Rita Gaspari,* Elisena Morizio,* ,§ Rita Mingarelli, ¶ Mariella Di Santo,㛳 Antonio Pizzuti, ¶,1 Giuseppe Calabrese,* ,§ and Giandomenico Palka* ,§ ,2 *Dipartimento di Scienze Biomediche, Sezione di Genetica Medica, Universita` “G. D’Annunzio,” Chieti, Italy; †Istituto di Citomorfologia Normale e Patologica CNR, Chieti, Italy; ‡Istituto di Clinica Neurologica, Universita` di Milano, Ospedale Policlinico IRCCS, Milano, Italy; §Servizio di Genetica Umana, Ospedale Civile di Pescara, Pescara, Italy; ¶ IRCCS-CSS Mendel, Rome, Italy; and 㛳 Istituto di Medicina della Riproduzione, Chieti, Italy Received September 5, 2000; accepted November 10, 2000; published online March 1, 2001
VCY2 is a gene positioned within the AZFc locus of the Y chromosome, a region frequently deleted in infertile males. To investigate the involvement of this gene in idiopathic male infertility, we studied its genomic organization and localization. Analysis of the genomic structure demonstrated that the VCY2 gene is composed of 9 exons spanning 21 kb. FISH analysis on interphase nuclei with specific probes for exons 4 – 6, 7, and 8 demonstrated the presence of a single gene copy, and Fiber-FISH on relaxed chromatin indicated that VCY2 is located within the DAZ gene cluster. PCR, Southern blot, and FISH analysis on infertile patients with Yq microdeletions demonstrated the absence of VCY2 in all cases where deletions involved the DAZ gene, raising the question about the role of the VCY2 gene loss in the phenotype reported for DAZ-deleted patients. © 2001 Academic Press
INTRODUCTION
Since the original observation of Tiepolo and Zuffardi (1976), who postulated the presence of one or more genes controlling spermatogenesis on the long arm of the Y chromosome (Yq), many efforts have been devoted to the identification of genes related to male infertility within Yq. Different reports have demonstrated that about 10 –15% of infertile patients with the normal karyotype are carriers of Yq microdeletions (Reijo et al., 1995; Stuppia et al., 1996a, 1998; Najmabadi et al., 1996; Foresta et al., 1997; Pryor et al., 1997; McElreavy and Krausz, 1999). These microdeletions are clustered within intervals 5 and 6 of the Y 1
Present address: Dipartimento di Medicina Sperimentale e Patologia, Universita` “La Sapienza,” Rome, Italy. 2 To whom correspondence should be addressed at Dipartimento di Scienze Biomediche, Sezione di Genetica Medica, Universita` “G. D’Annunzio,” via dei Vestini 35, 66013 Chieti, Italy. Telephone: (39) 0871 3554137. Fax: (39) 0871 3554135. E-mail:
[email protected].
chromosome in three nonoverlapping hot spot regions, defined as AZFa, AZFb, and AZFc (Vogt et al., 1996). So far, at least 12 genes (or gene families) have been isolated from these regions (Ma et al., 1993; Reijo et al., 1995; Lahn and Page, 1997; Sargent et al., 1999). Due to their localization within the AZF loci, and the specific testicular expression of the majority of them, these genes might play a role in male infertility. However, so far only a few of them have been fully characterized and are routinely investigated in infertile patients, including RBMY (Ma et al., 1993), DAZ (Reijo et al., 1995), USP9Y (Brown et al., 1998; Sun et al., 1999), and DBY (Foresta et al., 2000). Thus, the characterization of the other genes mapped within the AZF loci is of great importance for the study of their involvement in patients with idiopathic infertility. Since our previous studies suggested the presence of an oligozoospermia critical region within subinterval 6E of the Y chromosome (Stuppia et al., 1996b, 1997), we focused our attention on the VCY2 (variable charge Y 2, alias BPY2) gene, which has been mapped to this subinterval (Lahn and Page, 1997). MATERIALS AND METHODS Characterization of genomic structure of VCY2. A human Y chromosome YAC library (Research Genetics, Huntsville, AL) was screened by PCR with primers for VCY2 available in the literature (Lahn and Page, 1997). One of the selected YAC clones (yOX101) was subcloned into a cosmid library. Cosmid clones containing VCY2 were identified by hybridization with oligonucleotides specific for the 5⬘ and 3⬘ regions of the cDNA sequences. Sequences of these clones were compared to the reported cDNA sequence of VCY2 (GenBank No. AF000980) to detect intron/exon boundaries. After the characterization of the genomic structure of VCY2, the YACs showing presence of this gene were tested again by PCR with primers specific for exon 7. PCR analysis of infertile patients. Specific primers for exons 3, 4, 5, 6, 7, and 8 –9 were derived from the genomic sequence of VCY2 gene (Table 1). For exons 1–2, primers reported by Lahn and Page (1997) were used. PCR analysis was performed on DNA from peripheral blood of 11 infertile patients who were carriers of previously
153
0888-7543/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
154
STUPPIA ET AL.
TABLE 1 Sequence of the Primers Used for the Amplification of VCY2 Exons and Size of the Amplification Product Exon
Forward
Reverse
Size (bp)
3 4 5 6 7 8, 9
TTTTTCCTGGCAATAGTGTG CTCTGCCCACAGGTGATA CCATTTTCTAGGTGTTTTCA TAATAGGCATAGTGCTTAGG TGTCATATTGGGATAGGT GACTGCAAAAACTGGGTAA
ACTTGGCCTGTGAGCAG TGCGGGCTATAACAAGG CATCTTTGTGGTGTATTTGC AAGGAAAGGGAGTCAACT GGCCAAGGAAGTAGAA TTTATTTGCAGGTTCTGTTC
178 184 528 546 264 488
detected Yq deletions (patients 1–11), 4 with azoospermia (patients 1– 4) and 7 with oligozoospermia (patients 5–11). Namely, 5 patients had terminal deletions, with breakpoint within interval 5 in 1 case (patient 1), subinterval 6A in 3 cases (patients 2– 4), and subinterval 6E in the last case (patient 5). The remaining 6 patients had interstitial deletions of AZFc involving either subintervals 6D– 6E, with loss of the DAZ gene (patients 6 –9), or subinterval 6E alone (patients 10 and 11). Twenty normal males and 5 females were analyzed as positive and negative controls, respectively. PCRs were performed with 35 rounds of the following cycle: 94°C for 1 min, 58°C for 1 min, 72°C for 1 min. RT-PCR analysis. Total RNA was extracted by fine-needle aspirate from the testis of patient 7 (whose testis histology showed a spermatogenetic arrest at the spermatocyte level) and of five controls (infertile patients with congenital bilateral absence of the vas deferens but with normal spermatogenesis) using RNAble solution (Eurobio, Milano, Italy). First-strand cDNA was synthesized using random hexamers as primers. The VCY2 transcript was PCR amplified using two primer pairs encompassing bases 62–545 and 490 –968 of the cDNA sequence. As controls, transcripts of G3PDH and TTY1 (a gene mapped within Yp) were amplified. Southern blot analysis. Southern blot analysis was carried out on EcoRI-digested DNA of normal males, females, and one patient with terminal Yq deletion (patient 2). The probe was an 8-kb PCR fragment of the VCY2 gene encompassing exon 7, intron 7, and exon 8 (probe 7FR). FISH analysis. FISH analysis was carried out on acetic acid– methanol-fixed cells from peripheral blood cultures of healthy controls and of the previously described patients with Yq microdeletions. Three different probes for VCY2 were used: 4F6R (a 3.8-kb PCR fragment encompassing exons 4 – 6), 1F3R (a 3.5-kb fragment encompassing exons 1–3), and the above-described 7FR. Two-color FISH analysis was performed with one of the VCY2 probes together with a plasmid probe for the SRY gene (pHu14) (Sinclair et al., 1990). Fiber-FISH analysis was carried out on relaxed chromatin according to Fidlerova et al. (1994) with the 4F6R or 7FR probe together with probe 7A69M for the DAZ gene (Glaser et al., 1998).
RESULTS
VCY2 Genomic Structure Screening of a human Y chromosome YAC library with specific primers for the VCY2 gene produced a
FIG. 1.
PCR product of about 350 bp in YAC clones yOX101, yOX21, yOX103, yOX190, and yOX120. Sequencing of this band demonstrated the presence of nucleotides 14 –32 and 33–77 of the reported VCY2 cDNA product divided by a further 273 bp of nontranscribed sequence. YAC yOX101 was subcloned in cosmids, and cosmid clone 26 was identified as containing the entire VCY2 sequence. Sequencing of this clone allowed the identification of the genomic structure of VCY2, which spans 21 kb and consist of nine exons, with the first ATG codon within exon 4 and a termination codon within exon 8 (Fig. 1). The YAC clones showing the presence of VCY2 were tested again by PCR primers specific for exon 7. Only clones yOX101 and yOX21 showed an amplification product. PCR Analysis of Infertile Patients PCR analysis with primers derived from the intronic sequences flanking VCY2 exons produced a band of the expected size for each exon in normal male controls, and the nucleotide sequence of the amplification products was confirmed by direct sequencing. No amplification product was present in females, except for some bands appearing when PCR amplification of exon 3 was performed with annealing at 56°C. These bands, with sizes different from the genuine band of exon 3, are likely of autosomal or X-linked origin, being present in both male and female subjects (Fig. 2). A normal amplification was observed also in patients 5, 10, and 11, deleted in 6E but retaining DAZ. On the other hand, patients 1– 4 and 6 –9, with deletions involving DAZ, showed no amplification product, except for a pale band after amplification of exons 1–2 in patients 4 and 6 –9 (Fig. 2). In patients 4, 6, and 7, the band of exon 4 was also detected.
Genomic organization of the VCY2 gene. Horizontal bars indicate the position of the probes 1F3R, 4F6R, and 7FR within VCY2.
155
GENOMIC ORGANIZATION OF THE VCY2 GENE
DISCUSSION
FIG. 2. Agarose gel showing deletion of exons 3 (lane 2), 4 (lane 4), and 7 (lane 6) of VCY2 in an infertile patients (patient 8). Note the presence of a pale band for exons 1–2 (lane 8). Lanes 1, 3, 5, 7, and 9, normal male control. The additional bands, likely of autosomal or X-linked origin, present in the runs of exon 3 are produced also in female samples at an annealing temperature of 56°C and are used as an internal control.
RT-PCR RT-PCR analysis showed amplification products of the expected sizes for VCY2, G3PDH, and TTY1 in control subjects. In contrast, the patient with the Yq deletion (patient 7) showed amplification of only G3PDH and TTY1. Southern Blot Analysis Southern blot on EcoRI-digested DNA from normal males using the 7FR probe disclosed a main signal at 22 kb, as expected by the presence of EcoRI digestion sites 3.4 kb upstream of the first exon and within intron 7. This band was not present in the patient with the terminal Yq deletion (patient 2) (Fig. 3). In addition to this band, male samples showed weaker smaller fragments absent from female DNA. The origin of these bands is unknown, although the presence of other diverged members of the family on the Y chromosome cannot be excluded. Moreover, Southern blot showed the presence of several fragments common to males and females, which could likely represent autosomal or X-linked homologues of VCY2.
The analysis of Yq deletions in infertile males has prompted the identification of several genes related to spermatogenesis (Ma et al., 1993; Rejio et al., 1995; Lanh and Page, 1997). Analysis of genes involved in Yq deletions is difficult, as most of them are multicopy and scattered along the Y chromosome. Also, the VCY2 (BPY2) gene was originally described as a multicopy gene, positioned in subinterval 6E in a study performed using primers for the 5⬘ region of the gene (Lahn and Page, 1997). The localization of VCY2 in a region frequently rearranged in infertile patients has prompted the study of its organization and relationship to infertility occurring in males with Yq deletions. VCY2 spans 21 kb on the Y chromosome and is composed of nine exons. However, only five exons are likely translated in amino acids, since the putative start codon of the largest open reading frame lies within exon 4 and the termination codon lies in exon 8. Following characterization of the genomic sequence of VCY2, we derived primers for each exon as well as different intragenic probes used for FISH and Southern blot analysis. This approach has helped us in deciphering some unknown characteristics of VCY2. In particular, we found a single complete VCY2 copy within the DAZ gene cluster (subinterval 6D) and multiple partial copies scattered along Yq, mostly represented by its 5⬘ untranslated exons. This result was obtained by FISH analysis using probes 4F6R and 7FR, which show a single signal in interphase nuclei. In addition Fiber-FISH disclosed VCY2 signal within the signals corresponding to the multiple copies of the DAZ cluster (Glaser et al., 1998; Saxena et al., 2000). Probe 1F3R, which corresponds to the genomic region covering the first three untranslated exons and their intervening sequences, showed multiple signals within Yq, representing nonfunctional copies. This was confirmed by RT-PCR analysis on testis RNA of an infertile patient with an AZFc deletion involving VCY2, which indicated no gene transcript, although genomic analysis of this patient showed the presence of exons
FISH Analysis FISH analysis of interphase nuclei using 7FR and 4F6R probes showed in normal males a single VCY2 signal. In the chromosome spreads, this signal was localized onto band Yq11 (Fig. 4A). Fiber-FISH analysis disclosed the VCY2 signal within the DAZ gene cluster (Fig. 4B). FISH with the 1F3R probe showed a quite large signal on the Y chromosome and multiple signals in the interphase nuclei (Fig. 4C). FISH analysis with the 4F6R and 7FR VCY2 probes showed no signal in patients 1– 4 or 6 –9 (Fig. 4D) while a normal signal was present in patients 5, 10, and 11. The results of PCR and FISH analysis are reported in Table 2.
FIG. 3. Southern blot showing deletion of VCY2 gene in an infertile patient (patient 2).
156
STUPPIA ET AL.
FIG. 4. FISH and Fiber-FISH analysis of the VCY2 gene. (A) 7FR probe showing a single signal on the long arm of the Y chromosome and in an interphase nucleus. (B) Fiber-FISH with probe 7FR for the VCY2 gene (pink) and probe 7A69M for the DAZ gene (yellow). Two different levels of chromatin relaxation are shown. (C) 1F3R probe showing multiple signals on the long arm of the Y chromosome and in an interphase nucleus (yellow); pHu14 probe showing the single signal of the SRY gene (pink). (D) deletion of the VCY2 gene in an infertile patient. Only the signal of the SRY gene is present.
1–2. VCY2 had been originally positioned within subinterval 6E (Lahn and Page, 1997). However, FISH and PCR results of the present study clearly demonstrate that VCY2 is located outside subinterval 6E. Fiber-FISH detected a single copy of VCY2 within the DAZ cluster (subinterval 6D), while PCR showed that VCY2 was retained in patients with disruption of subinterval 6E alone. Based on this refinement of VCY2 mapping, we have investigated a group of infertile patients to check whether subjects with a full deletion of DAZ genes were also deleted for VCY2. This invariably was the case for eight examined patients. Similar results were reported by Krausz et al. (1999), for three
patients with loss of the DAZ gene cluster, and by Saut et al. (2000), for a family with four carriers of the Yq microdeletion. Thus, although the DAZ family remains one of the strong candidates for AZFc, a role of the VCY2 gene in spermatogenesis cannot be excluded. Therefore analysis of VCY2 using primers specific for the regions of the gene that are not repetitive (exons 5 to 9) is highly recommended in all infertile patients submitted to the Yq microdeletion screening. In conclusion, this study provides information on the structure and localization of VCY2 and its involvement in Yq microdeletions. Further studies are in progress on larger samples of infertile patients to assess the fre-
TABLE 2 PCR and FISH Analysis of VCY2 in Infertile Patients with Yq Deletions Patient
Yq deletion
BPY2 analysis (PCR)
FISH (probes 4F6R-7FR)
1 2 3 4 5 6 7 8 9 10 11
5Q–qter 6A–qter 6A–qter 6A–qter 6E–qter 6D–6E 6D–6E 6D–6E 6D–6E 6E 6E
No amplification No amplification No amplification Amplification of exons 1–2 and 4 Amplification of all exons Amplification of exons 1–2 and 4 Amplification of exons 1–2 and 4 Amplification of exons 1–2 Amplification of exons 1–2 Amplification of all exons Amplification of all exons
No signal No signal No signal No signal Positive No signal No signal No signal No signal Positive Positive
GENOMIC ORGANIZATION OF THE VCY2 GENE
quency of VCY2 deletions, to look for the presence of point mutations in individuals without any obvious Yq deletion, and to find out the role of this gene in the spermatogenesis process. ACKNOWLEDGMENTS The authors thank Pauline Yen for critically reading the manuscript and for providing probe 7A69M, and P. N. Goodfellow for providing the pHu14 probe. The financial support of Telethon Italy (Grant. N. E.832) and of the Italian M.U.R.S.T 1999 is gratefully acknowledged.
REFERENCES Brown, G. M., Furlang, R. A., Sargent, C. A., Erickson, R. P., Longepied, G., Mitchell, M., Jones, M. H., Hargreave, T. B., Cooke, H. J., and Affara, N. A. (1998). Characterization of the coding sequence and fine mapping of the human DFFRY gene, and comparative expression analysis and mapping to the Sxrb interval of the mouse Y chromosome of the Dffry gene. Hum. Mol. Genet. 7: 97–107. Fidlerova, H., Senger, G., Kost, M., Sanseau, P., and Sheer, D. (1994). Two simple procedures for releasing chromatin from routinely cells for fluorescence in situ hybridization. Cytogenet. Cell Genet. 65: 203–205. Foresta, C., Ferlin, A., Garolla, A., Rossato, M., Barbaux, S., and De Bortoli, A. (1997). Y-chromosome deletions in idiopathic severe testiculopathies. J. Clin. Endocrinol. Metab. 82: 1075–1080. Foresta, C., Ferlin, A., and Moro, E. (2000). Deletion and expression analysis of AZFa genes on the human Y chromosome revealed a major role for DBY in male infertility. Hum. Mol. Genet. 9: 1161– 1169. Glaser, B., Yen, P. H., and Schempp, W. (1998). Fibre-fluorescence in situ hybridization unravels apparently seven DAZ genes or pseudogenes clustered within a Y-chromosome region frequently deleted in azoospermic males. Chromosome Res. 6: 481– 486. Krausz, C., Bussani-Mastellone, C., Granchi, S., McElreavy, K., Scarselli, G., and Forti, G. (1999). Screening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection. Hum. Reprod. 14: 1717–1721. Lahn, B. T., and Page, D. C. (1997). Functional coherence of the human Y chromosome. Science 278: 675– 680. Ma, K., Inglis, J. D., Sharkey, A., Bickmore, W. A., Hill, R. E., Prosser, E. J., Speed, R. M., Thomson, E. J., Jobling, M., Taylor, K., Wolfe, J., Cooke, H. J., Hargreave, T. B., and Chandley, A. C. (1993). A Y chromosome gene family with RNA binding protein homology: Candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell 75: 1287–1295. McElreavy, K., and Krausz, C. (1999). Male infertility and the Y chromosome. Am. J. Hum. Genet. 64: 928 –933. Najmabadi, H., Huang, V., Yen, P., Subbarao, M. N., Bhasin, D., Banaag, L., Naseeruddin, S., de Kretser, D. M., Baker, G. H. W., McLachlan, R. I., Loveland, K. A., and Bhasin, S. (1996). Substantial prevalence of microdeletions of the Y-chromosome in infertile men with idiopathic azoospermia and oligozoospermia detected using a sequence-tagged site-based mapping strategy. J. Clin. Endocrinol. Metab. 81: 1347–1353. Pryor, J. L., Kent-First, M., Muallem, A., Van Bergen, A. H., Nolten, W. E., Meisner, L., and Roberts, K. P. (1997). Microdeletions in the Y chromosome of infertile men. N. Engl. J. Med. 20: 2534 –2539.
157
Reijo, R., Lee, T. Y., Salo, P., Alagappan, R., Brown, L. G., Rosemberg, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O., de La Chapelle, A., Silber, S., and Page, D. C. (1995). Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat. Genet. 10: 383–392. Sargent, C. A., Boucher, C. A., Kirsch, S., Brown, G., Weiss, B., Trundley, A., Burgoyne, P., Saut, N., Durand, C., Levy, N., Terriou, P., Hargreave, T., Cooke, H., Mitchell, M., Rappold, G. A., and Affara, N. A. (1999). The critical region of overlap defining the AZFa male infertility interval of proximal Yq contains three transcribed sequences. J. Med. Genet. 36: 434 – 441. Saut, N., Terriou, P., Navarro, A., Levy, N., and Mitchell, M. J. (2000). The human Y chromosome genes VCY2, CDY1 and DAZ are not essential for sustained fertility. Mol. Hum. Reprod. 6: 789 –793. Saxena, R., de Wries, J. W. A., Repping, S., Alagappan, R. K., Skaletsky, H., Brown, L. G., Ma, P., Chen, E., Hovers, J. H. N., and Page, D. C. (2000). Four DAZ genes in two clusters found in the AZFc region of the human Y chromosome. Genomics 67: 256 –267. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A. M., Lovell-Badge, R., and Goodfellow, P. N. (1990). A gene for the human sexdetermining region encodes a protein with homology to a conserved DNA binding motif. Nature 346: 240 –244. Stuppia, L., Mastroprimiano, G., Calabrese, G., Peila, R., Tenaglia, R., and Palka, G. (1996a). Microdeletions in interval 6 of the Y chromosome detected by STS-PCR in 6 of 33 patients with idiopathic oligo- or azoospermia. Cytogenet. Cell Genet. 72: 155–158. Stuppia, L., Calabrese, G., Guanciali Franchi, P., Mingarelli, R., Gatta, V., Palka, G., and Dallapiccola, B. (1996b). Widening of a Y-chromosome interval-6 deletion transmitted from a father to his infertile son accounts for an oligozoospermia critical region distal to the RBM1 and DAZ genes. Am. J. Hum. Genet. 59: 1393–1395. Stuppia, L., Gatta, V., Mastroprimiano, G., Pompetti, F., Calabrese, G., Guanciali Franchi, P., Morizio, E., Mingarelli, R., Nicolai, M., Tenaglia, R., Improta, L., Sforza, V., Bisceglia, S., and Palka, G. (1997). Clustering of Y chromosome deletions in subinterval E of interval 6 supports the existence of an oligozoospermia critical region outside the DAZ gene. J. Med. Genet. 34: 881– 883. Stuppia, L., Gatta, V., Calabrese, G., Franchi, P. G., Morizio, E., Bombieri, C., Mingarelli, R., Sforza, V., Frajese, G., Tenaglia, R., and Palka, G. (1998). A quarter of men with idiopathic oligoazoospermia display chromosomal abnormalities and microdeletions of different types in interval 6 of Yq11. Hum. Genet. 102: 566 –570. Sun, C., Skaletsky, H., Birren, B., Devon, K., Tang, Z., Silber, S., Oates, R., and Page, D. C. (1999). An azoospermic man with a de novo point mutation in the Y-chromosomal gene USP9Y. Nat. Genet. 23: 429 – 432. Tiepolo, L., and Zuffardi, O. (1976). Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm. Hum. Genet. 34: 119. Vogt, P. H., Edelmann, A., Kirsch, S., Henegariu, O., Hirschmann, P., Kiesewetter, F., Kohn, F. M., Schill, W. B., Farah, S., Ramos, C., Hartmann, M., Hartschuh, W., Meschede, D., Behre, H. M., Castel, A., Nieschlag, E., Weidner, W., Grone, H. J., Jung, A., Engel, W., and Haidl, G. (1996). Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum. Mol. Genet. 5: 933–943. Yen, P. (1998). A long range restriction map of deletion interval 6 of the human Y chromosome: A region frequently deleted in azoospermic males. Genomics 54: 5–12.